ID: 1146685295

View in Genome Browser
Species Human (GRCh38)
Location 17:34837380-34837402
Sequence GGCCTGGTAGAACATCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685295_1146685302 3 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685302 17:34837406-34837428 CAGAGAGATTGAGGGAAATGAGG No data
1146685295_1146685298 -6 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685295_1146685299 -5 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685299 17:34837398-34837420 AGGCCCAGCAGAGAGATTGAGGG No data
1146685295_1146685303 12 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685295 Original CRISPR GGCCTGGTAGAACATCTTCA GGG (reversed) Intergenic
No off target data available for this crispr