ID: 1146685297

View in Genome Browser
Species Human (GRCh38)
Location 17:34837396-34837418
Sequence CTCAATCTCTCTGCTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685297_1146685303 -4 Left 1146685297 17:34837396-34837418 CCAGGCCCAGCAGAGAGATTGAG No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685297 Original CRISPR CTCAATCTCTCTGCTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr