ID: 1146685298

View in Genome Browser
Species Human (GRCh38)
Location 17:34837397-34837419
Sequence CAGGCCCAGCAGAGAGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685291_1146685298 17 Left 1146685291 17:34837357-34837379 CCCTGGTGCAGGACAGGTAGCCA No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685292_1146685298 16 Left 1146685292 17:34837358-34837380 CCTGGTGCAGGACAGGTAGCCAC No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685290_1146685298 22 Left 1146685290 17:34837352-34837374 CCAAGCCCTGGTGCAGGACAGGT No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685293_1146685298 -3 Left 1146685293 17:34837377-34837399 CCACCCTGAAGATGTTCTACCAG No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685296_1146685298 -7 Left 1146685296 17:34837381-34837403 CCTGAAGATGTTCTACCAGGCCC No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685288_1146685298 23 Left 1146685288 17:34837351-34837373 CCCAAGCCCTGGTGCAGGACAGG No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data
1146685295_1146685298 -6 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685298 Original CRISPR CAGGCCCAGCAGAGAGATTG AGG Intergenic
No off target data available for this crispr