ID: 1146685301

View in Genome Browser
Species Human (GRCh38)
Location 17:34837402-34837424
Sequence ATTTCCCTCAATCTCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685301_1146685303 -10 Left 1146685301 17:34837402-34837424 CCAGCAGAGAGATTGAGGGAAAT No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data
1146685301_1146685305 27 Left 1146685301 17:34837402-34837424 CCAGCAGAGAGATTGAGGGAAAT No data
Right 1146685305 17:34837452-34837474 TGAGCACCCAAAACATGCCAGGG No data
1146685301_1146685304 26 Left 1146685301 17:34837402-34837424 CCAGCAGAGAGATTGAGGGAAAT No data
Right 1146685304 17:34837451-34837473 TTGAGCACCCAAAACATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685301 Original CRISPR ATTTCCCTCAATCTCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr