ID: 1146685302

View in Genome Browser
Species Human (GRCh38)
Location 17:34837406-34837428
Sequence CAGAGAGATTGAGGGAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685292_1146685302 25 Left 1146685292 17:34837358-34837380 CCTGGTGCAGGACAGGTAGCCAC No data
Right 1146685302 17:34837406-34837428 CAGAGAGATTGAGGGAAATGAGG No data
1146685291_1146685302 26 Left 1146685291 17:34837357-34837379 CCCTGGTGCAGGACAGGTAGCCA No data
Right 1146685302 17:34837406-34837428 CAGAGAGATTGAGGGAAATGAGG No data
1146685295_1146685302 3 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685302 17:34837406-34837428 CAGAGAGATTGAGGGAAATGAGG No data
1146685293_1146685302 6 Left 1146685293 17:34837377-34837399 CCACCCTGAAGATGTTCTACCAG No data
Right 1146685302 17:34837406-34837428 CAGAGAGATTGAGGGAAATGAGG No data
1146685296_1146685302 2 Left 1146685296 17:34837381-34837403 CCTGAAGATGTTCTACCAGGCCC No data
Right 1146685302 17:34837406-34837428 CAGAGAGATTGAGGGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685302 Original CRISPR CAGAGAGATTGAGGGAAATG AGG Intergenic
No off target data available for this crispr