ID: 1146685303

View in Genome Browser
Species Human (GRCh38)
Location 17:34837415-34837437
Sequence TGAGGGAAATGAGGAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685300_1146685303 -9 Left 1146685300 17:34837401-34837423 CCCAGCAGAGAGATTGAGGGAAA No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data
1146685296_1146685303 11 Left 1146685296 17:34837381-34837403 CCTGAAGATGTTCTACCAGGCCC No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data
1146685295_1146685303 12 Left 1146685295 17:34837380-34837402 CCCTGAAGATGTTCTACCAGGCC No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data
1146685293_1146685303 15 Left 1146685293 17:34837377-34837399 CCACCCTGAAGATGTTCTACCAG No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data
1146685297_1146685303 -4 Left 1146685297 17:34837396-34837418 CCAGGCCCAGCAGAGAGATTGAG No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data
1146685301_1146685303 -10 Left 1146685301 17:34837402-34837424 CCAGCAGAGAGATTGAGGGAAAT No data
Right 1146685303 17:34837415-34837437 TGAGGGAAATGAGGAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685303 Original CRISPR TGAGGGAAATGAGGAAAAGT AGG Intergenic
No off target data available for this crispr