ID: 1146685701

View in Genome Browser
Species Human (GRCh38)
Location 17:34840248-34840270
Sequence CTGGCTTTAGAGTGAGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146685701_1146685707 -4 Left 1146685701 17:34840248-34840270 CCTGAGTCTCACTCTAAAGCCAG No data
Right 1146685707 17:34840267-34840289 CCAGGCAGGGGCTGCAGTTGAGG No data
1146685701_1146685708 15 Left 1146685701 17:34840248-34840270 CCTGAGTCTCACTCTAAAGCCAG No data
Right 1146685708 17:34840286-34840308 GAGGCCCAGCATGACCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146685701 Original CRISPR CTGGCTTTAGAGTGAGACTC AGG (reversed) Intergenic
No off target data available for this crispr