ID: 1146688703

View in Genome Browser
Species Human (GRCh38)
Location 17:34858260-34858282
Sequence GCCCAAGCAGGTGGTCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146688703_1146688710 -5 Left 1146688703 17:34858260-34858282 CCTGTATGACCACCTGCTTGGGC No data
Right 1146688710 17:34858278-34858300 TGGGCAGAAGTGGGGGTTTCTGG No data
1146688703_1146688712 26 Left 1146688703 17:34858260-34858282 CCTGTATGACCACCTGCTTGGGC No data
Right 1146688712 17:34858309-34858331 GCTAGATATCTGTACCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146688703 Original CRISPR GCCCAAGCAGGTGGTCATAC AGG (reversed) Intergenic
No off target data available for this crispr