ID: 1146689975

View in Genome Browser
Species Human (GRCh38)
Location 17:34866614-34866636
Sequence TCAAATCCCTGTTCCTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146689975_1146689980 -7 Left 1146689975 17:34866614-34866636 CCCCCTCAGGAACAGGGATTTGA No data
Right 1146689980 17:34866630-34866652 GATTTGAAGTCTCAAGGAGCTGG No data
1146689975_1146689981 7 Left 1146689975 17:34866614-34866636 CCCCCTCAGGAACAGGGATTTGA No data
Right 1146689981 17:34866644-34866666 AGGAGCTGGTCTCCTTCCACAGG No data
1146689975_1146689984 22 Left 1146689975 17:34866614-34866636 CCCCCTCAGGAACAGGGATTTGA No data
Right 1146689984 17:34866659-34866681 TCCACAGGGATCAGCTGCTGCGG No data
1146689975_1146689982 8 Left 1146689975 17:34866614-34866636 CCCCCTCAGGAACAGGGATTTGA No data
Right 1146689982 17:34866645-34866667 GGAGCTGGTCTCCTTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146689975 Original CRISPR TCAAATCCCTGTTCCTGAGG GGG (reversed) Intergenic
No off target data available for this crispr