ID: 1146696054

View in Genome Browser
Species Human (GRCh38)
Location 17:34909740-34909762
Sequence AACTCTGCCCCCACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146696054_1146696060 -3 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696060 17:34909760-34909782 GTTAGGATTCTCAGAGTTAGGGG No data
1146696054_1146696064 23 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696064 17:34909786-34909808 TCTGGCTCCCCCCATGCACAAGG No data
1146696054_1146696058 -5 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696058 17:34909758-34909780 GAGTTAGGATTCTCAGAGTTAGG No data
1146696054_1146696059 -4 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696054_1146696061 5 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696061 17:34909768-34909790 TCTCAGAGTTAGGGGCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146696054 Original CRISPR AACTCTGCCCCCACTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr