ID: 1146696059

View in Genome Browser
Species Human (GRCh38)
Location 17:34909759-34909781
Sequence AGTTAGGATTCTCAGAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146696056_1146696059 -9 Left 1146696056 17:34909745-34909767 CCCAGTGGGGGCAGAGTTAGGAT No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696047_1146696059 5 Left 1146696047 17:34909731-34909753 CCCCTGGTCCCACACCCAGTGGG No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696054_1146696059 -4 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696053_1146696059 -3 Left 1146696053 17:34909739-34909761 CCCACACCCAGTGGGGGCAGAGT No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696057_1146696059 -10 Left 1146696057 17:34909746-34909768 CCAGTGGGGGCAGAGTTAGGATT No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696051_1146696059 3 Left 1146696051 17:34909733-34909755 CCTGGTCCCACACCCAGTGGGGG No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data
1146696049_1146696059 4 Left 1146696049 17:34909732-34909754 CCCTGGTCCCACACCCAGTGGGG No data
Right 1146696059 17:34909759-34909781 AGTTAGGATTCTCAGAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146696059 Original CRISPR AGTTAGGATTCTCAGAGTTA GGG Intergenic
No off target data available for this crispr