ID: 1146696064

View in Genome Browser
Species Human (GRCh38)
Location 17:34909786-34909808
Sequence TCTGGCTCCCCCCATGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146696056_1146696064 18 Left 1146696056 17:34909745-34909767 CCCAGTGGGGGCAGAGTTAGGAT No data
Right 1146696064 17:34909786-34909808 TCTGGCTCCCCCCATGCACAAGG No data
1146696057_1146696064 17 Left 1146696057 17:34909746-34909768 CCAGTGGGGGCAGAGTTAGGATT No data
Right 1146696064 17:34909786-34909808 TCTGGCTCCCCCCATGCACAAGG No data
1146696054_1146696064 23 Left 1146696054 17:34909740-34909762 CCACACCCAGTGGGGGCAGAGTT No data
Right 1146696064 17:34909786-34909808 TCTGGCTCCCCCCATGCACAAGG No data
1146696051_1146696064 30 Left 1146696051 17:34909733-34909755 CCTGGTCCCACACCCAGTGGGGG No data
Right 1146696064 17:34909786-34909808 TCTGGCTCCCCCCATGCACAAGG No data
1146696053_1146696064 24 Left 1146696053 17:34909739-34909761 CCCACACCCAGTGGGGGCAGAGT No data
Right 1146696064 17:34909786-34909808 TCTGGCTCCCCCCATGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146696064 Original CRISPR TCTGGCTCCCCCCATGCACA AGG Intergenic
No off target data available for this crispr