ID: 1146698582

View in Genome Browser
Species Human (GRCh38)
Location 17:34932381-34932403
Sequence GTAAGGCATCAGCAAAAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146698581_1146698582 -8 Left 1146698581 17:34932366-34932388 CCTTGGGAATAATGAGTAAGGCA 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1146698582 17:34932381-34932403 GTAAGGCATCAGCAAAAGCTTGG 0: 1
1: 0
2: 2
3: 14
4: 165
1146698577_1146698582 9 Left 1146698577 17:34932349-34932371 CCGAAAGGGTAGTTGTACCTTGG 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1146698582 17:34932381-34932403 GTAAGGCATCAGCAAAAGCTTGG 0: 1
1: 0
2: 2
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146698582 Original CRISPR GTAAGGCATCAGCAAAAGCT TGG Exonic
902449637 1:16488704-16488726 GCAAGGCATGAGCAAAGGCATGG - Intergenic
902454383 1:16521421-16521443 GAAAGGAAAAAGCAAAAGCTGGG + Intergenic
902470491 1:16645161-16645183 ATAAGGCAGCAGCAAAAGGGTGG + Intergenic
902504845 1:16932638-16932660 GCAAGGCATGAGCAAAGGCATGG + Intronic
902849923 1:19147026-19147048 GTCAGCCATAAGCAAGAGCTGGG + Intronic
904544893 1:31261635-31261657 GTAAGGTATCATGAAAAGCAAGG + Intronic
904729967 1:32582814-32582836 ATAAGGACTCAGCAAAAGCTGGG + Intronic
904911698 1:33938976-33938998 GTAAGCCAAGAGCAAAAGATGGG - Intronic
907194919 1:52678758-52678780 CCCAGACATCAGCAAAAGCTTGG + Intergenic
914006531 1:143736757-143736779 GGAAGGGAAAAGCAAAAGCTGGG + Intergenic
914327649 1:146636042-146636064 GTACTGCATCAGCCAAAGCGAGG + Intergenic
920570040 1:207009507-207009529 GTAAGGCATCTGAAAAAACAAGG + Intronic
920721433 1:208390620-208390642 GGAAGGCAGAAGCAGAAGCTGGG - Intergenic
921148017 1:212377860-212377882 GTCAGTCACCAGCAAAAGCAAGG + Intronic
922618927 1:226978985-226979007 GCAGGGCAGCAGCAAAAGGTGGG - Intronic
1067256813 10:44649583-44649605 GTAAGGCACCAGAAAAGACTTGG - Intergenic
1067533274 10:47089993-47090015 GTAAGGCAAGAGCAGAAGCAGGG - Intergenic
1068799870 10:61128118-61128140 GTAAAGAATAAGCAAAAGGTAGG + Intergenic
1069869762 10:71526061-71526083 GATAGCCACCAGCAAAAGCTCGG + Intronic
1070426460 10:76293017-76293039 GTAATGCAGCAGCACAATCTCGG + Intronic
1072195056 10:93110368-93110390 GGAAGGCCTCAGAAAAAGCCTGG + Intergenic
1073288108 10:102400462-102400484 GTCAGGCATATGCAACAGCTGGG - Exonic
1073563419 10:104516097-104516119 GCAAGGCATTAGCAAGAGATTGG - Intergenic
1073605142 10:104887337-104887359 GAATGGCATGAGCAAAATCTTGG + Intronic
1076198972 10:128542793-128542815 GTAGGCCATCAGCAAATGCCCGG + Intergenic
1080226133 11:29962865-29962887 GAAAGGCATCAACAAATTCTTGG - Intergenic
1080470743 11:32543155-32543177 GTAGGGCATGAGCCAAGGCTGGG + Intergenic
1080610897 11:33902614-33902636 ATAAGGCATCAGGAAAAACCTGG - Intergenic
1081410037 11:42747041-42747063 ATGAGGCATCAGCTAAAGTTAGG + Intergenic
1082829509 11:57605272-57605294 CTTAGGCATCAGCAAAGCCTGGG + Intronic
1083572001 11:63765942-63765964 GGAAGTCATCAGCAACAGCTGGG - Exonic
1085982879 11:81745159-81745181 TTAAAGCTTGAGCAAAAGCTGGG - Intergenic
1088420292 11:109637531-109637553 GCAACACATCAGCAAATGCTTGG + Intergenic
1088751230 11:112843812-112843834 TTAAGGCATCAGCATCACCTGGG - Intergenic
1089076858 11:115745388-115745410 CTTAGGCCTCAGCCAAAGCTGGG + Intergenic
1089632059 11:119789991-119790013 ATATGCCATCAGCAAAAGCAAGG - Intergenic
1090439987 11:126717429-126717451 GTAAGGCATAGCCAACAGCTGGG - Intronic
1092905494 12:13097185-13097207 GAAGAGCATCAGCAAAGGCTTGG - Intronic
1093627615 12:21368301-21368323 GTATGCCATCAGCAAAATCCAGG + Intronic
1094656203 12:32421686-32421708 GTAAGGCAACAGCAGAAGAAAGG - Intronic
1098914860 12:76246747-76246769 CTGAGGCATCAGCACCAGCTGGG + Intergenic
1108705336 13:52980373-52980395 GTGATGCATCAGCAAAGTCTCGG + Intergenic
1109976198 13:69835606-69835628 GGAAGGCATCTGCAAAATGTAGG + Intronic
1110618051 13:77563266-77563288 GGAAGGAAACAGGAAAAGCTGGG - Intronic
1112018519 13:95351533-95351555 CTGAGGGCTCAGCAAAAGCTGGG + Intergenic
1115128720 14:30027023-30027045 AGAAGGTATCAGCAAAAGTTTGG - Intronic
1115445919 14:33489505-33489527 GAAATACATCAGCAAAAGCTAGG + Intronic
1115470011 14:33758722-33758744 GTAAGGAATAAGAAAAACCTTGG - Intronic
1116182078 14:41547534-41547556 GTAAAGCAAGAGAAAAAGCTGGG + Intergenic
1117064402 14:51995709-51995731 CTGAGGCATCAGCAAAAAATTGG - Intronic
1117612645 14:57500642-57500664 GTAAGGCATCAGTAAGAGTAGGG - Intergenic
1117733010 14:58742910-58742932 TTAGGGTATCAGCATAAGCTGGG + Intergenic
1118633259 14:67725226-67725248 GAAAGCCCTCAGCAAAGGCTCGG - Exonic
1119535426 14:75399295-75399317 GGAAGGCATGTGCAAAGGCTTGG + Intergenic
1119959298 14:78836308-78836330 TAAAGGCAGCAGCAAAAGCTGGG - Intronic
1121903833 14:97721701-97721723 TTAAGGCAGCAGGAAATGCTAGG + Intergenic
1124199592 15:27667108-27667130 GGAAGGCTGAAGCAAAAGCTTGG - Intergenic
1125597317 15:40895167-40895189 GAAAAGCATCAGCAGAAGCCGGG - Intronic
1126115858 15:45207017-45207039 GAAAGGCATAAGTAAAAGCAAGG + Intergenic
1127405514 15:58640807-58640829 GTACGCCATCATCAAAATCTCGG + Exonic
1127450793 15:59114494-59114516 GCAAGGCATCAGAAAAAGCTTGG - Exonic
1131116330 15:89798329-89798351 GTCAGCCTTCAGGAAAAGCTTGG + Intronic
1132358299 15:101189966-101189988 GTAACGCATGACCCAAAGCTGGG - Intronic
1133877841 16:9751709-9751731 GAACAGCATCAGCAAAAGCATGG + Intergenic
1135048199 16:19171220-19171242 GTAAGGGAATAGCAACAGCTTGG - Intronic
1136012785 16:27375012-27375034 GAAAGGCATGAGAAAAGGCTTGG - Intergenic
1140005910 16:71074898-71074920 GTACTGCATCAGCCAAAGCGAGG - Intronic
1142978434 17:3658448-3658470 CAAAGGCATCAGGAAAGGCTGGG - Intronic
1144427925 17:15161866-15161888 ATAAGTCATCAGCAAGAACTTGG - Intergenic
1145001464 17:19307978-19308000 GTAAGGCAGAAGCAACACCTAGG + Intronic
1146698582 17:34932381-34932403 GTAAGGCATCAGCAAAAGCTTGG + Exonic
1147849140 17:43427692-43427714 GTAAGGTATCAGCAGGAGCCTGG + Intergenic
1149208901 17:54280983-54281005 GAAAGGGGTCAGCAAATGCTTGG - Intergenic
1149774544 17:59346871-59346893 GAATGGCATCAGCAAAACCATGG + Intronic
1150452053 17:65277458-65277480 GTGAGGAAGCAGCAGAAGCTTGG - Intergenic
1150807894 17:68333750-68333772 GGAAGGGAACAGAAAAAGCTGGG + Intronic
1151901914 17:77021738-77021760 GTTATGCCTTAGCAAAAGCTTGG + Intergenic
1156406116 18:36784186-36784208 GTGAGGAATCACCACAAGCTTGG - Intronic
1158261441 18:55610303-55610325 GTAAGGCATAGGGAAAAGGTCGG - Intronic
1158873834 18:61713902-61713924 GTAAAGCATAACCTAAAGCTGGG - Intergenic
1159476862 18:68932217-68932239 GGAAGACAACAGCAAAAGCCTGG - Intronic
1159945143 18:74439220-74439242 TTAAGGTACCAGAAAAAGCTGGG - Intronic
1162340321 19:10087702-10087724 GAATGGCATAAGCAAAGGCTGGG + Intronic
1166950785 19:46426721-46426743 GTAAGAGATCTGCAAAACCTTGG + Intergenic
925601043 2:5609001-5609023 ATAAGCCATCAACAAAAACTAGG + Intergenic
927576382 2:24205148-24205170 AAAAGTCATCAGCAAAAACTGGG + Intronic
929213260 2:39382963-39382985 GAAAAGCATGAGCAAAGGCTTGG + Intronic
930098879 2:47587976-47587998 GTAAGTCATGAGAAAGAGCTTGG + Intergenic
934604445 2:95683213-95683235 GTAAGGCACAAGCAACAGATTGG + Intergenic
936537845 2:113325444-113325466 GTAAGGCACAAGCAACAGATTGG + Intergenic
940328274 2:152448184-152448206 TTAAGAAATCAGCAAATGCTAGG - Intronic
944813943 2:203355983-203356005 CAAAGGCAACAACAAAAGCTAGG - Intronic
945740423 2:213653557-213653579 TTAAGGCTTAAGCAAAACCTTGG + Intronic
947594150 2:231400290-231400312 GTACGGCAACAGAAAAACCTGGG + Exonic
948798365 2:240418635-240418657 GTGAGGCTTCAGAAAAAGCTTGG + Intergenic
1168969844 20:1923521-1923543 GTAGGGCATCGGCCAATGCTGGG + Intronic
1170309899 20:14981272-14981294 GGATGGCATTTGCAAAAGCTGGG - Intronic
1175578019 20:60077335-60077357 GGAAGGCATCAGCATCACCTGGG + Intergenic
1181015778 22:20067817-20067839 CCAAGGCATCACCAGAAGCTGGG + Intergenic
1181958332 22:26604637-26604659 AGAAGGCATAGGCAAAAGCTGGG + Intronic
1183245506 22:36690300-36690322 GGCAGCCATCAGCAAGAGCTGGG - Intronic
1183619651 22:38965040-38965062 GTAAGGCATCCATAAAACCTGGG - Intronic
1184316745 22:43699224-43699246 GTGAGGCACCAGCAGAAGGTTGG + Intronic
1185036623 22:48481436-48481458 GTAAGGGATCAGCAATAGAAAGG + Intergenic
949235997 3:1808683-1808705 ATAAAACATCAGCAAAAACTAGG + Intergenic
951463665 3:22978253-22978275 GGAAGCCAACAGCAAAAACTAGG + Intergenic
952297067 3:32070975-32070997 GTAAATCATGAGAAAAAGCTTGG - Intronic
954298933 3:49689069-49689091 ATAAGGCAGCAGCAAAAGGGTGG - Intronic
956955414 3:74333280-74333302 GTAAGGCAGTACCAAAAACTTGG + Intronic
957904665 3:86540698-86540720 GTAAGTCATGAGAAAGAGCTTGG + Intergenic
958690436 3:97459264-97459286 CAAAGGCATCAGCAACACCTGGG + Intronic
958883788 3:99703093-99703115 ATAATGCATCAGCAAGACCTTGG + Intronic
959770975 3:110095647-110095669 GTAAGTACTCAGAAAAAGCTGGG + Intergenic
964026599 3:152081405-152081427 GTCAACCATCATCAAAAGCTAGG - Intergenic
964847314 3:161057919-161057941 GTAAGGTATAAGAAAAATCTTGG - Intronic
966678555 3:182616052-182616074 GACAGGCATCAGCAAAGACTGGG + Intergenic
967640909 3:191861951-191861973 GGAAGACAGCAGCAAAAGCTGGG + Intergenic
969178171 4:5415889-5415911 GGAAGGCATCACCAAGAGATGGG - Intronic
971205137 4:24559230-24559252 GTTAGCCACCACCAAAAGCTAGG + Intronic
972560010 4:40218567-40218589 GGAAGGCATGAGGAACAGCTTGG + Intronic
974188976 4:58478053-58478075 GTAAAGCATCAGCCAGGGCTGGG - Intergenic
979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG + Intergenic
981420768 4:144547899-144547921 GTAAGGAATCAAGAAAAGTTTGG - Intergenic
983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG + Intronic
986434193 5:7711853-7711875 TTAATGCATCACCAAAAACTTGG - Intronic
987038236 5:14038693-14038715 GTAAGTCAGCAGTAAAAGCTGGG - Intergenic
987105959 5:14639686-14639708 GCAACACATCAGCAAATGCTTGG + Intergenic
989614975 5:43330257-43330279 GTAAATCATGAGAAAAAGCTTGG + Intergenic
993551734 5:89281644-89281666 GCAGGGCATTAGCAAAAGCTGGG + Intergenic
994472834 5:100231082-100231104 GTAAGGCATAGGCAAATGCCTGG + Intergenic
995154135 5:108890465-108890487 GTCAGCCATCACCAGAAGCTAGG - Intronic
996281274 5:121731828-121731850 GTAATGCAACTGCAAGAGCTAGG - Intergenic
998049637 5:139021532-139021554 GTTTGGCATAAGCAATAGCTAGG - Intronic
998426951 5:142036901-142036923 GTCAGGCTTCAGAAAAATCTTGG + Intergenic
999247127 5:150161099-150161121 GAAAAGCATCTGCAAAAGCTTGG + Intergenic
1000154577 5:158538134-158538156 GTTAGGAATCAGAAAAATCTGGG - Intergenic
1000783002 5:165507511-165507533 GTAAGCCTTCAGCAGAAACTAGG + Intergenic
1002304789 5:178276774-178276796 TCAAGGCACCAGCAACAGCTGGG - Intronic
1004593922 6:17080721-17080743 GTAAGGTACCAGCACAAGCTGGG + Intergenic
1007944444 6:45812954-45812976 GTAAGGCAGCAGCTGAAGTTTGG + Intergenic
1008116970 6:47562556-47562578 GTCTTGCATAAGCAAAAGCTTGG + Intronic
1010502148 6:76614286-76614308 GCCAGGCATCAGCTAAAGTTAGG - Intergenic
1012644072 6:101657859-101657881 GTAGGGCATCAGTCAAATCTAGG + Intronic
1013638715 6:112053023-112053045 GTAAGGCAGCAGGAAAAGGAGGG + Intergenic
1016423859 6:143913420-143913442 GTAAGCCATCAGCAACAGGGCGG - Intronic
1020412647 7:7910150-7910172 GCAAAGCATCAGAAAAAGCTCGG + Intronic
1022071977 7:26925002-26925024 CTAAGTGATCAGCAAAGGCTTGG - Intronic
1022347001 7:29526445-29526467 GAAAGGGATCAGCAAAAACAGGG + Intergenic
1023295481 7:38710853-38710875 GTAAGAAATCGGCAAAAGATAGG - Intergenic
1025090662 7:56060904-56060926 GCAATGCATCAGCAAATGCTTGG - Exonic
1025833033 7:65071006-65071028 GCAACGCATCAGCAAATGCTTGG - Intergenic
1025902798 7:65760520-65760542 GCAACACATCAGCAAATGCTTGG - Intergenic
1025953858 7:66167438-66167460 GTAAGCCATCAGCAAAATCCAGG - Intergenic
1031402799 7:121345629-121345651 GTAAGGAATGAGCAAGAACTGGG - Intergenic
1032510842 7:132471142-132471164 ATAAGGCAGCAGCAAGAGATGGG - Intronic
1034178126 7:149116433-149116455 CTAATCCATCAGCAAAATCTAGG + Intronic
1037502605 8:19500054-19500076 TTAAAGCATCAGCAAACGCATGG + Intronic
1037741422 8:21612124-21612146 GAAAGCCATCAACAAATGCTTGG + Intergenic
1037913077 8:22755926-22755948 GTACGGCAGCAGCAGGAGCTTGG - Intronic
1040339251 8:46432168-46432190 GTGAGACCACAGCAAAAGCTGGG + Intergenic
1041337306 8:56800741-56800763 GTAAGGGATCAGCAACATTTAGG + Intergenic
1041548155 8:59069762-59069784 GAAAGGTATAAGAAAAAGCTGGG + Intronic
1041804850 8:61838837-61838859 GAAAGGCCTCAGAAAAAGCCAGG + Intergenic
1042014073 8:64286989-64287011 GTATGGCATCAGGAATATCTTGG - Intergenic
1046518860 8:115299212-115299234 GGAAGGCCTCAGAGAAAGCTTGG - Intergenic
1052644145 9:31210704-31210726 TTAAGGCTTCAGCAAAAACCAGG - Intergenic
1055963899 9:81846432-81846454 GAAATGCATTAGGAAAAGCTGGG + Intergenic
1059670569 9:116487471-116487493 GTAAGTCATCAGCAAAACTCAGG + Exonic
1060030846 9:120213585-120213607 GAAAGACATGTGCAAAAGCTTGG + Intergenic
1062008844 9:134256290-134256312 GTGGGGCTTCAGCAAATGCTCGG + Intergenic
1186743707 X:12544428-12544450 TTAAGGCATCTGCACAAACTTGG - Intronic
1186775255 X:12858089-12858111 TTAAGGCATCTGCACAAACTTGG + Intergenic
1187290928 X:17952539-17952561 CTCAGGAACCAGCAAAAGCTGGG + Intergenic
1188498659 X:30803361-30803383 GTAAGGCACAAGGCAAAGCTAGG - Intergenic
1189222744 X:39386241-39386263 GTAAATCATCAGGAATAGCTGGG - Intergenic
1191103011 X:56753239-56753261 GTAAGGAAGAAGCTAAAGCTAGG + Intergenic
1193450456 X:81658586-81658608 CTGAGGCATAAGCAAAAGGTGGG - Intergenic
1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG + Intronic
1195116735 X:101706869-101706891 GTATGGCATGTGCAAAAACTAGG + Intergenic
1196379602 X:115075505-115075527 TTGAGGCATCAGCAACAGTTGGG - Intergenic
1198059216 X:133027251-133027273 GTAAATCATCAGCAAACGATGGG + Exonic
1198642973 X:138777074-138777096 GTCAGGGATCAGGAAATGCTGGG - Intronic