ID: 1146698646

View in Genome Browser
Species Human (GRCh38)
Location 17:34933067-34933089
Sequence AGTCATAAGGCCGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4093
Summary {0: 1, 1: 2, 2: 64, 3: 553, 4: 3473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146698646_1146698652 12 Left 1146698646 17:34933067-34933089 CCACCACACCCGGCCTTATGACT 0: 1
1: 2
2: 64
3: 553
4: 3473
Right 1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG 0: 1
1: 0
2: 6
3: 49
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146698646 Original CRISPR AGTCATAAGGCCGGGTGTGG TGG (reversed) Intronic
Too many off-targets to display for this crispr