ID: 1146698652

View in Genome Browser
Species Human (GRCh38)
Location 17:34933102-34933124
Sequence TATTTATAATTTATATTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 774}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146698649_1146698652 3 Left 1146698649 17:34933076-34933098 CCGGCCTTATGACTACTTTTAAG 0: 1
1: 0
2: 3
3: 35
4: 313
Right 1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG 0: 1
1: 0
2: 6
3: 49
4: 774
1146698646_1146698652 12 Left 1146698646 17:34933067-34933089 CCACCACACCCGGCCTTATGACT 0: 1
1: 2
2: 64
3: 553
4: 3473
Right 1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG 0: 1
1: 0
2: 6
3: 49
4: 774
1146698648_1146698652 4 Left 1146698648 17:34933075-34933097 CCCGGCCTTATGACTACTTTTAA 0: 1
1: 0
2: 8
3: 68
4: 695
Right 1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG 0: 1
1: 0
2: 6
3: 49
4: 774
1146698647_1146698652 9 Left 1146698647 17:34933070-34933092 CCACACCCGGCCTTATGACTACT 0: 1
1: 0
2: 5
3: 51
4: 491
Right 1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG 0: 1
1: 0
2: 6
3: 49
4: 774
1146698651_1146698652 -1 Left 1146698651 17:34933080-34933102 CCTTATGACTACTTTTAAGAGGT 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG 0: 1
1: 0
2: 6
3: 49
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146698652 Original CRISPR TATTTATAATTTATATTGAC AGG Intronic
900863238 1:5247837-5247859 TATTTATTTTTTATAGAGACAGG - Intergenic
901133093 1:6975008-6975030 TATTGATAATTTAAGTTGGCAGG - Intronic
901351067 1:8597258-8597280 TTTATATTATTTATAGTGACGGG + Intronic
901547114 1:9966314-9966336 TATTTATAAATATTATTGACCGG + Intronic
901919630 1:12526901-12526923 TATTTTTATTTTTTAGTGACAGG - Intergenic
902565609 1:17309516-17309538 GATTTATTATTTAGATTCACTGG - Intronic
902855479 1:19200970-19200992 AATTAATATTTTATAGTGACAGG - Intronic
903248790 1:22036925-22036947 TATATATAATTTGTATTTTCTGG - Intergenic
903495818 1:23766401-23766423 TATTTTTATTTTATTTTGAATGG - Intergenic
904984262 1:34531950-34531972 TACTAATAATTTATTTTGAGAGG + Intergenic
906392670 1:45432338-45432360 TATTTATCATTTATATGTATTGG + Intronic
908055328 1:60279841-60279863 TAATTATGAATTATATTGAGAGG + Intergenic
908243802 1:62211663-62211685 TTTTTAGAATTTATATTATCTGG + Exonic
908571432 1:65415244-65415266 TATTTGTAATGTATATTAAAAGG + Exonic
908642912 1:66245104-66245126 TATTCATAATATTTAATGACTGG + Intronic
908687204 1:66734828-66734850 TTTTTATTTTTTAAATTGACAGG + Intronic
908920993 1:69192112-69192134 AATTTATATTCAATATTGACAGG + Intergenic
909155540 1:72070404-72070426 TATTGATATCTAATATTGACAGG - Intronic
909430886 1:75586470-75586492 TATATAAAATTTAAAATGACAGG + Intronic
909452708 1:75816292-75816314 TATTTATAATTTTTCTTAAGGGG + Intronic
909737701 1:78985245-78985267 TATCTATAATCTATTTTGATAGG + Intronic
910135890 1:83968846-83968868 TATTTCAACTTTATATTGAAGGG - Intronic
910937053 1:92492911-92492933 TATTTATAATTTTTCTTGGCAGG - Intergenic
910965114 1:92800546-92800568 TATTTATTATTTGTAGAGACAGG + Intergenic
911238695 1:95440415-95440437 TTATTATTATTTATATTGAAAGG + Intergenic
911361028 1:96876408-96876430 TTGTTATAATTTATATTAAATGG + Intergenic
911410702 1:97502788-97502810 GAATTATAACTTTTATTGACAGG + Intronic
911461071 1:98191853-98191875 TATTTATAATATAGAATGTCAGG + Intergenic
911622503 1:100081280-100081302 TAATTATAATTTCAAGTGACTGG - Intronic
912103210 1:106237546-106237568 TATTTATACTATATATTCAGGGG - Intergenic
912612948 1:111067021-111067043 TATTTATCATTTATATTTGCTGG + Intergenic
912876559 1:113365575-113365597 GTTTTAAAATTTATCTTGACCGG + Intergenic
912890937 1:113529834-113529856 TATTTTTAATTTATTTTTATTGG - Intronic
912901338 1:113653184-113653206 TATTTATAATTGATTTTAAAAGG + Intronic
913490275 1:119373332-119373354 TAATTCTAAGTTATATTGCCAGG + Intronic
913955923 1:143293038-143293060 TAATTAAAATATATATTAACAGG - Intergenic
913981510 1:143522399-143522421 TAATTAAAATATATATTAACAGG + Intergenic
914075881 1:144349058-144349080 TAATTAAAATATATATTAACAGG + Intergenic
914103297 1:144617438-144617460 TAATTAAAATATATATTAACAGG - Intergenic
914973262 1:152331271-152331293 TATATATTATTTATATTGGGTGG + Intergenic
915029402 1:152864022-152864044 TATATATAAATTATATATACAGG - Intergenic
915383566 1:155467755-155467777 TATTTACTATTTGTATTGAGTGG - Intronic
915684223 1:157615452-157615474 TATTTTCAATTTATACTGAATGG - Intergenic
916290192 1:163157534-163157556 TATCTTTAATTTTTATTGAGTGG - Intronic
917825087 1:178811293-178811315 TATTTAAAATTTTTATTTACAGG + Exonic
918252911 1:182719728-182719750 TATTTTTCATTTACATAGACTGG + Intergenic
918414662 1:184294195-184294217 TATTCATAATTAGTATTTACTGG + Intergenic
918822874 1:189280970-189280992 TATGTAAAATTAATATTGAATGG - Intergenic
918900097 1:190404681-190404703 TGTTAATAATTTATATTCTCTGG - Intronic
918953219 1:191168530-191168552 TTTCTGTAAATTATATTGACAGG + Intergenic
919054519 1:192552805-192552827 TATTTATTATTAATGCTGACAGG - Intergenic
919071490 1:192761563-192761585 TATTTTGAGTGTATATTGACAGG + Intergenic
919195461 1:194279190-194279212 TTTTTATCATTTATGTTAACAGG - Intergenic
919300149 1:195751801-195751823 CAATTATTATTTATATTTACAGG - Intergenic
919428944 1:197469252-197469274 AATTTATATTTGATATGGACAGG + Intronic
919618559 1:199837864-199837886 TATTTATTAATTATAGAGACAGG - Intergenic
919629472 1:199945947-199945969 AACTTATAATTTAGATTGATGGG + Intergenic
919856599 1:201710457-201710479 TTTTTATTTTTTATATAGACAGG + Intronic
920553464 1:206885325-206885347 TATTTCTAATTTTTAATCACAGG + Intergenic
920957201 1:210630469-210630491 TAATTATTATTTCTTTTGACAGG - Intronic
921200177 1:212797268-212797290 TCTTTCTAATTTATATTCTCAGG + Intronic
921475465 1:215601809-215601831 TAATTATAATTTCTATTTTCTGG - Intronic
921790300 1:219282208-219282230 TTTTTATATTTTTTATAGACAGG - Intergenic
922037007 1:221858614-221858636 TATTTATTTTTTATAGAGACAGG - Intergenic
923126240 1:231036978-231037000 TCATTATAATATATCTTGACTGG + Intronic
923310685 1:232732007-232732029 TTTTTAAAATTTTTTTTGACAGG + Intergenic
923643374 1:235789319-235789341 TATTCATAATTTATATTCCCTGG + Intronic
923903335 1:238354446-238354468 TTTTTAAAATTTATCTTGCCAGG + Intergenic
924145840 1:241073773-241073795 CATTTATAATGAATATTGAAAGG - Intronic
924744608 1:246819886-246819908 TATTTATATTTTGTAGAGACTGG - Intergenic
924748000 1:246856095-246856117 TAAATATAATGTATACTGACAGG - Intronic
1062880911 10:977157-977179 TATTTATTATTTTTACAGACAGG + Intergenic
1062884729 10:1007561-1007583 TATTTATTTTTTATAGAGACAGG - Intronic
1063595550 10:7431958-7431980 TATTTATTTTTTATAGAGACAGG + Intergenic
1063895765 10:10679989-10680011 TATATAAAATGTATATTTACGGG + Intergenic
1064419076 10:15174784-15174806 TATTAATACTTTATAGAGACAGG + Intergenic
1064786807 10:18906823-18906845 AATTTATAAGTCATATTGGCTGG + Intergenic
1065032861 10:21605610-21605632 TTTTTATTGTTTATAGTGACTGG + Intronic
1065401914 10:25313764-25313786 TATTGATAAATTATATTGATTGG + Intronic
1065465677 10:26019034-26019056 GATTTTTAATGTATATTCACAGG + Intronic
1065748100 10:28860055-28860077 TATTTACAATTCATTTTGATGGG + Intronic
1065831358 10:29617237-29617259 TATTAATAATTTATATGTATGGG - Intronic
1066034264 10:31465990-31466012 TACTTAAAATTTATTTTGCCTGG - Intronic
1066240511 10:33529845-33529867 TATTTATAATTGCTATGTACAGG + Intergenic
1066256915 10:33688788-33688810 TGTTTTTAATTTTTATTTACTGG + Intergenic
1066343881 10:34562939-34562961 TTTTTATATTTTGTAGTGACAGG + Intronic
1067445699 10:46342753-46342775 AATTTATAATTTAAATTATCTGG - Intergenic
1067591677 10:47517990-47518012 AATTTATAATTTAAATTATCTGG + Intronic
1067638792 10:48026064-48026086 AATTTATAATTTAAATTATCTGG + Intergenic
1067874689 10:49994244-49994266 AATTTATAATTTAAATTATCTGG - Intronic
1068996308 10:63209031-63209053 TATTTATAATTTTTAAGCACTGG + Intronic
1069282143 10:66668514-66668536 TATATATAAAATATATTGGCCGG + Intronic
1069330443 10:67285707-67285729 TATTTAAAATTAATATTGTGTGG + Intronic
1070135779 10:73692206-73692228 AATTTATAATTTAAATTATCTGG + Intronic
1071100004 10:82025169-82025191 TATTTCTAACTTAAATTCACAGG + Intronic
1071100658 10:82033446-82033468 TATTTATAAGCTATTTTGAGAGG - Intronic
1071105720 10:82092335-82092357 GATTTTTAACATATATTGACAGG - Intronic
1071421739 10:85507048-85507070 GGTTTATAATTTATATTGTAGGG + Intergenic
1071855958 10:89624652-89624674 TATTTATTTTTTTTAGTGACTGG + Intronic
1071928598 10:90439960-90439982 TATTTATTGTTTATCTTAACTGG - Intergenic
1071948667 10:90677641-90677663 TAATAATAATATATATTGGCTGG - Intergenic
1072080241 10:92022712-92022734 TATAAATAATGTATATTGGCTGG - Intronic
1073520060 10:104120459-104120481 TATTTATGGTTTATATTGTGTGG + Intergenic
1073910355 10:108335470-108335492 TATTTTTAGTTGATTTTGACAGG + Intergenic
1074239981 10:111628741-111628763 TAAGTATAATTTCTATTGAATGG + Intergenic
1074566604 10:114584937-114584959 TGTTTATAATTAATATTGTTTGG - Intronic
1075578743 10:123599853-123599875 AATATACAATTTATTTTGACAGG - Intergenic
1076044981 10:127285130-127285152 GATTTATTATTTATGTTGACAGG - Intronic
1076739174 10:132473339-132473361 TCTTAATAATTTAAATTGGCCGG - Intergenic
1078562503 11:12385321-12385343 TATTTATTATTTATTGAGACAGG - Intronic
1079856709 11:25613414-25613436 TTGATATAATTTATATTGATTGG - Intergenic
1079980652 11:27148540-27148562 TTTATATAATTTATTTTGAAGGG + Intergenic
1080741876 11:35072979-35073001 TATTTATAATATATCTTGCAGGG - Intergenic
1083477657 11:62924439-62924461 TTTTTAAATTTTTTATTGACAGG + Intergenic
1083526462 11:63370749-63370771 TATTTCTAATTTGCAATGACAGG - Intronic
1085123934 11:73984682-73984704 TATTTATTCTTTGTAGTGACAGG + Intergenic
1086247303 11:84769420-84769442 TATGTATATTTTATTCTGACTGG - Intronic
1086574618 11:88325036-88325058 TATGTTTAATTCATATTGTCTGG - Intronic
1086748939 11:90465954-90465976 TATTTAAAATATAACTTGACAGG - Intergenic
1086905211 11:92410790-92410812 TATTTATTGTTTATTTTGCCTGG - Intronic
1087325413 11:96716213-96716235 TATATATAATTTTTAGAGACAGG + Intergenic
1087582552 11:100076804-100076826 TTTTTATTCTTAATATTGACAGG + Intronic
1087742806 11:101909476-101909498 CTTTTATAATTTATATTAATAGG + Intronic
1087954617 11:104269792-104269814 TATTTGTAGTACATATTGACTGG - Intergenic
1088039584 11:105362037-105362059 TATTTATATTTTATATTTCTTGG - Intergenic
1088071884 11:105797040-105797062 TTTTTATTTTTTGTATTGACGGG - Intronic
1088354145 11:108924152-108924174 TATTAAAAATTTAATTTGACTGG - Intronic
1089029749 11:115313428-115313450 TATTTATAAATTGTACTAACTGG - Intronic
1089874347 11:121705328-121705350 GATTTTTAAATAATATTGACAGG - Intergenic
1092205446 12:6612075-6612097 TATTTATAATTTATCTGGGAGGG - Intergenic
1092374664 12:7945327-7945349 TATTTTTAAATTATAGAGACAGG + Intergenic
1092804603 12:12208053-12208075 TATGAATATATTATATTGACTGG - Intronic
1093351655 12:18109949-18109971 TATTTATAATTCTTATTTACAGG - Intronic
1093446984 12:19271496-19271518 TATTTTTATTTTTTTTTGACAGG - Intronic
1093600276 12:21013243-21013265 TATTTTTAAATTATTTTGAAAGG + Intergenic
1093697650 12:22180371-22180393 TATTTATAATGTAAATTGTATGG + Intronic
1093723341 12:22472347-22472369 TGATTACAATTTATTTTGACAGG - Exonic
1093751652 12:22807004-22807026 TATTTAAAATTTATTATCACAGG - Intergenic
1094131245 12:27078233-27078255 TTTTTAAAAATTATATAGACAGG + Intergenic
1094529133 12:31256497-31256519 GATTTATAATTTGTAATAACTGG - Intergenic
1095219551 12:39593421-39593443 TTTTTATTATTTGTATTGACGGG + Intronic
1095219695 12:39594935-39594957 TTTTTATTATTTGTATTGACAGG - Intronic
1095935958 12:47681438-47681460 AATTTTTCATTAATATTGACTGG + Intronic
1096821612 12:54240394-54240416 TATTTATATTTTTTAGAGACAGG + Exonic
1097026805 12:56062441-56062463 TATTTTTAATTTTTAGAGACGGG - Intergenic
1097376292 12:58846897-58846919 TATTTTTAATTTTTATTTCCTGG - Intergenic
1097756448 12:63412119-63412141 TATTTATAATTTAGATGAAATGG - Intergenic
1097914446 12:65005568-65005590 GATTTCTAACATATATTGACTGG + Intergenic
1098103026 12:67039099-67039121 TATTTATAACTTAGATTTTCAGG - Intergenic
1098724616 12:73947205-73947227 TGTTTTTAATTTGTATTGGCTGG - Intergenic
1098786452 12:74763594-74763616 TATATATAATTTATATTTGGTGG + Intergenic
1098825643 12:75294242-75294264 TATTTATAATTTGTATTTGTTGG - Intronic
1099417986 12:82417385-82417407 TATTTATTACTTATGTTGAAAGG - Intronic
1099715054 12:86281367-86281389 GATATATATTTTATATTGAGAGG - Intronic
1100172169 12:91987434-91987456 TATTGATAATTTATTATGAGAGG - Intronic
1100487683 12:95046134-95046156 TATTTAAGATTTTTATTGGCCGG - Intronic
1100639548 12:96469265-96469287 TATTTATTATTTATTTTTGCGGG + Intergenic
1100653893 12:96619907-96619929 TATTCAAAATTTATTTTGGCCGG + Intronic
1101944061 12:109122400-109122422 TTTTTATATTTTATACAGACAGG - Intronic
1102045750 12:109829164-109829186 TATTTATTATTTTTAGAGACAGG - Intronic
1102154131 12:110710858-110710880 TATTTATATTTTAGAGAGACAGG - Intergenic
1102307342 12:111815214-111815236 TTTTTATATTTTTTAATGACAGG + Intergenic
1102393454 12:112568229-112568251 TATATATAATATATATAGCCAGG + Intergenic
1103071548 12:117947999-117948021 TATTTATTATAAATATAGACAGG + Intronic
1104195097 12:126529396-126529418 TATTTATTATAAATATTCACTGG - Intergenic
1105424252 13:20281559-20281581 TGTTTATAATATATATTAAAAGG + Intergenic
1105545105 13:21345411-21345433 TTTTTATATTTTTTATTGACGGG + Intergenic
1106951400 13:34888353-34888375 AATTTATAAATTATACTTACTGG + Intergenic
1107050912 13:36048353-36048375 TAACTATTATATATATTGACAGG + Intronic
1107507444 13:41048583-41048605 TTTTAATATTTTATAGTGACAGG + Intronic
1108026268 13:46181715-46181737 TATTGATAATTTAGATTGTATGG - Intronic
1108033540 13:46263180-46263202 TATTTTTAATTTTTAGAGACAGG + Intronic
1108195341 13:47989046-47989068 TATTTAACATACATATTGACAGG + Intronic
1108563742 13:51673443-51673465 TATTTAAAATTCATTTTAACAGG + Intronic
1108834254 13:54521097-54521119 TATTTACATTTTAAAATGACAGG + Intergenic
1108842386 13:54635455-54635477 TATTTATAATTTTTATTCAGAGG + Intergenic
1108903724 13:55445195-55445217 AATTTTTAATTTGTAGTGACAGG - Intergenic
1108949534 13:56073155-56073177 TATTTAAAATTTATTCTGTCAGG - Intergenic
1109231729 13:59765751-59765773 TATTTATTTTTAATACTGACAGG + Intronic
1109261430 13:60149577-60149599 TATTTATATTTTATAGAGACAGG - Intronic
1109449668 13:62493906-62493928 TATTTATATTTTTTATTTATTGG - Intergenic
1109584376 13:64378950-64378972 TATTTTTTATTTTTATTGATTGG - Intergenic
1110021039 13:70473179-70473201 TATTTGTAATTTATATGTAATGG + Intergenic
1110068281 13:71138163-71138185 ATTTTATAGTTTATATTGCCAGG - Intergenic
1110101690 13:71614094-71614116 TATTTATAATCCATTTTGCCTGG + Intronic
1110329402 13:74253811-74253833 TTTTCATAATTTATATAGGCTGG - Intergenic
1110445077 13:75570904-75570926 TATATATATTTTATAGAGACAGG - Intronic
1110986420 13:81975673-81975695 TATTTATTTTTTATATTGTTAGG + Intergenic
1111009900 13:82298561-82298583 TATTTACAATTTTTATTTTCAGG + Intergenic
1111203877 13:84977611-84977633 TAATGATAATTTAAATTCACTGG - Intergenic
1111413291 13:87905687-87905709 TATATATATATTTTATTGACTGG + Intergenic
1111563256 13:89980521-89980543 TCTGTATAATTTTTATTGATTGG + Intergenic
1111563969 13:89990826-89990848 TATTTATATATTATATGGAGTGG - Intergenic
1111907055 13:94267206-94267228 TATTACAAAATTATATTGACTGG - Intronic
1112448833 13:99491148-99491170 TCTTTAAAATGTATTTTGACTGG + Intergenic
1112652323 13:101413540-101413562 TATTTATAATAAATATTCAGTGG + Intronic
1113147775 13:107228075-107228097 TATTGATCATTTATATTCATTGG + Intronic
1113306673 13:109087001-109087023 TCTTTATAATAAATATTGATTGG + Intronic
1113976663 13:114232537-114232559 AATTTGTAATTAATATTGCCAGG - Intergenic
1114226520 14:20743632-20743654 GATTTAAAATTTATATTTAAAGG + Intronic
1114888908 14:26891144-26891166 TATTTAGAGCTTATATTGAAAGG - Intergenic
1115131844 14:30063147-30063169 TATTTCTAATTAATATTTTCAGG + Intronic
1115951426 14:38726809-38726831 TATTTCTAATGTATAATCACTGG + Intergenic
1116130709 14:40853890-40853912 TATTTATTATTTAGATTCAGAGG + Intergenic
1116196244 14:41729453-41729475 AATTTATAATTTATAAAGAAAGG - Intronic
1116212929 14:41971220-41971242 CATTTATAATTTACATAGAAAGG - Intergenic
1116221401 14:42093054-42093076 TATATATAATATATATTTAAAGG + Intergenic
1116665986 14:47776223-47776245 GATTTATAATTTAGATACACTGG + Intergenic
1116758187 14:48975752-48975774 TATTTATAATTCATATTATAAGG - Intergenic
1117383644 14:55190256-55190278 TTTTTAAAATTTATAGAGACGGG - Intronic
1117683601 14:58230521-58230543 CATTTAAAATTTATATTTAAAGG - Intronic
1118549440 14:66933435-66933457 TATGTAAAATTAATATTGAAAGG + Intronic
1118987345 14:70767856-70767878 TTTTTATTTTTTGTATTGACCGG + Intronic
1119063011 14:71495440-71495462 TATTTATATTTTATACTGTAGGG + Intronic
1120037984 14:79719928-79719950 TAATAATAATTTTTATTGAAAGG - Intronic
1120578295 14:86212192-86212214 TATATAAAATATATATGGACAGG + Intergenic
1120716796 14:87849245-87849267 TATTTAAAATTCATAGTGAAAGG - Intronic
1121059708 14:90895435-90895457 TATTTGTAATGAATATTAACAGG - Intronic
1121178958 14:91913141-91913163 TTTTTATCACTTATAATGACAGG - Intronic
1121864823 14:97352929-97352951 TATATATAATTTAATTTAACTGG - Intergenic
1122003055 14:98679952-98679974 TTTTTAAAATTTATTTTGACAGG - Intergenic
1122361243 14:101167014-101167036 TATTTAAAGTTTATATGGAAAGG - Intergenic
1122638837 14:103145183-103145205 TATATATATTTTATAGAGACAGG + Intergenic
1202890422 14_KI270722v1_random:151977-151999 TATTTTTATGTCATATTGACAGG + Intergenic
1125408233 15:39376384-39376406 TATTTTTACTTTATTTTCACCGG - Intergenic
1125700807 15:41681876-41681898 TATTTGTAGTTTATATGTACTGG + Intronic
1125711555 15:41791162-41791184 TATTTATAACTTGAATTGAGTGG + Intronic
1125924238 15:43549084-43549106 TATATATAATTTGTAGAGACAGG + Intronic
1126902947 15:53332805-53332827 TATTTCTAATATTTATTGAGAGG + Intergenic
1126968734 15:54085617-54085639 TATTTATTATTTATAGAGATAGG + Intronic
1126984158 15:54283229-54283251 TGTATATAATTGATAGTGACAGG - Intronic
1127161655 15:56193465-56193487 TGTTGATAATTGATAATGACAGG + Intronic
1127310495 15:57747672-57747694 TAATTATAATTTAAATCGATGGG + Intronic
1127313777 15:57776065-57776087 TATTTTTAATTTGTAATGTCTGG - Intronic
1127555888 15:60087096-60087118 TATTTATTTTTTATTTTGCCAGG - Intergenic
1128041635 15:64579792-64579814 TATTTATAATATGTGTTGATGGG - Intronic
1128310219 15:66626373-66626395 TATTTTTAATTTGTAGAGACGGG - Intronic
1128531037 15:68448021-68448043 TATATATAGTTTAGATTGAGAGG + Intergenic
1128968914 15:72088676-72088698 TATATATATTTTTTACTGACTGG - Intronic
1129311530 15:74715115-74715137 TATATATAATGTATATGGAGGGG - Intergenic
1129372035 15:75103440-75103462 TTTGAATAATTTCTATTGACTGG + Intronic
1130134276 15:81169068-81169090 TATATATTATTGATAGTGACAGG + Intronic
1130583358 15:85158411-85158433 TATTTATATTTTATTTTCAGTGG - Intergenic
1131079714 15:89524486-89524508 TATTTCTTCTTTATATTGACTGG - Intergenic
1132307747 15:100829337-100829359 TATTTTTAATTTTTAGTGACAGG - Intergenic
1132543471 16:522271-522293 TATGTATAATATATAAAGACTGG + Exonic
1133053636 16:3133764-3133786 CATATATAATATATATTCACAGG + Intronic
1133129478 16:3667715-3667737 TATTTATAATTTATTTATATGGG - Intronic
1133186292 16:4101448-4101470 TATTTATTATTTTTAGAGACAGG + Intronic
1133541209 16:6756196-6756218 TATTTAAAAATTATATGGATTGG + Intronic
1133566508 16:7000476-7000498 TCTTTATATTTTCTGTTGACTGG + Intronic
1134366793 16:13586298-13586320 TATTTTTATTTTAGATTGATGGG + Intergenic
1134746408 16:16592527-16592549 TATATATATTTTATAGAGACGGG + Intergenic
1134999072 16:18761173-18761195 TATATATATTTTATAGAGACGGG - Intergenic
1135386354 16:22044322-22044344 TAGTTATTATTAATGTTGACAGG - Intronic
1135786801 16:25357559-25357581 TATTTAAAATTAATAATAACGGG - Intergenic
1137072605 16:35917941-35917963 TCTTTATAATTTTTATTGCAGGG + Intergenic
1137662117 16:50216937-50216959 TTTTTATATTTTATCTTGTCAGG + Intronic
1137851247 16:51746905-51746927 TATTAATAAATTATATTGTAAGG - Intergenic
1138463147 16:57165652-57165674 TGTTAATAATTTATATTCGCAGG - Intronic
1138703395 16:58888824-58888846 TATTTAGAAATTGTATTTACAGG + Intergenic
1139135134 16:64193873-64193895 TTTTTATAATTTAAATATACTGG + Intergenic
1141796131 16:86275921-86275943 TAATTATAACTTACATTGATTGG - Intergenic
1143362046 17:6379748-6379770 TATATATAATTAATATTAATTGG - Intergenic
1144135663 17:12292436-12292458 AGTTTATAATTTATAATGAGAGG + Intergenic
1144416716 17:15054814-15054836 TATTTTTAATGTATTTTTACTGG - Intergenic
1145191736 17:20847300-20847322 TATATACATTTTATATAGACAGG + Intronic
1145401944 17:22547342-22547364 TATATACATTTTATATAGACAGG + Intergenic
1146698652 17:34933102-34933124 TATTTATAATTTATATTGACAGG + Intronic
1149264057 17:54908545-54908567 TATTTATAATCGAATTTGACAGG - Intronic
1149287665 17:55183412-55183434 TATTTATTTTTTATAGAGACTGG - Intergenic
1149624676 17:58072395-58072417 TATTTATAAGTGATATTGATGGG - Intergenic
1149798799 17:59547017-59547039 TAATTATAATTTATTTTAAAAGG + Intergenic
1149815570 17:59720675-59720697 TATATATTATTTATCTTGGCTGG + Intronic
1150112505 17:62514438-62514460 TTTTTTTAATTATTATTGACTGG - Intronic
1150216546 17:63474595-63474617 TATTTTTAATTTTTACTCACTGG + Intergenic
1150358682 17:64509677-64509699 TATTTATTATTTATTGAGACAGG - Intronic
1150362836 17:64552706-64552728 TATTTTTAATTTATATTAGGTGG + Intronic
1150367752 17:64605424-64605446 TAATTTTAAATTATATTGGCCGG + Intronic
1150956263 17:69863561-69863583 TATTTATAATTATTATTATCTGG + Intergenic
1150986513 17:70204016-70204038 TATTTCTAATATTTATTGCCAGG + Intergenic
1151131954 17:71906554-71906576 TATTTGTAAATAATATTTACAGG - Intergenic
1152128539 17:78461997-78462019 TTTTTATTATTTATACAGACAGG - Intronic
1152384671 17:79964894-79964916 TATATATAATATATATTGACAGG + Intronic
1152845658 17:82598264-82598286 TATTTATTTTTTATAGAGACGGG + Intronic
1153085715 18:1284391-1284413 AATTTTTATTTTATATTCACAGG - Intergenic
1153300160 18:3585241-3585263 TATTTACAATGTATATGCACTGG - Intronic
1153752424 18:8246491-8246513 TATTTTTAAAATATTTTGACAGG + Intronic
1153801068 18:8669405-8669427 TATCCATAATTTATAGTAACTGG - Intergenic
1153829318 18:8907237-8907259 TATATATAATATATATGGAATGG + Intergenic
1154006473 18:10533360-10533382 TAGTTTTAAACTATATTGACAGG + Intronic
1154051435 18:10962979-10963001 TATTTCTATTTAATTTTGACAGG - Intronic
1154140468 18:11819505-11819527 TATTTGTTATTTATATTCAAAGG - Intronic
1155079833 18:22397924-22397946 CATTAATAATTTATATGGGCTGG + Intergenic
1155380113 18:25211749-25211771 TATTTGTGATTTATATTGTGTGG + Intronic
1155622370 18:27794559-27794581 TAAATATATTTTATAATGACTGG + Intergenic
1156121907 18:33854671-33854693 TATTTATAACAGATATTGAAAGG + Intronic
1157356929 18:46944013-46944035 TATTTCTCATTTATCTTGTCTGG + Intronic
1157972869 18:52290406-52290428 TATTTATTATGTATATAGATAGG + Intergenic
1158194832 18:54873070-54873092 TATTTTTATTTTATATGGAAAGG - Intronic
1158231056 18:55255903-55255925 CATTTCTATTTTATACTGACAGG + Intronic
1158542857 18:58372477-58372499 TATTTATTTTTTATAGAGACAGG + Intronic
1159177443 18:64856224-64856246 GATTTAAATTTTATATGGACAGG - Intergenic
1159670785 18:71218194-71218216 TATTTATGATTGATAGTGCCTGG + Intergenic
1159887809 18:73925805-73925827 TATTTATCATTTATTTTGCTAGG + Intergenic
1160198004 18:76773022-76773044 TCTTTGAAATTTATTTTGACCGG + Intergenic
1160302326 18:77694497-77694519 TATGTATAAGTTATATTCAAAGG - Intergenic
1160655348 19:264115-264137 TATTAAAAATTTATGTTGGCCGG - Intergenic
1161361355 19:3851724-3851746 TTTTTATAATTTTAAGTGACTGG + Intronic
1162650561 19:12085749-12085771 TCTATCTAATTTATTTTGACAGG - Intergenic
1162842472 19:13366466-13366488 TATATATATTTTATAGAGACAGG + Intronic
1162930990 19:13957596-13957618 TCTTTTTAATTTATATTAAGTGG - Intronic
1163016159 19:14456162-14456184 TATTAGAACTTTATATTGACAGG + Intronic
1164028669 19:21380253-21380275 TATTTTTATTTTATTTTGAGTGG - Intergenic
1164053488 19:21603261-21603283 TATTTATTATTTAGGTTCACTGG - Intergenic
1164111756 19:22169276-22169298 TATTTTTATTTTATATTTAAGGG + Intergenic
1164142233 19:22482633-22482655 TATTTTTATTTTATATTCAAGGG - Intronic
1164667264 19:30049592-30049614 TATTTATCATATATAATGGCTGG + Intergenic
1167247712 19:48383683-48383705 TTTTTATTTTTTATAGTGACAGG + Intronic
1167654911 19:50757287-50757309 TATTTATTTTTTATAGAGACTGG + Intergenic
1167986424 19:53321595-53321617 TATTTATCATTTCTATGGGCTGG + Intergenic
1168249270 19:55132500-55132522 TATTTTTAATTTTTAGAGACAGG - Intergenic
1168447545 19:56433884-56433906 TATTTATATGTTCTATTGAGAGG - Intronic
1168671006 19:58241131-58241153 TATATATATTTTAAATTGGCTGG - Intronic
1202665845 1_KI270708v1_random:118810-118832 TATTTTTATGTCATATTGACAGG + Intergenic
925321652 2:2974805-2974827 TTTTTATGAAGTATATTGACAGG - Intergenic
926511523 2:13786801-13786823 TAATTATAATCTATGTTGACAGG + Intergenic
927481163 2:23455271-23455293 TATTTATAAAATATATTTTCAGG - Intronic
928006026 2:27562588-27562610 TATATATAATTTAATTTGGCTGG + Intronic
928067536 2:28181569-28181591 TATTTATCATTTCTATGTACTGG - Intronic
928564461 2:32530121-32530143 TTGTTATAATTTATATTGAGTGG + Intronic
928567652 2:32569372-32569394 TATTTTTAATTTTATTTGACAGG + Intronic
928808174 2:35187321-35187343 TATCTAGAATTTATATTCAATGG - Intergenic
929517224 2:42614801-42614823 TTTTTATTATTTATAGAGACAGG - Intronic
929830485 2:45343097-45343119 TATTTATAATATAAACAGACTGG - Intergenic
930823666 2:55674016-55674038 TATTTAAAATATGTATTGCCAGG - Intronic
930915842 2:56686425-56686447 TATTGATAATTTAGATTTGCAGG + Intergenic
931262522 2:60632571-60632593 TATTTATTATTTATAAAGACGGG + Intergenic
931605139 2:64045049-64045071 TATTTATTATTATTATTGAAAGG + Intergenic
932290794 2:70577180-70577202 TTTTTAAAATTTATATTCATAGG - Intergenic
932534217 2:72574775-72574797 TATTTATCATTTGCATTAACTGG - Intronic
932778408 2:74543518-74543540 TATTTAGAAGTAAAATTGACAGG - Intronic
933444338 2:82359043-82359065 TATTTTTAATTTCTATTGAGAGG + Intergenic
933645407 2:84809034-84809056 TATTTAAAATTCATATTCCCAGG - Intronic
933896746 2:86817907-86817929 TATTAAAAATATATATTCACTGG + Intronic
936004152 2:108867124-108867146 TATGTATAATTTATATAAATAGG + Intronic
936430802 2:112461094-112461116 TATTTCTTTTTTAAATTGACAGG + Intergenic
936593203 2:113823203-113823225 TATTTATAAATTTTATTAAATGG - Intergenic
936651224 2:114428740-114428762 GATTTATAATTTATAAAGAAGGG + Intergenic
937528851 2:122804423-122804445 CATTTGTAAATTATATTTACTGG + Intergenic
938104018 2:128517845-128517867 TATTTTTATTTTATTTTGAGTGG - Intergenic
938696314 2:133838272-133838294 TATTTATAATGTACTTAGACCGG - Intergenic
938896716 2:135759052-135759074 TAATTAAAATTTATTTTGGCTGG - Intronic
939434631 2:142158982-142159004 TTTTTATAATATATATTACCAGG - Intergenic
940395293 2:153182959-153182981 TATTTATGATTTATATTCCTTGG + Intergenic
940799056 2:158113253-158113275 TAGTTGTAATTTACATTCACTGG + Intronic
941446163 2:165602663-165602685 TATTTCTGATTTATAATTACTGG - Intronic
942086454 2:172448781-172448803 TATTTTTAAATTATACTTACTGG - Intronic
942634740 2:177991025-177991047 TATTTAAAATATATCTTGGCTGG + Intronic
942789820 2:179747951-179747973 ATTTTATAATTCATATTGATGGG - Intronic
943118230 2:183701651-183701673 TTTTTATAATGTAAATTAACAGG + Intergenic
943487063 2:188498505-188498527 TATTTATAACTGATTCTGACAGG - Intronic
943563074 2:189486341-189486363 TATTTTTAAACTATATTGACTGG - Intergenic
943861334 2:192867340-192867362 TTTTTATACTTTATATTTAGAGG + Intergenic
943938814 2:193963356-193963378 TATTTATATTTTTTCTTGTCTGG + Intergenic
944270363 2:197777610-197777632 TATTTTTAATTGATATTGTTTGG - Intronic
944524335 2:200602938-200602960 TATTAATAATAAATATTAACAGG - Intronic
944591279 2:201220147-201220169 AATGTCTAATCTATATTGACAGG + Exonic
944728459 2:202496189-202496211 TATTTATAATTGTTATGGCCAGG + Intronic
944923777 2:204441986-204442008 TATTTATAATTTTTAGTGCCAGG - Intergenic
945846086 2:214946799-214946821 TATGTGTAATTTATATTTCCAGG + Intronic
945883016 2:215346165-215346187 TATTTATTTTTTATAGAGACAGG + Intronic
946084180 2:217154483-217154505 TATTAATACTTTATATGGGCTGG - Intergenic
946303092 2:218836752-218836774 TATTTATTATTTATTGAGACAGG - Intergenic
946712821 2:222523685-222523707 TATTTATATATTATATTTATTGG + Intronic
947059878 2:226152104-226152126 TATTTATAAGATAAATTGATAGG + Intergenic
947887666 2:233587258-233587280 TGTTTATAATTTCCATTGAAGGG + Intergenic
947893886 2:233650287-233650309 TGTTTATAATTTCCATTGAAGGG + Intronic
947921576 2:233879975-233879997 TATGTATAATTTATATATAATGG + Intergenic
948036091 2:234859190-234859212 TATTTATATTTAAAATTCACAGG + Intergenic
948100992 2:235372965-235372987 TAATTATAATATATATGGATAGG - Intergenic
948559531 2:238842357-238842379 CATTTATATTTTTTCTTGACAGG + Intergenic
1169144584 20:3244075-3244097 TATTTTTAATTTTTTTAGACAGG + Intergenic
1169411907 20:5378023-5378045 TATATATATTTTATAGGGACAGG + Intergenic
1169775483 20:9247876-9247898 TTTGTATAATTTCTATTGAGAGG - Intronic
1170197543 20:13705401-13705423 TATTTTTTATTTTTAGTGACAGG + Intergenic
1170198783 20:13719872-13719894 TTTTTAAAACTTATATTTACAGG - Intronic
1170308751 20:14969919-14969941 TATTTATAAACTAAATTCACTGG + Intronic
1170940788 20:20846341-20846363 CATTTATAATTTTTTTTGACAGG + Intergenic
1171299372 20:24046242-24046264 TATTTACAACTTATATTGGTTGG - Intergenic
1171435701 20:25121886-25121908 TATTTATTTTTTATAGAGACAGG + Intergenic
1171496526 20:25560113-25560135 TTTTTAAAATTTTTATAGACAGG + Intronic
1172831698 20:37841143-37841165 TAGTTATTATTTGCATTGACAGG + Intronic
1173932767 20:46835181-46835203 TATATATAATATATATTTATGGG + Intergenic
1173945681 20:46948918-46948940 TATTTATTATTTATTGTGTCAGG + Intronic
1174609559 20:51787993-51788015 TATTTTTATTTTGTAGTGACAGG + Intronic
1174737720 20:52981531-52981553 TATGGAAAATTTATATTAACTGG + Intronic
1174960431 20:55150915-55150937 TATTTCTATTTTTTAATGACGGG + Intergenic
1176727440 21:10451240-10451262 TTTTTTTAATTTTTATAGACAGG + Intergenic
1176991424 21:15501798-15501820 TATTTACAATTTCTATTTACAGG - Intergenic
1177353695 21:19979516-19979538 TATTAATATTTTAGATTTACTGG - Intergenic
1178931746 21:36825210-36825232 TATTTATTTTTTATAGAGACAGG - Intronic
1180286958 22:10755789-10755811 TTTTTTTAATTTTTATAGACAGG - Intergenic
1180332556 22:11495740-11495762 TATTTTTATGTCATATTGACAGG + Intergenic
1180644494 22:17327331-17327353 TATTTTTAATTTTTTGTGACAGG - Intergenic
1180678763 22:17608429-17608451 TATTTATTATTTTTAGAGACAGG + Intronic
1181711122 22:24690313-24690335 AATTTATAATTTTTAATTACTGG - Intergenic
1181984841 22:26792997-26793019 TATTTATCATGTATATTAAGGGG + Intergenic
1182344622 22:29652924-29652946 TATTTTTTATTTTTATAGACAGG + Intronic
1182374996 22:29840161-29840183 TATTTTTAATTTTTAGAGACTGG - Intergenic
1182376007 22:29848599-29848621 TATTTGTAAATTATAATGAATGG - Intergenic
1182738641 22:32549422-32549444 TTTTTATTTTTTATAGTGACAGG + Intronic
1183892004 22:40937186-40937208 TATTAAAAATTTTTATTGCCGGG - Intergenic
949121879 3:394961-394983 CATTTCTAATTTACAATGACTGG - Intronic
949429452 3:3958785-3958807 TATTTTTAATTGCTATTTACAGG + Intronic
949675797 3:6451806-6451828 GATTTATACTTTATATTTATGGG + Intergenic
949973011 3:9427246-9427268 CATTTACAATTTACATTAACCGG + Intronic
950497719 3:13344052-13344074 TATTTATTATTTTTAGAGACAGG + Intronic
950873687 3:16251030-16251052 TTTTTATATTTTATAGAGACAGG - Intergenic
950938674 3:16870593-16870615 TTTTTTTAATTTTTAGTGACAGG - Intronic
951303207 3:21024029-21024051 TAATTATAAATTTTATTGAATGG + Intergenic
951693657 3:25423402-25423424 TATGTATTATTTATTTTGAAGGG + Intronic
951975693 3:28505289-28505311 TATTTATAAGTCTTATTGCCAGG + Intronic
952666639 3:35913612-35913634 TATTTAAAATTTATACAGATTGG + Intergenic
953072673 3:39537646-39537668 CATTGATATTTTACATTGACAGG - Intergenic
953456924 3:43049979-43050001 TAATTATAATCTATACTGATGGG - Intronic
953964032 3:47288627-47288649 TATTTGAAATTTAAATTCACTGG + Intronic
954307890 3:49740144-49740166 TTTTTATATTTTATAGAGACAGG - Intronic
955129397 3:56149697-56149719 TATTGAAAATTTATAGTGATTGG + Intronic
955380041 3:58431048-58431070 TATTTTTATTTTTTATGGACAGG + Intronic
955756990 3:62235098-62235120 TATTTATAATCTAAAATGTCTGG - Intronic
955808233 3:62758983-62759005 TTTTTCTTATTTATATTGAAAGG - Intronic
955934040 3:64085464-64085486 TATTTATAATAAATATTTAGCGG + Intergenic
956804687 3:72797594-72797616 TATTTAAAAATTATATTGCAAGG + Intronic
957090053 3:75720671-75720693 TATTTTTATGTCATATTGACAGG - Intronic
957160587 3:76603860-76603882 TATGTATATTTAATTTTGACAGG - Intronic
957257201 3:77853300-77853322 TATTAATAATTGACATTGATAGG + Intergenic
957342155 3:78914682-78914704 TATTTATAATTTATATTTATAGG + Intronic
957437571 3:80198316-80198338 TATTTAAAATTTTTATTTGCTGG + Intergenic
957684657 3:83486130-83486152 AATTTATAATTTATATTGCTAGG + Intergenic
957799750 3:85060908-85060930 TATTTATATTATATTTTAACTGG - Intronic
958105144 3:89062855-89062877 TATGTTTGATATATATTGACTGG + Intergenic
958193130 3:90208796-90208818 TATGTATGATTTATATACACAGG + Intergenic
958625743 3:96622018-96622040 TATATATATTTTATATACACGGG - Intergenic
958784207 3:98579419-98579441 TATTTATATTTTTTGTTGCCAGG - Intronic
959154182 3:102646565-102646587 TATTTAGAAGTAAAATTGACAGG - Intergenic
959352544 3:105284190-105284212 TTTTTATAATTTTTATAGAATGG + Intergenic
959429158 3:106231279-106231301 TATTTTTAATTTATGTTCATAGG + Intergenic
959878416 3:111414293-111414315 GATTTATAATTTAGATTTAGAGG - Intronic
960316002 3:116178170-116178192 TAATTTTTATTTATTTTGACAGG + Intronic
960464241 3:117976644-117976666 AAATTATAATTTATATTCAATGG - Intergenic
960693111 3:120367998-120368020 TATTTCTCATTTAACTTGACAGG - Intergenic
961162498 3:124740939-124740961 TATTTTTAATTTTTTTTGACAGG - Intronic
961242553 3:125424690-125424712 TCTTTATATTTTATAGAGACAGG - Intergenic
961574968 3:127827428-127827450 ATTTTAAAATTTATATTGAAAGG - Intergenic
962296863 3:134198167-134198189 GATTGATAATTTATTTAGACTGG - Intronic
962697479 3:137964679-137964701 TATTTTTATTTTTTATTTACAGG + Intergenic
963085741 3:141434834-141434856 TATATTTAATTTATATAGGCTGG + Intronic
963439906 3:145326013-145326035 TAATTATAATTTATCCTGTCTGG - Intergenic
963533449 3:146498797-146498819 TATTTATAAATTATACTGGAGGG + Intergenic
963573004 3:147020794-147020816 TATATATCTTTTATATAGACAGG - Intergenic
963990901 3:151652670-151652692 TTTTAATAATATACATTGACTGG + Intergenic
964249662 3:154698191-154698213 TATTTATATTATATATTTAATGG - Intergenic
964592190 3:158377287-158377309 TCTTTATAATTGATATTGTTTGG + Intronic
964821187 3:160771818-160771840 TATTTAGAATATAAATTAACAGG - Intronic
964985968 3:162739598-162739620 TATTTTAAATTTATAGAGACAGG + Intergenic
965071047 3:163915722-163915744 TATTTAAAATATATCTTAACTGG - Intergenic
965071049 3:163915779-163915801 TATTTAAAATATATTTTAACTGG - Intergenic
965254532 3:166388727-166388749 TTGTTATAATTTTTATTGACTGG + Intergenic
965280399 3:166744438-166744460 AATTTTTAAATTATATTAACAGG - Intergenic
965455770 3:168897871-168897893 AAATTCTAATTTATATTTACAGG - Intergenic
965491750 3:169345777-169345799 TATTTATATTTCATATTGGCTGG - Intronic
965648687 3:170910233-170910255 TATTTAGTATTTATATAGGCAGG + Intergenic
965833100 3:172818829-172818851 TATTTAAAATTTGTATTTGCGGG + Intronic
966088380 3:176099515-176099537 TCTTCATAATGTTTATTGACTGG - Intergenic
967050225 3:185776358-185776380 TGTTTATAATTTAAAGTGACAGG + Intronic
967383960 3:188892066-188892088 TATTTATAATTTACATTTCAAGG + Intergenic
967435688 3:189443375-189443397 TATTTTTATTTTATATCGAGTGG + Intergenic
967588532 3:191244573-191244595 TATTTATAATATATATATAATGG - Intronic
968176298 3:196552490-196552512 TAATTAAAATTTATATTTAATGG + Intergenic
968564049 4:1300318-1300340 TATTTCTTATTTATAATGAAAGG + Intronic
968822194 4:2862756-2862778 TATTTATCATGTTTATTGCCTGG + Intronic
970199342 4:13586999-13587021 TATTTATATTTTATATTATTTGG - Intronic
970645004 4:18109535-18109557 TAATTATAATATATAGTGTCTGG - Intergenic
970682139 4:18521962-18521984 CATTTTTAATTTATGTTGAACGG - Intergenic
971059665 4:22953492-22953514 TAATTATATTTAATATTAACAGG - Intergenic
971588614 4:28437498-28437520 TATTTCCAATTTGTATTGCCTGG + Intergenic
971719751 4:30230317-30230339 TATTTATAATGCATATTTTCTGG - Intergenic
971794677 4:31211529-31211551 TTTTTATATTTTTTACTGACAGG + Intergenic
971865350 4:32163528-32163550 TATATCTAATTTGTATTGTCTGG + Intergenic
972116075 4:35635553-35635575 TCATTATAATTTATATTTTCTGG - Intergenic
972521539 4:39861926-39861948 TTTTTACTATTTATATTGAGAGG - Intronic
972706790 4:41552579-41552601 TGTTTATAATTTTTATGGATTGG - Intronic
973031145 4:45341929-45341951 TATTTATTATTTTTATAGACAGG + Intergenic
973665077 4:53150995-53151017 TAGTAATATTTTATATTTACTGG - Intronic
974139325 4:57864444-57864466 ATTTTATAATTTATAGAGACAGG + Intergenic
974336586 4:60554822-60554844 TGTTTATAATCTCTATTGATGGG - Intergenic
974493775 4:62601264-62601286 TTTTTATATTTTGTAGTGACTGG + Intergenic
974572690 4:63674402-63674424 CATTTTTAATTTTTGTTGACTGG + Intergenic
974663697 4:64929831-64929853 TATTTATATAATATATTGGCTGG - Intergenic
974736780 4:65945810-65945832 TCTGTATAATTTATATTCATTGG + Intergenic
975066279 4:70068321-70068343 TATTTACAATTTATTTTTAAAGG - Intergenic
975107575 4:70585916-70585938 TATTTATCATTTATTTTAGCAGG + Intergenic
975117896 4:70699449-70699471 TATCTATAATATATATAGAGAGG + Intergenic
975132237 4:70841122-70841144 TATTTATTTTTTGTATAGACGGG - Intergenic
975617744 4:76264512-76264534 TAATTAAATATTATATTGACTGG - Intronic
975981450 4:80164880-80164902 TATTTATTTTTTGTAGTGACAGG - Intergenic
976247504 4:83018431-83018453 TATTTATTTTTTATAAAGACAGG - Intergenic
976504473 4:85831164-85831186 TATTTATTATTTATGATGATGGG - Intronic
976723488 4:88193051-88193073 TATTTTTAATATATTTTGAAAGG - Intronic
976956267 4:90903979-90904001 AATTAATAATTTTTTTTGACAGG + Intronic
977049282 4:92106714-92106736 TATTTATAATTTATTTTGTGAGG - Intergenic
977461666 4:97333408-97333430 TGTTTATAATATATATGCACAGG - Intronic
977959517 4:103070282-103070304 TATTTATTATTTATAGTCATTGG + Intronic
978125715 4:105133018-105133040 TATTTTCAATTTACATTGTCTGG + Intergenic
978383557 4:108156702-108156724 TTTTTATAATTTTTATTGTAAGG + Intronic
978736845 4:112093388-112093410 TTTTTATTATTTATAATGTCTGG + Intergenic
979149496 4:117291780-117291802 TATTTATTATCTATATTGTATGG - Intergenic
979586870 4:122430432-122430454 TATTTATAATTTAGATTAACAGG + Intergenic
979655410 4:123187129-123187151 TATTTATAATTTTGAATGACTGG - Intronic
979829110 4:125278662-125278684 TTTGTATAATATATAGTGACAGG + Intergenic
979880646 4:125954912-125954934 TATTTATTATTTATATTCAGTGG - Intergenic
980401526 4:132292821-132292843 TAATTATCATTTATTTTGAATGG - Intergenic
980447162 4:132924059-132924081 AATTTATATTTTTTATTGCCTGG - Intergenic
980692463 4:136313148-136313170 TATATATACTTTTTATTGACAGG + Intergenic
981065286 4:140477308-140477330 TAATTATAATATAAAGTGACTGG - Intronic
981083889 4:140662802-140662824 TAATTAAAATTTAGATTGAGAGG - Intronic
981239423 4:142458505-142458527 TATTTATTATTAATATGGCCAGG + Intronic
981832376 4:149017160-149017182 TTTTTATAATTTAGACTCACTGG - Intergenic
981985909 4:150855523-150855545 TATATGTAATTTATATGTACAGG + Intronic
982530866 4:156541536-156541558 TAATTATAATTTATGTTCCCAGG - Intergenic
982602659 4:157470914-157470936 TTTTTATAATTTATTTTACCAGG - Intergenic
982608510 4:157543473-157543495 TATTTATTTTTTATATTTAGTGG + Intergenic
982692950 4:158568314-158568336 TCTTTAAAATTTATATTTAGTGG - Intronic
982749428 4:159141866-159141888 TATAAATAATTTATATTAAGTGG + Intronic
982997908 4:162374608-162374630 TCTTAATATTTTATATTGAATGG + Intergenic
983040314 4:162917103-162917125 TATCTGTCATTTATATTGATGGG - Intergenic
983232441 4:165142656-165142678 TATTTAGAAATTATATTTACTGG - Intronic
983336833 4:166405431-166405453 TAATAATAATTAATATAGACAGG - Intergenic
983375343 4:166920433-166920455 TCTATTTAATTTGTATTGACAGG + Intronic
983380874 4:166991665-166991687 TATTTAAAATTGGTATGGACTGG - Intronic
983470752 4:168151403-168151425 TATTTTTAATTTAAATGGAGTGG + Intronic
983756123 4:171338921-171338943 TTTGTATAATTTATATTTGCAGG + Intergenic
983779814 4:171654211-171654233 TCTTTAAAATTTATTTTGCCAGG + Intergenic
984080294 4:175240140-175240162 AATTTATAACTTATATTCACTGG - Intergenic
984534697 4:180959640-180959662 TATTTTTAATTTATGTTGTTTGG + Intergenic
984799449 4:183700106-183700128 TATTAATAATTAACATTGGCTGG - Intronic
984953400 4:185022709-185022731 TATTAATAATTTATATTTCCAGG - Intergenic
985239864 4:187918885-187918907 TTTTTATAATTTCAAGTGACTGG - Intergenic
985897265 5:2756129-2756151 TATTTATAATTTACATTCTAGGG + Intergenic
986428915 5:7662556-7662578 TATTTTTAATTTATAGTGCTGGG + Intronic
986930405 5:12812296-12812318 TATTAATATCTTATATTGCCTGG - Intergenic
987607799 5:20160518-20160540 TATTTATAAGTTATATATTCAGG - Intronic
988004984 5:25398311-25398333 TTGTTATAATTTATATTAACTGG - Intergenic
988244355 5:28659957-28659979 TATTTATAAATTAAATTGGTGGG - Intergenic
988357043 5:30191467-30191489 TATTTATAAGTTATATTTTATGG + Intergenic
988390571 5:30623130-30623152 AATTTATAATTTATAATTGCTGG - Intergenic
988982287 5:36583462-36583484 TATTCATATACTATATTGACAGG - Intergenic
989079643 5:37604250-37604272 TTTTTAAAATATATTTTGACTGG + Intronic
989741570 5:44779325-44779347 AATTTCTAATTTATCTTTACTGG - Intergenic
990345469 5:54866495-54866517 TATTTATTATTTAGATTTATGGG - Intergenic
990620749 5:57556196-57556218 TTTTTATATTTTGTATAGACAGG + Intergenic
990900658 5:60745052-60745074 TATTTATATTTTAAATTCAAGGG + Intergenic
991099378 5:62775932-62775954 TATTTTTATTTTATTTTGAGTGG - Intergenic
991735010 5:69623871-69623893 TATTTATTATTTTTTGTGACAGG + Intergenic
991779968 5:70122847-70122869 TATTTATTATTTTTTGTGACAGG - Intergenic
991811444 5:70479006-70479028 TATTTATTATTTTTTGTGACAGG + Intergenic
991859255 5:70998277-70998299 TATTTATTATTTTTTGTGACAGG - Intronic
991872415 5:71123170-71123192 TATTTATTATTTTTTGTGACAGG - Intergenic
992172543 5:74118490-74118512 TATCTATAGATAATATTGACAGG - Intergenic
992273373 5:75089130-75089152 TCTTTATAAGTTATATTATCTGG - Intronic
992578804 5:78150019-78150041 TATTTAAAATTGGTCTTGACTGG + Intronic
993058226 5:83007565-83007587 TAAATATAATTTATATTCATTGG + Intergenic
993071940 5:83176020-83176042 TATTATTATTTTATATAGACAGG - Intronic
993276010 5:85859838-85859860 TAATTATAATATATATTTATTGG + Intergenic
993420158 5:87691659-87691681 TATTTACAAGTAATATTGATAGG + Intergenic
993521138 5:88902735-88902757 TATTAGTAATTTATATTGGTAGG + Intronic
993556165 5:89341991-89342013 TTTTTATCAATTATATTGCCAGG - Intergenic
993571981 5:89552105-89552127 TTGTTAAAATTTCTATTGACAGG - Intergenic
993613506 5:90083214-90083236 TATTTATTATTTTTATAAACAGG + Intergenic
993798982 5:92305733-92305755 GATTTATAATTTATTTTTTCTGG - Intergenic
993840970 5:92878169-92878191 CTGTTATAATTGATATTGACAGG - Intergenic
994195204 5:96915303-96915325 TATTTATAAATTATATGGGCTGG - Intronic
994448016 5:99902490-99902512 TATTTACATTTTATACTTACAGG + Intergenic
994509921 5:100689424-100689446 ACTTTATTATTTATATTGAGAGG - Intergenic
994581285 5:101645821-101645843 TTTTTAAAATTTATTTTGAATGG + Intergenic
994914291 5:105953448-105953470 GATTTATAATTTATTTTTAAGGG - Intergenic
995089715 5:108160010-108160032 TTTTTCTAATTTTTTTTGACAGG - Intronic
995211582 5:109545746-109545768 TATTTTAAAATTATATTGATAGG + Intergenic
995597659 5:113764971-113764993 TTTTTATTATTTGTATAGACAGG - Intergenic
996048307 5:118901668-118901690 TTATTTTAATTTTTATTGACAGG - Intronic
996069185 5:119114962-119114984 TATTTAAAATTTTTAATGGCCGG - Intronic
996375160 5:122797509-122797531 TATTTATAATACATTTTAACAGG + Intronic
996651175 5:125878945-125878967 TATTTATTATTGGGATTGACTGG - Intergenic
996803693 5:127430903-127430925 TTTTTATAATTTATATTCAAAGG + Intronic
997382686 5:133449022-133449044 TATATATATATTATATAGACAGG + Intronic
997414967 5:133720289-133720311 TATTGATAGTTTGTATTTACAGG - Intergenic
997650638 5:135515560-135515582 TCTTTATATATTATGTTGACAGG + Intergenic
998510715 5:142711902-142711924 TATATATAGTCTATATTGATGGG + Intergenic
998518560 5:142779193-142779215 TTTTTACAAATTATAGTGACTGG + Intronic
998917515 5:147031482-147031504 TTTTTTTAATTTATCTTGACTGG + Intronic
999436170 5:151565501-151565523 TATTTTTAATTTGTTTTTACTGG - Intronic
999689269 5:154132629-154132651 TATTGATAATTTATTTTTCCTGG - Intronic
1000140266 5:158396525-158396547 CATTTAAAATAAATATTGACTGG + Intergenic
1000494244 5:161958806-161958828 TATTTCTAAAATATATTTACAGG + Intergenic
1000549724 5:162645759-162645781 TAATCATAATTTATATGCACTGG - Intergenic
1000972152 5:167726463-167726485 TATTTATTATTTTTAGAGACAGG + Intronic
1001160993 5:169312872-169312894 TTTTTATAAGTTATATTTTCAGG - Intergenic
1001386468 5:171343503-171343525 TATTTATTTATTATTTTGACAGG - Intergenic
1002037087 5:176480167-176480189 TATTAATAGTTTATACTGAGTGG + Intronic
1002098862 5:176847559-176847581 TGTATATAATTTATATCCACTGG + Intronic
1003156282 6:3598238-3598260 TATTTATAATTTCTATATATTGG + Intergenic
1003835223 6:10064454-10064476 TATATATAATTTTTTTTCACTGG + Intronic
1005204721 6:23389067-23389089 TATACATAATTTATATATACAGG - Intergenic
1005222771 6:23607069-23607091 TATTTTTAATTTTTAGAGACAGG + Intergenic
1005639153 6:27778035-27778057 TATATATAATATATATTTAGAGG - Intergenic
1005776165 6:29133287-29133309 TATTAATAAGTAATTTTGACTGG - Intergenic
1005779380 6:29172703-29172725 AATTTATAATTTGTATTTTCTGG - Intergenic
1006530877 6:34652790-34652812 TAATGACAATTTATGTTGACTGG - Intronic
1006539875 6:34730848-34730870 TATTTATGATTTACAGTGCCAGG + Intergenic
1007557369 6:42777968-42777990 AAATTATAGTTTATATAGACAGG - Intronic
1007885882 6:45229813-45229835 TATTTATTATTTTTATGTACAGG + Intronic
1008070923 6:47098038-47098060 TAATTATAATTTCCATTTACAGG - Intergenic
1008097967 6:47359512-47359534 TATTTACTATTTATGTTGATTGG - Intergenic
1008216033 6:48790224-48790246 TATTTTTAAATAATATTGAATGG - Intergenic
1008790286 6:55223386-55223408 TATTTTTAATTTATGGTTACAGG - Intronic
1008827668 6:55717564-55717586 TTTTTAAAATTTATAATGATAGG - Intergenic
1008832191 6:55778948-55778970 TATTTCAAATTTATAGTCACAGG + Intronic
1008911800 6:56741980-56742002 TTATTACAATCTATATTGACTGG + Intronic
1008955099 6:57206901-57206923 AATTGATCATTCATATTGACAGG - Intronic
1009448639 6:63774600-63774622 TATTTATAATTTTTTCTGATTGG - Intronic
1009612355 6:65962916-65962938 CATTTATTATTTTTATTGAAAGG - Intergenic
1009618388 6:66039659-66039681 TATTTATAGTTTACATTGACCGG - Intergenic
1010378785 6:75204491-75204513 TTTTTAAAACATATATTGACGGG - Intronic
1010627877 6:78160691-78160713 TATTTATTATTTAGGTTCACCGG - Intergenic
1010742303 6:79522953-79522975 TATTTATAAATAAAATTGTCTGG + Intronic
1011066557 6:83333137-83333159 CATTTATAATTTGTATTTAAAGG + Intronic
1011074260 6:83421228-83421250 TCTTTATTATTAATATTGATTGG + Intronic
1011379416 6:86726415-86726437 TATTTAAAATTTAAATCAACAGG + Intergenic
1011438621 6:87364921-87364943 GATTTATAATTTAGATGGATTGG - Intronic
1011990174 6:93505288-93505310 TATTTATAATTTATTATGCATGG - Intergenic
1012234340 6:96795940-96795962 CATTTCTAATTTTTATTCACAGG - Exonic
1012465013 6:99507246-99507268 AATTTAAATTTTATATTCACAGG + Intronic
1012648183 6:101716252-101716274 TATTTATTATTTATTATCACAGG - Intronic
1012684238 6:102224505-102224527 TACTAATAGTTTATGTTGACTGG - Intergenic
1012721169 6:102747752-102747774 TATTTATTATTTATTTTAAACGG + Intergenic
1012943766 6:105444322-105444344 TGTTTAAAATTTCTATTGAAAGG + Intergenic
1013155012 6:107485183-107485205 TATATTTAATTTATATTAATGGG + Intergenic
1013556536 6:111261886-111261908 TATTAAAAATTTAAATTGGCCGG - Intronic
1014057007 6:117027634-117027656 TATCCATATTTTACATTGACTGG + Intergenic
1014687831 6:124525614-124525636 TATTTATACATTATTATGACAGG - Intronic
1014960766 6:127681667-127681689 TATTTATAATTTTCAGTCACAGG + Intergenic
1015580028 6:134714301-134714323 TCTTTATTATTTATATTTCCCGG + Intergenic
1015835763 6:137418550-137418572 GATTTATAATTTATATTTGGAGG - Intergenic
1015918343 6:138241371-138241393 TATGTAAAATTTAGATTTACTGG + Intronic
1016297302 6:142587068-142587090 TATGTATAATGTAGATTTACTGG + Intergenic
1016540940 6:145163548-145163570 TTTTTATTTTTTATTTTGACAGG + Intergenic
1016551899 6:145290659-145290681 TATTCAAAAACTATATTGACTGG - Intergenic
1016859422 6:148701873-148701895 TATTTTTCATTTATTTTGAGTGG + Intergenic
1017163284 6:151385784-151385806 TATTAATAATTAATATTGGAGGG + Intronic
1017222239 6:151979263-151979285 TATTTATAATTGCTATCGGCTGG - Intronic
1017241434 6:152173939-152173961 TATTTATAACATATTTTGTCTGG - Intronic
1017857554 6:158363981-158364003 TTTTTTTAATTTATTTTGAAAGG - Intronic
1017965519 6:159261690-159261712 TATCTTTAATTAATATTGAGAGG + Intronic
1018337155 6:162805274-162805296 TAAATATAATTTATATGCACTGG - Intronic
1019896265 7:3985615-3985637 TATTTATTTTTTGTATAGACAGG - Intronic
1020583359 7:10033245-10033267 TATTTATAATTTAGTTTGCAGGG - Intergenic
1020588289 7:10100948-10100970 TATTTATTATATATATTTATAGG + Intergenic
1020594467 7:10187566-10187588 TATATACAATATATATTTACGGG - Intergenic
1020610217 7:10387004-10387026 TATTTAAAAATTATATTGTATGG + Intergenic
1020869670 7:13611695-13611717 AATTTATAATATATATTTAAAGG - Intergenic
1020925807 7:14322722-14322744 TATATATAATTTATATTTGAAGG - Intronic
1021910697 7:25383426-25383448 TCTTTATATTTTATTTTCACTGG - Intergenic
1023064693 7:36365901-36365923 TGTATATCATTTATGTTGACAGG - Intronic
1023279539 7:38555397-38555419 TATTTATTATTTTTAAAGACAGG - Intronic
1025153639 7:56583585-56583607 TATTTTGAATTTACATTCACTGG + Intergenic
1025191412 7:56898490-56898512 TATTTATAGTTTGTAGAGACAGG - Intergenic
1025239761 7:57261394-57261416 TATTTAAAATTTTTATTGGTGGG + Intergenic
1025601736 7:63006437-63006459 TATTTAGGATTTATATTTTCTGG - Intergenic
1025680536 7:63678444-63678466 TATTTATAGTTTGTAGAGACAGG + Intergenic
1025954616 7:66173000-66173022 TATCTATAATTTATTTTAAATGG - Intergenic
1026094816 7:67337266-67337288 TATTAGTAATTTATATTGGTAGG - Intergenic
1027713259 7:81635338-81635360 TATTTATAATATATATAAAATGG + Intergenic
1027763986 7:82316101-82316123 TATTTAAAATTTATAATTATAGG - Intronic
1027969114 7:85054986-85055008 TATTTATAATTTACATAAAATGG + Intronic
1028311372 7:89341852-89341874 TATTTATATTATATATTTAAAGG + Intergenic
1028387938 7:90280365-90280387 TTTTTGTATTTTATATAGACAGG + Intronic
1028729735 7:94132023-94132045 AATATATAATTTATAATTACTGG + Intergenic
1028765113 7:94546934-94546956 TACTTGTAATTTATACTAACTGG + Intronic
1028887955 7:95955494-95955516 TATTTATTATTTTTAGAGACAGG + Intronic
1030020177 7:105266384-105266406 TATTTATATTTTGTATTTAGAGG + Intronic
1030799659 7:113833998-113834020 TTTTTTTAATTAATATTTACTGG + Intergenic
1031184467 7:118458524-118458546 TATTTATAATTTTACTGGACAGG + Intergenic
1031773392 7:125874664-125874686 CATTTATAATCAATTTTGACTGG - Intergenic
1032041695 7:128568323-128568345 TTTTTTTAATTATTATTGACTGG - Intergenic
1032296174 7:130640448-130640470 TATTTATTATTTGTAATCACTGG + Intronic
1033383090 7:140843513-140843535 CATTTATAATTTTTATGGATTGG + Intronic
1033716413 7:144007492-144007514 TATTTATATTTTATTTTGTGGGG - Intergenic
1033772382 7:144566746-144566768 AATTTATAATTTATGGTAACAGG - Intronic
1033809036 7:144988875-144988897 TTTTTATTGTTTATATTGAATGG - Intergenic
1034029944 7:147750241-147750263 TTTTTATAATTTTTATTAAATGG + Intronic
1034199648 7:149275898-149275920 TATTCATAATTTTTTTTGGCAGG + Intronic
1034477854 7:151297947-151297969 TATTCCTACTTTATATTGGCAGG + Intergenic
1035771936 8:2154692-2154714 TATTTAAAAGGTATATTGAAGGG + Intronic
1037024390 8:14015441-14015463 CATTTATTATTTATTTTGAGGGG + Intergenic
1037036420 8:14174432-14174454 TACTTCTAATTTAAATTTACTGG + Intronic
1037195240 8:16180747-16180769 TATTTTCAAAATATATTGACAGG - Intronic
1038220114 8:25599447-25599469 TATTTATTATTTTTAGAGACAGG - Intergenic
1038530334 8:28313478-28313500 TTTTTATATTTTATAGAGACAGG + Intergenic
1038550650 8:28465607-28465629 TTTTTTTTATTTTTATTGACAGG - Intronic
1038831238 8:31063003-31063025 TATTTATAGTTTTTAAAGACAGG + Intronic
1039130236 8:34255845-34255867 TAATTATAATTTATCTTGTAAGG - Intergenic
1039226244 8:35391709-35391731 TATTTATAATTTAAAAAGCCTGG + Intronic
1039336339 8:36594530-36594552 TATTAATAATTTATTTTGCAAGG - Intergenic
1039522056 8:38179451-38179473 AATTTATAATTAATCTTGGCCGG - Intronic
1039661045 8:39466055-39466077 AATTTAAAATTTATATTAAATGG - Intergenic
1039736824 8:40341615-40341637 TTTTTAGGATTTAGATTGACCGG - Intergenic
1039946153 8:42130395-42130417 TATTTATATTTTGTAAAGACAGG - Intergenic
1040057765 8:43075517-43075539 TATAAAAAATTTATATTGCCTGG + Intronic
1040737140 8:50521987-50522009 TACTCATGATTAATATTGACAGG - Intronic
1040880083 8:52194964-52194986 TATTTATATTTTATATTGAATGG - Intronic
1041596384 8:59658388-59658410 TATTTACAATTTCTATTGAAGGG - Intergenic
1041684861 8:60634110-60634132 TATTTTTAATTTTTAGAGACGGG - Intergenic
1041871937 8:62644679-62644701 TATTGATTATAAATATTGACTGG + Intronic
1041925594 8:63232574-63232596 TATTTGAATTTTATTTTGACAGG + Intergenic
1042127061 8:65548894-65548916 TTTTTATAATTTATTTTAATGGG - Intergenic
1042593365 8:70420387-70420409 TGTTTCTAATTTATTTTTACTGG - Intergenic
1042867726 8:73370243-73370265 TATTTATTTTTTATAGAGACAGG - Intergenic
1043264119 8:78241013-78241035 TGTTTATATTTTATAAAGACAGG + Intergenic
1043732085 8:83695180-83695202 TATATTTAATGTCTATTGACAGG - Intergenic
1043752665 8:83959820-83959842 TATGTATAATTTATATAGTTTGG - Intergenic
1043787237 8:84418708-84418730 TCATTAAAATTTATATTCACTGG + Intronic
1043879686 8:85528302-85528324 TAATTATAAATTATTTTGAAAGG + Intergenic
1044076201 8:87824547-87824569 TACTTTTAATTTTTATAGACAGG + Intergenic
1044214611 8:89594523-89594545 TATATATAATTTATTTTAAGGGG + Intergenic
1044753022 8:95434264-95434286 CATTCATATTTTAGATTGACTGG - Intergenic
1044773575 8:95663444-95663466 TCTTTATAAATTATGTAGACAGG + Intergenic
1045208016 8:100063791-100063813 TATATATACTTTATTTTGAGAGG - Exonic
1045359889 8:101423283-101423305 TATTTACAATATTTATTGAAAGG - Intergenic
1045415412 8:101961599-101961621 TACTTTTATTTTTTATTGACAGG + Intronic
1045630012 8:104107920-104107942 TATTTATTATTTATTGAGACAGG - Intronic
1046333276 8:112750032-112750054 TCTTTATAAATTTTATTGTCAGG - Intronic
1046400179 8:113695251-113695273 TATTATTAGTTTTTATTGACAGG + Intergenic
1046890973 8:119420403-119420425 TACTTATGATTTCTATTTACTGG + Intronic
1047443264 8:124898007-124898029 TATTTATATTTTTTAGAGACAGG + Intergenic
1048870002 8:138789542-138789564 AATGTATAATTTATATTTTCTGG + Intronic
1049076682 8:140402193-140402215 TATTTTTTATTTGTAATGACAGG - Intronic
1049103373 8:140595651-140595673 TATATATAATATATATAGCCTGG - Intronic
1050111857 9:2225139-2225161 GATTTATAGTTTATTTTTACTGG + Intergenic
1050287965 9:4123479-4123501 TATTTATAATTTTTAAAGAATGG + Intronic
1050644697 9:7706621-7706643 TATTTATAATTTAAATGCAGGGG + Intergenic
1050664288 9:7917959-7917981 TATTTATAGTTTAAAGTGACAGG + Intergenic
1050871543 9:10577355-10577377 TATTGATCATTCATATTGAATGG + Intronic
1051453552 9:17225522-17225544 TATTTATAATATAAATTGACTGG + Intronic
1051540445 9:18210217-18210239 TATTTATACTTTATATTTGGAGG - Intergenic
1051735460 9:20193480-20193502 TATATATAATTTCTATTTAAGGG - Intergenic
1052518523 9:29513162-29513184 TATATATAATATATATATACAGG - Intergenic
1054846539 9:69804500-69804522 TATTTGGAATATATAATGACAGG + Intergenic
1054988647 9:71295279-71295301 AATTTTTAATTTCTATTCACAGG - Intronic
1055261547 9:74441167-74441189 TATTGATGATTTATATTTATAGG - Intergenic
1055291306 9:74784938-74784960 TTTTTATTATTTATATAGACAGG - Intronic
1055302919 9:74900750-74900772 TATGTAGAACATATATTGACTGG - Intergenic
1055661649 9:78509637-78509659 TTTTTATAATTGTTGTTGACTGG + Intergenic
1055843971 9:80538882-80538904 TATCTATAATATGTATTTACAGG - Intergenic
1056404991 9:86265105-86265127 TATTTTTATTTTATTTTGAGTGG - Exonic
1057582590 9:96301034-96301056 TATTTATTATTTGTATTAGCAGG + Intronic
1058068552 9:100577107-100577129 TATTTATAAGATATATGGACTGG + Exonic
1058177199 9:101749780-101749802 TACTTATCATTTAAACTGACTGG - Intergenic
1058306148 9:103442853-103442875 TATTTTTAATATATTTTAACTGG + Intergenic
1059083772 9:111277590-111277612 TGTTTACAATTTATATCCACAGG - Intergenic
1059370771 9:113832001-113832023 CAAATATAATTTATAGTGACAGG + Intergenic
1059699989 9:116766021-116766043 TACTTAATAGTTATATTGACAGG - Intronic
1060657777 9:125384453-125384475 TATTTATATTTTGTAGAGACAGG + Intergenic
1060675331 9:125509140-125509162 TATTTATCATTTCTATACACTGG - Intronic
1061012273 9:127962704-127962726 TATTTATAATTTTTCTTCATAGG - Intronic
1185728576 X:2443201-2443223 TTTTTAAATTTTATATAGACGGG + Intronic
1185975674 X:4717230-4717252 TATTTAGAAAATATATTTACTGG + Intergenic
1185988943 X:4871289-4871311 TATTTCTAATTTTTATTTTCTGG + Intergenic
1186279964 X:7981467-7981489 TATTTATACTTTTTTGTGACCGG + Intergenic
1186284468 X:8028502-8028524 TTTTTATATTTTATAGTGATAGG + Intergenic
1187005404 X:15228216-15228238 TTTTTAAAATTTAAATTTACAGG + Intergenic
1187013818 X:15306745-15306767 TATTTATAATTTGCATAAACTGG + Intronic
1187087255 X:16053724-16053746 TATTTAAAATTTATAATAAAAGG - Intergenic
1187690458 X:21861042-21861064 TATTTATAATCTATATAGGGAGG - Intronic
1187734669 X:22291560-22291582 TATTTATTTTTTATTTTAACTGG - Intergenic
1187985885 X:24810564-24810586 TAATTATTATTTATATTGTCAGG - Intronic
1188138314 X:26517276-26517298 TATTTGTAATATATATTGTTGGG - Intergenic
1188232255 X:27679219-27679241 TATTTCTCATTTATCTTGAGGGG + Intronic
1188301515 X:28509588-28509610 TATCTAAAATTTATTTTGAAGGG - Intergenic
1188316062 X:28674937-28674959 TATTTTAAATTCATATTGCCAGG - Intronic
1188749587 X:33888181-33888203 TATTTATAAGCTATAATTACTGG + Intergenic
1188951278 X:36378118-36378140 AATTTAAAATTCAAATTGACAGG - Intronic
1189484689 X:41421143-41421165 TGTTTATTCTTTATATTAACTGG - Intergenic
1189499363 X:41541232-41541254 TATTTTTATTTTGTATAGACAGG + Intronic
1190716254 X:53106155-53106177 TATTTATAATTCATATTATCTGG - Intergenic
1191011533 X:55764355-55764377 TATTTAAAATTTATAAAGAAAGG + Intergenic
1191921484 X:66261305-66261327 TCTTTATATTTTATATGGAGAGG + Intronic
1192314212 X:70039381-70039403 TATATATAATGTATATAAACTGG + Exonic
1192526734 X:71852402-71852424 TATTTTTTATTTTTATAGACAGG - Intergenic
1193213135 X:78831245-78831267 TATTTATAATATCTAATCACTGG - Intergenic
1193217884 X:78885833-78885855 TATTCCTAATTTATATTCATGGG - Intergenic
1193424945 X:81330733-81330755 TATATATAATTTTTATTTATCGG + Intergenic
1193545423 X:82821485-82821507 TATTCATAAGTGATATTGATGGG + Intergenic
1193552238 X:82909437-82909459 TTTTTAAAATTTATATAGAAAGG + Intergenic
1193579775 X:83250685-83250707 AATTTATACTTTATAGTGATGGG + Intergenic
1194213829 X:91103336-91103358 TATTTAAAATTCTTATTCACTGG + Intergenic
1194421217 X:93674659-93674681 TATTTGTTATTTTTATTTACAGG + Exonic
1194738186 X:97539613-97539635 TATGTATAACTTCTTTTGACAGG + Intronic
1194757501 X:97754770-97754792 GTTTAATAATTTTTATTGACAGG + Intergenic
1194834363 X:98662783-98662805 TATTGCTAAGTTATAGTGACAGG + Intergenic
1194895708 X:99436663-99436685 TACTTTTATTTTGTATTGACTGG + Intergenic
1195486168 X:105409238-105409260 TATATAGAAGTTATTTTGACTGG - Intronic
1195487607 X:105426928-105426950 TATGAATAATTTATTTTGAAAGG + Intronic
1195955468 X:110324657-110324679 TTTTTTTAATTTATCATGACAGG + Intronic
1196537609 X:116866252-116866274 AATTTTTAATTTATTTTGAAGGG + Intergenic
1196577462 X:117336329-117336351 TATTTATCATTTATATGTGCTGG + Intergenic
1197388366 X:125828169-125828191 TATTTATAAATAATAATCACAGG - Intergenic
1197630206 X:128849557-128849579 TATCAATAATTTTTATTGAGGGG + Intergenic
1197803864 X:130380662-130380684 TATTTATATTTTGTAGAGACAGG - Intergenic
1198139199 X:133786075-133786097 TATATATTCTTTATTTTGACAGG - Intronic
1198508206 X:137322737-137322759 TATACATATTTTTTATTGACAGG - Intergenic
1198521895 X:137461354-137461376 TTTTTAAAATATATATAGACAGG - Intergenic
1198930489 X:141853508-141853530 TATTTTTACTTTATATGGAATGG + Intronic
1199056713 X:143305126-143305148 TATATATAATTTTTATTGCCGGG + Intergenic
1199105967 X:143868528-143868550 TATTTATTAGTTTCATTGACTGG - Intergenic
1199431754 X:147769249-147769271 TATATAAAATTTATATGGAGAGG - Intergenic
1199528100 X:148814993-148815015 TATTTATACATTAATTTGACAGG - Intronic
1200529219 Y:4314239-4314261 TGGTTATGATTAATATTGACAGG + Intergenic
1200790610 Y:7296026-7296048 TATTTATTTTTTATAGCGACAGG - Intergenic
1201979511 Y:19891923-19891945 TTGGAATAATTTATATTGACTGG + Intergenic