ID: 1146700080

View in Genome Browser
Species Human (GRCh38)
Location 17:34949932-34949954
Sequence GAATGTATGCTGCAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146700080 Original CRISPR GAATGTATGCTGCAGTTGGT AGG (reversed) Intronic
901413162 1:9099059-9099081 GAATGCATGCTGCATTTGCTGGG + Intergenic
906077504 1:43062950-43062972 GAAGGGAGGCTGCAGCTGGTGGG + Intergenic
906270895 1:44477928-44477950 GAATGTATTTTGCAGGTGGGAGG - Intronic
906548936 1:46645315-46645337 GAATGAATGTTACAGGTGGTTGG - Intronic
906604251 1:47154200-47154222 GTAGGTCTGCTGCAGTTTGTTGG - Intergenic
907015283 1:51006098-51006120 GCAGGTATGCTGCAGTTTGCTGG - Intergenic
907336984 1:53706226-53706248 GAATGTTGACTGCAGTTTGTAGG - Intronic
907530659 1:55092623-55092645 GAATGTATAATGTAGATGGTGGG - Intronic
908906898 1:69024475-69024497 ATATGTATTCTGCAGTTGTTGGG + Intergenic
909227853 1:73047942-73047964 AAATATATTCTGCAGTTGTTGGG - Intergenic
911767396 1:101694215-101694237 GAGTGTTTTCTGCAGTTGTTGGG + Intergenic
913307455 1:117446731-117446753 AAGTGTATTCTGCAGTTGTTGGG + Intronic
914457290 1:147847787-147847809 AAATGGATGCTGCAGATGGATGG + Intergenic
921350545 1:214230195-214230217 GAATGATTCCTGCAGTTGGGTGG + Intergenic
922863005 1:228835451-228835473 GACTGTAGGGTGGAGTTGGTAGG + Intergenic
923007280 1:230060641-230060663 GAATGGATGCTGAAGTGGTTAGG - Intronic
1063390567 10:5647707-5647729 GAATCTATGCTGCAGGTTGCTGG - Intronic
1067743905 10:48919000-48919022 GTTTGTATTCTGCAGTTGCTAGG - Intronic
1069288316 10:66744044-66744066 GAATGTAAACTGCAGGTGGCAGG + Intronic
1070832470 10:79427368-79427390 AAATGTATTCTGCTGTTGTTTGG - Intronic
1071221489 10:83471352-83471374 GAATGTATGTTGAACATGGTTGG - Intergenic
1072777850 10:98218636-98218658 GAATGTATCCTGCAGTTGTTGGG + Intronic
1073161968 10:101405904-101405926 GTGTGTATACTGCAGTTGTTGGG + Intronic
1076101287 10:127780976-127780998 GAAAATGTCCTGCAGTTGGTAGG + Intergenic
1076665366 10:132086321-132086343 GAATATATTCTGCAGTCGTTGGG + Intergenic
1076677919 10:132157277-132157299 GGAAGCATGCTGCAGCTGGTGGG - Intronic
1076977107 11:182055-182077 CAATGTATGTTGCAAGTGGTGGG + Intronic
1078743323 11:14089397-14089419 GCAGGTATGCTGCAGTTTGCTGG + Intronic
1079704135 11:23592195-23592217 GAATGTATGTTGCATGTGGGAGG + Intergenic
1079997206 11:27306777-27306799 GAATGTTTATTGGAGTTGGTAGG - Intergenic
1081417661 11:42835282-42835304 GAATGTATGCTCCATTGGGGTGG - Intergenic
1084697124 11:70762443-70762465 GTCTGTATTCTGGAGTTGGTGGG + Intronic
1087084670 11:94204393-94204415 GAATCTATGGAGCAGTTAGTAGG - Intergenic
1087580902 11:100051182-100051204 AAGTGTATTCTGCTGTTGGTTGG - Intronic
1088078206 11:105878178-105878200 GCAGGTCTGCTGCAGTTGGCTGG + Intronic
1089878866 11:121754004-121754026 GTATGTGTGCTGCCTTTGGTGGG + Intergenic
1090811794 11:130250655-130250677 GAAGGTCTGCTGCAGTTTGTTGG - Intronic
1092550187 12:9490050-9490072 GAATGAATGCTGCAATTAGTGGG + Intergenic
1094521621 12:31196323-31196345 GAATGAATGCTGCAATTAGTGGG - Intergenic
1096425590 12:51499532-51499554 GAATGTAAGCTCCATGTGGTCGG - Intronic
1097898695 12:64852752-64852774 GCATGTCTGCTGGAGTTTGTTGG + Intronic
1098180375 12:67840507-67840529 GAGTGTTGGCTGCAGTGGGTGGG + Intergenic
1099953595 12:89330752-89330774 ATATGTATTCTGCAGTTGTTGGG - Intergenic
1100136930 12:91564892-91564914 GCATGTATTCTTCAGTTGTTGGG - Intergenic
1100421530 12:94438715-94438737 GAATATATTCTGCAATTGTTGGG - Intronic
1100547928 12:95621040-95621062 AAATGTATGCTGTGGTTGATTGG + Intergenic
1100709145 12:97235340-97235362 GAAGGTATGCTGGTGCTGGTGGG + Intergenic
1100913999 12:99397421-99397443 GAATGTAAGCTGCAATAGGTTGG - Intronic
1103483637 12:121267788-121267810 GAAAATATTCTGCAGTTGGCCGG - Intronic
1103865934 12:124052145-124052167 GAATACATGCTGCAGATGGAAGG + Intronic
1106462667 13:29986592-29986614 GAATGTATTTTGCAGGTGTTGGG + Intergenic
1107383760 13:39885672-39885694 CAATGTATTCTGCTGTTGTTAGG - Intergenic
1107659995 13:42628913-42628935 GCATGTATGCTGGACTTGGCTGG + Intergenic
1107832575 13:44387345-44387367 GAAAGTGGGCTGCAGTTGATTGG + Intronic
1108182956 13:47859319-47859341 GAAAGTATGCTGCCTCTGGTGGG - Intergenic
1108319922 13:49279563-49279585 GAGTTTATGCTCCATTTGGTAGG + Intronic
1108774023 13:53741355-53741377 GAATATATAATGCAGTTGGAAGG - Intergenic
1109386890 13:61641922-61641944 AAATGTATTCTGCAGTTGCATGG + Intergenic
1110153875 13:72289925-72289947 TAATGTATGATGCAGTTTCTGGG + Intergenic
1115204976 14:30892928-30892950 GAATGCTTGCTGCTGTTGCTGGG - Intronic
1119957066 14:78809910-78809932 GAATATAACCTGCATTTGGTGGG + Intronic
1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1127250783 15:57235469-57235491 GGATGTATGCAGCAGTGGTTAGG - Intronic
1129334570 15:74844340-74844362 GAATGTACAATGCCGTTGGTTGG - Exonic
1132223859 15:100125695-100125717 TAATTTATGTTGCTGTTGGTGGG - Intronic
1136593074 16:31229365-31229387 TAATGTATGCTGCCTTTTGTTGG + Intergenic
1137665786 16:50248188-50248210 GAATGTGTGCTGCCCGTGGTCGG - Intronic
1137764358 16:50966697-50966719 CAATGGATGCTGGAGTTGGCAGG - Intergenic
1138287778 16:55823084-55823106 GAATGGGGGCTGCAGATGGTGGG - Intronic
1140418047 16:74791352-74791374 GTACGTATGCTGATGTTGGTTGG - Intergenic
1140634886 16:76900712-76900734 GAATGTATCCTCCAGGTGGCTGG - Intergenic
1140919189 16:79521045-79521067 GAATGTATGATACAGTGGTTAGG - Intergenic
1142443148 16:90114625-90114647 CAATGTATGTTGCAAGTGGTGGG - Intergenic
1142464245 17:120229-120251 CAATGTATGTTGCAAGTGGTGGG + Intergenic
1142654293 17:1380887-1380909 GATTGTGTGCTGCAGTTGTCGGG - Intronic
1146700080 17:34949932-34949954 GAATGTATGCTGCAGTTGGTAGG - Intronic
1148557369 17:48586474-48586496 TAATGTATGCTGCAGCGGCTCGG + Intronic
1149949516 17:60970902-60970924 ATATGTATTCTGCAGTTGTTGGG - Intronic
1150518375 17:65838175-65838197 AAATGTCTGCAGCAGTTGGGTGG - Intronic
1150604813 17:66681762-66681784 GAATGGGTGCTGCAGGTGGTGGG - Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1153474531 18:5483992-5484014 GAATGTATTCTGCAGCAGTTGGG - Intronic
1153846423 18:9053537-9053559 GAATGGGTGCTGCTGATGGTTGG + Intergenic
1154044094 18:10888041-10888063 TAATGTCTGCTAAAGTTGGTGGG - Intronic
1155259411 18:24026781-24026803 GAATGGCTGCTGCAGATGGAAGG - Intronic
1156144568 18:34159678-34159700 GAGAGTGTGCTGCCGTTGGTCGG - Intronic
1156166647 18:34429252-34429274 GAAGGTCTGCTGGAGTTTGTTGG + Intergenic
1156256321 18:35400351-35400373 AAATGTATTCAGCAGTTGTTGGG - Intergenic
1157760639 18:50261686-50261708 TAAAATATGGTGCAGTTGGTTGG - Intronic
1158910248 18:62053781-62053803 GCATGTATTCTGCTGTTGTTGGG - Intronic
1158928620 18:62297823-62297845 GAATAAATGCTGCAGATGCTAGG - Intronic
1159858180 18:73614489-73614511 GAATGGATGCTGAAGTTGAAGGG + Intergenic
1160546553 18:79660733-79660755 GAGTGTAAGCTGCAGTTCGGTGG + Intergenic
1164554290 19:29238785-29238807 GAATGTGTTCTGCAGTTGTTTGG - Intergenic
1166654819 19:44603181-44603203 GAATGTGTGCCCCAGATGGTTGG - Intergenic
1167628237 19:50606452-50606474 GGATGCCTGCTGCAGTTCGTTGG + Intergenic
1167773142 19:51534764-51534786 ATATGTATTCTGCAGTTGTTGGG + Intergenic
926188184 2:10707985-10708007 GAATGTAGGCTTCAGGAGGTCGG + Intergenic
927445555 2:23157978-23158000 GAATGTATTCTACAGTTTCTGGG - Intergenic
933113736 2:78438934-78438956 GCTTGTTTGCTGCATTTGGTAGG - Intergenic
934064393 2:88327109-88327131 GAATGTGTTCTGCAGTTGATAGG - Intergenic
936483176 2:112904730-112904752 GCATGTTTTCTGCAGTTGTTAGG - Intergenic
939377742 2:141391710-141391732 GAAAGGCTGCTGCAGTTGTTGGG + Intronic
940703763 2:157078255-157078277 GCCTGTCTGCTGCAGCTGGTAGG + Intergenic
942291348 2:174474640-174474662 GTATGTGTGCTGTATTTGGTGGG + Intronic
942788120 2:179724962-179724984 AAATCTATGTTGCTGTTGGTAGG + Intronic
942947478 2:181685349-181685371 CAATGGTTGCTGCAGTGGGTTGG + Intergenic
944765675 2:202862008-202862030 TAATGTATTCTGCTCTTGGTGGG - Intronic
948651888 2:239451126-239451148 GTGTGTATTCTGCAGTTGATGGG + Intergenic
1168772020 20:421460-421482 GAATGTAAGCTGCAGGAGGCAGG - Intronic
1171023338 20:21607107-21607129 AAATGAATGGTGCAGTGGGTTGG + Intergenic
1173611696 20:44372913-44372935 GAATTTGTGCTGCAGTCGGGAGG + Intronic
1175232889 20:57485531-57485553 GTATGTATTCTGCAGTTGTTGGG + Intergenic
1179055733 21:37931901-37931923 GAATGTGTTCTGCTGTTGTTTGG - Intergenic
949839643 3:8306015-8306037 AAATGTTTGCTGCATTGGGTGGG - Intergenic
950462093 3:13130526-13130548 GAATGTATGTTGCTCTTGTTAGG + Intergenic
950485565 3:13271966-13271988 GAATGTTTTCTGCTGTTGGGTGG - Intergenic
951458732 3:22925106-22925128 GAATGTATTCTGCATTTTGTAGG - Intergenic
954108371 3:48421081-48421103 GAATGGAGGCTTCAGGTGGTTGG + Intronic
954809904 3:53241340-53241362 AAATGGATGCTGCAGTTGGCCGG - Intronic
955047949 3:55377412-55377434 GAAAGTATTCTGCAGTGGATGGG - Intergenic
955053205 3:55432063-55432085 GCATCTATGCTGAAGTTTGTGGG - Intergenic
955611370 3:60760816-60760838 GAATGTACGTGGCAGTTGCTAGG + Intronic
956820301 3:72948292-72948314 AAGTTTATGCTGCAGTTGCTGGG - Intronic
960020837 3:112950602-112950624 GAATGTATTCTGCAGATGCTGGG - Intronic
960761811 3:121079785-121079807 GAATGTATTATGCAGTTGTTGGG + Intronic
961493908 3:127276658-127276680 GAATGCAGGCTGAAGATGGTTGG - Intergenic
962090650 3:132240956-132240978 GAATATATGTTGCATTTGGGAGG + Intronic
963416165 3:144998681-144998703 GAATGGCTGCTGCAGTTTGCTGG + Intergenic
964519579 3:157549618-157549640 GAATGTGTTCTGCAGTTGACGGG + Intronic
965184782 3:165448810-165448832 ATGTGTATGCTGCAGTTGTTGGG - Intergenic
965790602 3:172383424-172383446 GAATGTAGGCTTCAGTAGTTAGG - Intronic
967359674 3:188615154-188615176 CAATGTATTCTGCAACTGGTTGG - Intronic
967551869 3:190805418-190805440 GAATGTATGCTGTACTTGCTAGG + Intergenic
968363269 3:198164354-198164376 GAATGTATACGGCAGATGGTAGG - Intergenic
968363280 3:198164458-198164480 GAATGTATACGGCAGATGGTAGG - Intergenic
968363291 3:198164562-198164584 GAATGTATACGGCAGATGGTAGG - Intergenic
968363302 3:198164666-198164688 GAATGTATACGGCAGATGGTAGG - Intergenic
968363464 3:198166003-198166025 CAATGTATGTTGCAAGTGGTGGG - Intergenic
970136786 4:12933945-12933967 GAATTTCTGCTGCAGTTTATAGG + Intergenic
970246767 4:14072316-14072338 GGCTGGTTGCTGCAGTTGGTGGG - Intergenic
970648156 4:18146867-18146889 GAATGTAGGCAGAAGTAGGTAGG - Intergenic
973733428 4:53845708-53845730 GAATGTCAGCTGCTGTTGTTAGG + Intronic
974140102 4:57875326-57875348 GAATGACTGGTGCAGGTGGTAGG - Intergenic
977310560 4:95381911-95381933 GTGTGTATGGGGCAGTTGGTGGG + Intronic
978784387 4:112593301-112593323 GAAAGTATAGTGGAGTTGGTGGG - Intronic
979159798 4:117445779-117445801 ATATGTATCCTGCAGTTGTTGGG + Intergenic
980400365 4:132276521-132276543 TCATGTCTGCTGCAGTTTGTTGG - Intergenic
980409844 4:132403137-132403159 GAAGTTATTCTGCAGTTGTTGGG - Intergenic
981024797 4:140066784-140066806 GAAAGGAAGCAGCAGTTGGTGGG - Intronic
982588394 4:157272406-157272428 GAGTTTCTGCTCCAGTTGGTTGG - Intronic
982602041 4:157464045-157464067 GTATGTATTCTGCTGTTGTTGGG - Intergenic
983845374 4:172511900-172511922 GTATATATTCTGCAGTTGCTGGG + Intronic
988147182 5:27325118-27325140 GTATACATGCTGCAGTTGCTGGG - Intergenic
989072945 5:37531253-37531275 GAATATATTCTGCAGTTGTTGGG + Intronic
989755208 5:44944026-44944048 GAATGTGTGCTTTAATTGGTTGG - Intergenic
992902310 5:81309849-81309871 GAATGTATCTTACCGTTGGTGGG + Intronic
995470560 5:112497389-112497411 GACTCTATTCTGCAGTTGGGTGG - Intergenic
995522117 5:113018635-113018657 GAAGGTTTCCTGCAGGTGGTTGG + Exonic
996190246 5:120531522-120531544 GAATGCATGCATCAGTTGATTGG - Intronic
998700202 5:144689570-144689592 GAATGTATGCCCGAGGTGGTTGG - Intergenic
999822810 5:155245593-155245615 CAATGTATTCTGCAGTCGTTGGG + Intergenic
1000077470 5:157805148-157805170 TAATGTATGCAGCAGATTGTAGG - Intronic
1002288953 5:178186716-178186738 GCTTGTATGCTGCAGCTGGATGG - Intergenic
1004776730 6:18855245-18855267 ATATGTATTCTGCAGTTGTTGGG + Intergenic
1006734684 6:36264723-36264745 GAATGTTTGCTGCACTAGTTTGG + Intronic
1007507511 6:42347396-42347418 GAATTTATGGTTCAGTTGATGGG + Intronic
1008176111 6:48270295-48270317 GCAGGTATGCTGCAGTTTGCTGG + Intergenic
1009654090 6:66517097-66517119 GAATGTGTGCTGGATTTTGTAGG - Intergenic
1009993027 6:70866844-70866866 GATTGTATTCTGCTGTTGTTGGG - Intronic
1010962870 6:82166519-82166541 CAATGGATACTGCAGTTAGTTGG + Intergenic
1011158105 6:84356177-84356199 GAATGTAAGCTCCAGCTGGGCGG + Intergenic
1014749728 6:125242253-125242275 GAGTGTATACTGCAATTGTTTGG + Intronic
1014926405 6:127276350-127276372 GAATTTATGGTGTGGTTGGTTGG + Intronic
1015686093 6:135863114-135863136 AAATGTATTCTGCAATTGTTAGG + Intronic
1017759804 6:157559380-157559402 GAATTTTTGCTGCACTTGCTGGG - Intronic
1017759890 6:157560175-157560197 GAATTTTTGCTGCACTTGCTGGG + Intronic
1019252236 7:22670-22692 CAATGTATGTTGCAAGTGGTGGG + Intergenic
1021973451 7:25987294-25987316 GGATGTTTGATACAGTTGGTAGG - Intergenic
1024064027 7:45718250-45718272 GGTGGTATGCTGCAGTTTGTTGG + Exonic
1025280173 7:57621198-57621220 AAATGTAGGCTGCTGATGGTGGG + Intergenic
1025304560 7:57844303-57844325 AAATGTAGGCTGCTGATGGTGGG - Intergenic
1027816491 7:82979006-82979028 GAATTTAGGCTGAAGTTGGCAGG + Intronic
1033115184 7:138618973-138618995 GAGGCTATGCTGCTGTTGGTGGG - Intronic
1034086665 7:148328422-148328444 GAATGTCTGCTGCAGATTGTGGG + Intronic
1036826128 8:11977467-11977489 GAGTGTAGGCTGTAGTAGGTGGG + Intergenic
1038805622 8:30788678-30788700 GAAAGTATTCTGCTGTTGTTGGG + Intronic
1042979160 8:74506236-74506258 GAATGTATGGCCCAGGTGGTTGG - Intergenic
1047477097 8:125243132-125243154 AAATGTATGATGCAGTTGAGGGG + Intronic
1047501043 8:125441733-125441755 GAAAGTATGCAGCACTTGGTTGG - Intergenic
1047575687 8:126152048-126152070 GAATGTATTCTGTGGTTGCTGGG - Intergenic
1048003197 8:130396686-130396708 GAATGCATGCTGCACATGGACGG - Intronic
1048416967 8:134237097-134237119 TAATGTATTCTGCTGTTGTTGGG - Intergenic
1050080095 9:1906981-1907003 AAATGGATGCTGTGGTTGGTTGG - Intergenic
1050776845 9:9274325-9274347 GAATGCATGCTGTACTTGTTTGG - Intronic
1051143946 9:14007313-14007335 AAAAGGATGCTGCAGTGGGTAGG + Intergenic
1051298019 9:15617784-15617806 GCAGGTCTGCTGCAGTTTGTAGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052326587 9:27221639-27221661 GAAGGTCTGCTGGAGTTGGCTGG - Intronic
1055535136 9:77233849-77233871 GAATGTATTTTGCTGTTGTTGGG + Intronic
1057011358 9:91604779-91604801 CAATATAAGATGCAGTTGGTTGG + Intronic
1059176051 9:112171036-112171058 GAATGATTGCTGCAGATTGTGGG - Intronic
1062748106 9:138229245-138229267 CAATGTATGTTGCAAGTGGTGGG - Intergenic
1188233874 X:27701405-27701427 GAATGTATTCTGCTTTTGTTGGG - Intronic
1188297584 X:28468869-28468891 GAATGTATGTTGCATGTGGGAGG - Intergenic
1188713895 X:33437007-33437029 GAATGTATCCTGCTGCTGTTTGG - Intergenic
1189218963 X:39354411-39354433 GTATATATTCTGCAGTTGTTGGG + Intergenic
1190937652 X:55010826-55010848 GAATGTAAGCTCCAGAGGGTAGG + Intronic
1191809686 X:65174005-65174027 GCATGTCTGCTGCAGTTTGCTGG + Intergenic
1192030808 X:67510081-67510103 GCAGGTATGCTGCAGTTTGCTGG - Intergenic
1192980394 X:76333325-76333347 AAGTGTATTCTGCAGTTGCTGGG - Intergenic
1193228333 X:79012659-79012681 GCAGGTTTGCTGCAGTTTGTTGG + Intergenic
1195028404 X:100901651-100901673 GAATGTATTCTGCTGCTGTTGGG - Intergenic
1195730166 X:107959151-107959173 GCAGGTCTGCTGCAGTTTGTGGG + Intergenic
1196870294 X:120107162-120107184 GAATGTGTGCCCCAGGTGGTTGG + Intergenic
1200256447 X:154585422-154585444 GAATGGATGCTGCAGATGCGGGG + Exonic
1200261322 X:154618981-154619003 GAATGGATGCTGCAGATGCGGGG - Exonic