ID: 1146703409

View in Genome Browser
Species Human (GRCh38)
Location 17:34981134-34981156
Sequence TCACAACTGCCGCAGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146703409_1146703415 -8 Left 1146703409 17:34981134-34981156 CCCCTGGGCTGCGGCAGTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1146703415 17:34981149-34981171 AGTTGTGAGGGTGCGGAACGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1146703409_1146703417 1 Left 1146703409 17:34981134-34981156 CCCCTGGGCTGCGGCAGTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1146703417 17:34981158-34981180 GGTGCGGAACGAGGGACAGACGG 0: 1
1: 0
2: 1
3: 12
4: 201
1146703409_1146703416 -7 Left 1146703409 17:34981134-34981156 CCCCTGGGCTGCGGCAGTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1146703416 17:34981150-34981172 GTTGTGAGGGTGCGGAACGAGGG 0: 1
1: 0
2: 0
3: 13
4: 83
1146703409_1146703418 2 Left 1146703409 17:34981134-34981156 CCCCTGGGCTGCGGCAGTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1146703418 17:34981159-34981181 GTGCGGAACGAGGGACAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146703409 Original CRISPR TCACAACTGCCGCAGCCCAG GGG (reversed) Intronic
901253261 1:7797846-7797868 TTACCACTGCAGCTGCCCAGCGG - Intronic
901513723 1:9731364-9731386 TCACAACTGTCGCAGTGCTGGGG + Exonic
901752107 1:11416657-11416679 ACTCATCTGCAGCAGCCCAGGGG + Intergenic
902808926 1:18877380-18877402 TCACCCCCGCCGCGGCCCAGCGG - Intronic
903306500 1:22416827-22416849 TCACAAGGGCTGCAGCCCCGAGG + Intergenic
903456432 1:23490414-23490436 TCCCAACTGCTTCACCCCAGAGG - Intergenic
906726470 1:48048205-48048227 TCAGAACTGTCGGAGCACAGTGG + Intergenic
907562135 1:55400783-55400805 GCACATCTGCCCCAGCCCACAGG + Intergenic
911380133 1:97104489-97104511 TCACTTCTGCCACAGCCCACAGG - Intronic
915186038 1:154105902-154105924 CCACAACTGCCCCAGACCCGTGG - Intronic
917671010 1:177273509-177273531 TCATAGTTGCTGCAGCCCAGAGG - Exonic
917971377 1:180210261-180210283 TCACGGCTGCCACAGCACAGAGG + Intergenic
919726130 1:200885555-200885577 TCACCACTGCCCGAGCCCACAGG + Intergenic
919847997 1:201653754-201653776 TCACTACTGCTGCTGCCCAGAGG - Intronic
921718144 1:218439698-218439720 CTACTGCTGCCGCAGCCCAGAGG - Intronic
922802607 1:228371227-228371249 TCACCACTGCTGCACCCCCGGGG + Exonic
923135874 1:231118259-231118281 TCAAAACAGACGCAGCCCAAGGG + Intergenic
1062813288 10:481347-481369 TCACAACTGTCAAAGCCCAGTGG + Intronic
1065229332 10:23581054-23581076 TCACTAATGCCTCAGCCCACAGG - Intergenic
1065356445 10:24846486-24846508 TCACGACTGCATCAGCCCTGAGG - Intergenic
1065819084 10:29508766-29508788 TCACAGCTGCAGAAGCACAGTGG + Intronic
1065953736 10:30675170-30675192 TCACAGCTGCTGAAGCACAGTGG - Intergenic
1068831591 10:61501828-61501850 TCACAACTGCAGGAGTCCTGTGG - Intergenic
1069567580 10:69474078-69474100 TCAGAACTGCCGGCTCCCAGGGG - Intronic
1069928090 10:71865244-71865266 TCACAACAGCCTAGGCCCAGGGG - Intergenic
1070470560 10:76775146-76775168 TCGCAACACCCGAAGCCCAGAGG + Intergenic
1071295205 10:84214446-84214468 CCAGCACTGGCGCAGCCCAGTGG + Exonic
1071869820 10:89781468-89781490 TGACATCTGGCGCAGCCAAGGGG - Intergenic
1075728531 10:124622982-124623004 ACAGAACTACTGCAGCCCAGAGG - Exonic
1075730847 10:124635752-124635774 TCACAGCTGAAGCAGCCCGGAGG + Intronic
1077288981 11:1780160-1780182 GCACAAATGCCCCAGGCCAGGGG + Intergenic
1077922975 11:6655484-6655506 CCGCCGCTGCCGCAGCCCAGGGG + Intronic
1079121203 11:17686361-17686383 CCACTACAGCCGCAGCCCTGGGG + Intergenic
1083686955 11:64382324-64382346 TCCCTCCTGCTGCAGCCCAGTGG + Intergenic
1083757888 11:64801301-64801323 TCACAGCTGCCGCAGGCCCTAGG + Intronic
1089331047 11:117689094-117689116 TCACAACAGCTGCAGGACAGAGG + Intronic
1089641044 11:119847420-119847442 GCCCAGCTGCTGCAGCCCAGTGG + Intergenic
1091635955 12:2196881-2196903 TCAGAACTGCCCCAGACCAAGGG + Intronic
1092198371 12:6563831-6563853 TCACAGCTTCCCCACCCCAGTGG + Intronic
1092652585 12:10650536-10650558 TTACTACTGCCCCACCCCAGTGG + Intronic
1100329856 12:93572258-93572280 TCACACCTGGCGCAGCCCGAGGG - Intronic
1101718081 12:107328764-107328786 GCTGAACTGCCGCAGCCCAGTGG + Intronic
1102426451 12:112847942-112847964 TCACAAATGGCAAAGCCCAGAGG - Intronic
1105657134 13:22453814-22453836 CAGCAACTGCCACAGCCCAGAGG + Intergenic
1107666503 13:42696226-42696248 ACACAACTGACCCAGCCCACTGG + Intergenic
1108240492 13:48458162-48458184 TCACACCTGCTGCAGCAGAGAGG - Intronic
1114667560 14:24388815-24388837 TCACAGCTGCAGCAGCCTTGAGG - Intergenic
1119872588 14:78029967-78029989 TCACAGCAGCCGCAGCCAAGGGG - Intergenic
1121250739 14:92497687-92497709 TCTCAACTGCTGAATCCCAGGGG - Exonic
1132286327 15:100665734-100665756 TCACTCCAGCCTCAGCCCAGAGG + Intergenic
1133812244 16:9169806-9169828 GAACAACTGCACCAGCCCAGGGG - Intergenic
1140294465 16:73694961-73694983 TCTCAACTGCCTCAGCTTAGTGG - Intergenic
1145399276 17:22517774-22517796 GCACACCAGGCGCAGCCCAGCGG + Intergenic
1146569613 17:33941311-33941333 TCAGATCTGCCCCATCCCAGTGG + Intronic
1146703409 17:34981134-34981156 TCACAACTGCCGCAGCCCAGGGG - Intronic
1148110760 17:45143787-45143809 CCACAACTGCAGCCTCCCAGGGG - Exonic
1149085289 17:52709626-52709648 TCACGATGGCCACAGCCCAGAGG + Intergenic
1151871266 17:76838465-76838487 CTACAACAGCCGGAGCCCAGAGG - Intergenic
1152982515 18:292127-292149 TCACAACAGACTCAGACCAGGGG - Intergenic
1154032819 18:10767961-10767983 TCACAACATCCCCATCCCAGGGG + Intronic
1155997100 18:32341797-32341819 TTACAACTGTCTTAGCCCAGAGG - Intronic
1158422080 18:57304082-57304104 TCACAACTGAAACAGCTCAGGGG + Intergenic
1161474097 19:4474786-4474808 TGACAGCTGCCGGAGCCCATGGG + Intronic
1162726310 19:12691477-12691499 ACACACCTGCCACAGCCCATGGG + Intronic
1162781893 19:13010926-13010948 CCAGAACTGCCGCTGCCCAGTGG + Intronic
1162887448 19:13706278-13706300 TCTTAACTGCCTCATCCCAGTGG - Intergenic
1163713240 19:18859492-18859514 TCAGAAGTCCCTCAGCCCAGGGG - Intronic
1163892753 19:20031359-20031381 ACACAACTGCAGCAGGTCAGAGG + Intronic
1164633304 19:29775581-29775603 TCACTCCTGCCACAGACCAGGGG + Intergenic
1164748323 19:30632016-30632038 TCACAGCTGCCAGAGCCCATAGG + Intronic
1167250067 19:48394800-48394822 CCACCACTGCCGCCGCCCCGGGG + Intergenic
925155157 2:1643415-1643437 TCACAGCTGCCGTAGCCGTGAGG + Exonic
927217404 2:20675846-20675868 CCACACCTACCTCAGCCCAGGGG - Intergenic
933164452 2:79060611-79060633 TCACAACTGAGGCAGAGCAGGGG + Intergenic
938082518 2:128377766-128377788 TCACAGCTGGCACACCCCAGTGG - Intergenic
938168503 2:129054596-129054618 CCAAAGCTGCCGCTGCCCAGAGG + Intergenic
938476940 2:131624642-131624664 TCACAATGGCCTCAGTCCAGAGG + Intergenic
940809775 2:158229347-158229369 TCACAATTGTTGCAGCCTAGTGG - Intronic
943259163 2:185635926-185635948 ACACAACTGCCACAGGCCACAGG - Intergenic
944132526 2:196362195-196362217 CCACGACTGCCTCAGCCGAGGGG - Intronic
945884595 2:215362046-215362068 TGACAACTGCCGCAGACCTGGGG - Exonic
948839683 2:240642796-240642818 TCCCACCTGCCGCCCCCCAGGGG + Intergenic
1172630550 20:36375517-36375539 TCAGAGCTGCCCCTGCCCAGGGG + Intronic
1172886168 20:38232248-38232270 TCACAAGTGCCGCCTCACAGGGG + Intronic
1174237241 20:49103930-49103952 TCAGAACTTCTGCAGCCCAGGGG - Intergenic
1175293889 20:57895740-57895762 TGACACCTGCCCCAGCCCTGGGG + Intergenic
1175968898 20:62674033-62674055 TCCCTCCTGCCCCAGCCCAGTGG - Intronic
1176654283 21:9575811-9575833 TCCCATTTGCCCCAGCCCAGTGG - Intergenic
1177283357 21:19014285-19014307 TCACAACTGCCACTGGCAAGGGG - Intergenic
1179600958 21:42476925-42476947 CCACAACTCCCACAGCCCAAAGG + Intronic
1181382294 22:22515877-22515899 TCACAACTGCAGAAGACCAGGGG - Intronic
1183497253 22:38153965-38153987 CCACCACTGCCCCAGCCCTGTGG - Intronic
1184643862 22:45885774-45885796 TCACCACTCCCACCGCCCAGGGG + Intergenic
1185075894 22:48682098-48682120 TCACAACTTCTGCACCCCTGTGG + Intronic
950423274 3:12910999-12911021 TCACACCTGCAGCACCCCACTGG - Intronic
950443349 3:13022516-13022538 GCTCAGCTGCCGGAGCCCAGGGG + Intronic
956941684 3:74169235-74169257 TCACAAAAGCCCCAGCCCAGAGG + Intergenic
961003681 3:123390654-123390676 TCACATCTGCCACGCCCCAGGGG - Intronic
968905335 4:3448183-3448205 CCACAAGTGCAGCAGCCCTGAGG + Exonic
979508823 4:121528351-121528373 ACCCAACTGCAGAAGCCCAGTGG - Intergenic
985607055 5:863427-863449 TCACAAATGCCGCTGCCCCCAGG + Intronic
985914936 5:2910524-2910546 TGACAACTGCCGGGGCCCTGGGG - Intergenic
986407169 5:7437542-7437564 TCATAACAGCAGCAGCTCAGAGG + Intronic
996118360 5:119643999-119644021 TCAGAACTCCCCCAGGCCAGAGG - Intergenic
997732763 5:136192901-136192923 TCCCCGCCGCCGCAGCCCAGAGG - Intergenic
1007636876 6:43304973-43304995 TCACCACTGCCCCAACCCAAGGG - Exonic
1010707122 6:79128047-79128069 TCTCAACTCCCCCAGCACAGTGG + Intergenic
1016384439 6:143516724-143516746 TTCCAACTGGTGCAGCCCAGGGG - Intergenic
1017577162 6:155818009-155818031 TCACAAAGGCCTCAGCGCAGAGG - Intergenic
1022958726 7:35404674-35404696 TGAGAACAGCCGCAGCCCACAGG + Intergenic
1029413831 7:100430916-100430938 TCACAGCAGCCGCGGCACAGGGG + Exonic
1032156630 7:129474800-129474822 TCAAGACTACCTCAGCCCAGCGG - Intronic
1032859422 7:135863149-135863171 TCACAACAACCCCAGCCCTGAGG + Intergenic
1035299166 7:157885965-157885987 TCAGAACGGCAGCAGCACAGTGG - Intronic
1035786594 8:2266159-2266181 CCACCACTTCCACAGCCCAGCGG - Intergenic
1035806213 8:2455557-2455579 CCACCACTTCCACAGCCCAGCGG + Intergenic
1040561312 8:48525472-48525494 TCCCAACTGCATCTGCCCAGGGG - Intergenic
1040745228 8:50634067-50634089 GGACAGCTGCGGCAGCCCAGTGG - Intronic
1041346156 8:56900342-56900364 TCATCACTGCTGCAGCTCAGCGG - Intergenic
1042526565 8:69770679-69770701 TCACAGCTGCCTCAGCCGAGAGG + Intronic
1042804958 8:72761069-72761091 TATCAACAGCAGCAGCCCAGAGG + Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1043802394 8:84626270-84626292 GCACAAATGCCGCCGCCTAGTGG - Intronic
1045447856 8:102286048-102286070 TCACAACTGTGGGAGCCAAGGGG + Intronic
1058148674 9:101440424-101440446 TCATATCTGCTGCACCCCAGTGG - Intergenic
1058356987 9:104094459-104094481 TCACCGCTGCCTCAGGCCAGGGG - Exonic
1194968535 X:100317452-100317474 TCATGACTGCAGCAGCCCACAGG + Intronic
1194976583 X:100402654-100402676 TCAGAGCGGCGGCAGCCCAGGGG + Exonic
1195259031 X:103115072-103115094 TCACACCTCCAGTAGCCCAGAGG - Intergenic
1198972784 X:142300221-142300243 TCACAACAGCCCAAGGCCAGAGG + Intergenic
1201768507 Y:17595409-17595431 TCACATCTGGCCCTGCCCAGAGG - Intergenic
1201833047 Y:18310576-18310598 TCACATCTGGCCCTGCCCAGAGG + Intergenic