ID: 1146703725

View in Genome Browser
Species Human (GRCh38)
Location 17:34984252-34984274
Sequence GAAATATTTCAGATTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 21, 3: 64, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146703725_1146703728 10 Left 1146703725 17:34984252-34984274 CCTCCTTTAATCTGAAATATTTC 0: 1
1: 1
2: 21
3: 64
4: 448
Right 1146703728 17:34984285-34984307 CTTTTATGACATTGATATTTTGG 0: 1
1: 2
2: 7
3: 66
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146703725 Original CRISPR GAAATATTTCAGATTAAAGG AGG (reversed) Intronic
901544642 1:9946699-9946721 GAAATAATTAAGGTTAAATGAGG + Intronic
903051002 1:20601044-20601066 GAACTATTTTAGACAAAAGGAGG + Intronic
904772770 1:32889805-32889827 GAGCTATTCCAGATTAAAGGGGG - Intronic
905505233 1:38474178-38474200 GTCATATTTCAGCTTAAAGGTGG - Intergenic
905534929 1:38713746-38713768 GAAATATTTGAGAATAAACTAGG + Intergenic
905969177 1:42128156-42128178 GCAATATTTAATATTATAGGAGG + Intergenic
906207102 1:43992608-43992630 GAGATATTCCAGATGAGAGGTGG + Exonic
906798427 1:48715608-48715630 GAAATACTTCAGAGTAAATTTGG + Intronic
906864644 1:49404190-49404212 GAAATAATTAAGATTAAATGAGG + Intronic
906990601 1:50733517-50733539 GATACAATTCAGGTTAAAGGAGG + Intronic
907002927 1:50880446-50880468 GAAATAATTAAGGTTAAATGAGG + Intronic
908414152 1:63896438-63896460 GAAATCTTTCAGAGTAAAGGAGG - Intronic
910012258 1:82479986-82480008 GAATTATTTCAGGAAAAAGGTGG - Intergenic
910674934 1:89807228-89807250 GACATATTTAAGGTTAAATGAGG + Intronic
911068583 1:93813890-93813912 GAACTGTTCCAGGTTAAAGGAGG - Intronic
911132397 1:94402716-94402738 GAAATGTTCCAGATTAAAGGAGG - Intergenic
911549105 1:99258154-99258176 GCAATAATCCAGATTCAAGGTGG - Intergenic
911979294 1:104545874-104545896 GAAATAATTCAAGTTAAATGGGG + Intergenic
912130982 1:106600012-106600034 GGAATACTTCAGTTTAAAGATGG + Intergenic
912296064 1:108472104-108472126 GAAATGTGTCAGGTTAAAAGGGG - Intergenic
913011476 1:114687958-114687980 GAATTATTTCAGACCAAAGTGGG - Intronic
913097427 1:115532370-115532392 GCCTTATTTCAGAGTAAAGGGGG + Intergenic
913364676 1:118024142-118024164 AAAATACTTCAGATTAAACAGGG - Intronic
915834928 1:159169181-159169203 CAAGTATTTCAGAATTAAGGGGG + Intergenic
915864475 1:159484191-159484213 GAAATGTTACAGTTTCAAGGTGG - Intergenic
916184320 1:162116072-162116094 GAAATATTCCTAAGTAAAGGAGG - Intronic
916454714 1:164958948-164958970 TAACATTTTCAGATTAAAGGGGG + Intergenic
916474015 1:165151132-165151154 GAAATGTTTCAGGTGAAAGGAGG - Intergenic
916935458 1:169623660-169623682 AAAGTATGTCAGATTAAAGCAGG - Intronic
917136541 1:171793430-171793452 AAAATGTTTCAGATTACTGGAGG + Intronic
917323713 1:173810546-173810568 GACATGATTCAGATTAAAGGAGG + Intronic
918136281 1:181676888-181676910 GAAATATAACAGAGAAAAGGAGG - Intronic
918807873 1:189072877-189072899 GAAATATTTTAAAGAAAAGGAGG + Intergenic
919145168 1:193625172-193625194 GAAATTTTTCAGAGCAAAGTAGG + Intergenic
920161600 1:204002732-204002754 GAAATAATCAAGATTAAATGAGG + Intergenic
920453393 1:206078179-206078201 GAAATATTTCAGATTTGGTGGGG - Intronic
921061640 1:211590219-211590241 GAAATGTTCCAGATTAAAGGAGG - Intergenic
921194039 1:212735648-212735670 GAAATAATTAAGGTTAAATGAGG + Intronic
921260436 1:213381406-213381428 GAACTAGATCAGATTAATGGGGG - Intergenic
921293438 1:213680080-213680102 GAAAAATTTCACGTTAAAGAAGG + Intergenic
921794303 1:219325149-219325171 GAAAGATTTTAGATTAAATCTGG - Intergenic
921819964 1:219606032-219606054 CAAATGTTTCAGATTGAAGTGGG - Intergenic
923169248 1:231398140-231398162 GAAATATTTTAGATGACAGTAGG + Intronic
923335266 1:232964142-232964164 GAAATGTTCCAAATTAACGGAGG - Intronic
924371544 1:243356136-243356158 GACATGTTTCATTTTAAAGGCGG + Intronic
1063046907 10:2400688-2400710 GAGATATTTCAGGCCAAAGGTGG - Intergenic
1063575511 10:7258537-7258559 GAAATTATGCAGATTAATGGAGG - Intronic
1064240854 10:13626980-13627002 GGAATAATTCAGATGAGAGGTGG - Intronic
1064881621 10:20061263-20061285 GAATTCTTACAGATTGAAGGAGG - Intronic
1065147924 10:22790711-22790733 AAAAAGTTCCAGATTAAAGGAGG - Intergenic
1065904051 10:30232849-30232871 GAAATGGTACAGATTCAAGGTGG - Intergenic
1066441648 10:35445185-35445207 GAAATAGTTGGAATTAAAGGAGG + Intronic
1068288129 10:54965706-54965728 GAAATGTTTCAAATTAAATGTGG - Intronic
1068484327 10:57637260-57637282 GAAAAATAGCAGATTAAAGATGG - Intergenic
1069690097 10:70345798-70345820 AAAATATTGCAAATTAAAGCAGG - Intronic
1069971155 10:72170643-72170665 GAAATGTTCCAGATTCAAGGAGG + Intronic
1070053157 10:72908614-72908636 AAAATAATTAAGATTTAAGGAGG - Intronic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1071440296 10:85684938-85684960 GAAGTAATTGAGATTAAATGAGG - Intronic
1071714007 10:88076927-88076949 GAAATTTTTGAGAATAAAGGGGG - Intergenic
1072121498 10:92409064-92409086 GAGATAATTAAGATTAAATGAGG - Intergenic
1072356163 10:94613410-94613432 GAAATGTTTAAGATGAAAGCAGG - Intronic
1072707581 10:97692387-97692409 GAAGTAATTAAGATTAAACGAGG - Intergenic
1073237084 10:102026190-102026212 GAAATATTCTACATTAAATGAGG + Intronic
1073241278 10:102060246-102060268 GGAATCTTCCAGAATAAAGGAGG - Intergenic
1073827271 10:107338169-107338191 GAAATATTTCAGTAGAAAAGTGG + Intergenic
1073851885 10:107630956-107630978 GAAATATTTCACATTACACTCGG + Intergenic
1073857856 10:107697922-107697944 GAGATACTTAAGATTAAATGAGG - Intergenic
1078181098 11:9011526-9011548 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1078405466 11:11066916-11066938 GTAATAGTTCAAATTAAAGTCGG + Intergenic
1078967864 11:16368255-16368277 TTAAAATTTCAGATTAAAGAGGG + Intronic
1080004868 11:27396230-27396252 GAAATAATTCACAGAAAAGGTGG + Intronic
1080490544 11:32758664-32758686 GAAAAATTTCAGATTAGAAAAGG - Intronic
1080604500 11:33853543-33853565 GGAATGTTTCAGGTTAAAGAAGG - Intergenic
1081404014 11:42675327-42675349 GATATAATTAAGGTTAAAGGAGG - Intergenic
1081729234 11:45357287-45357309 GATATATTTTAGAATAAAAGCGG - Intergenic
1081885847 11:46495551-46495573 GAAATTGTGCAGATGAAAGGAGG + Intronic
1085218212 11:74850574-74850596 GAAATTCTTCAGATGAAAGAGGG + Intronic
1085580927 11:77649721-77649743 GAATTATTTCAGACTACAGTGGG + Intergenic
1086435299 11:86774058-86774080 GAAATATTTCTCATTAAACTTGG - Intergenic
1087252262 11:95916134-95916156 GAAATATTGCAGACTTTAGGTGG + Intronic
1087978491 11:104580859-104580881 AAAATATTTCAGATAAAAAAGGG - Intergenic
1088049034 11:105488107-105488129 GAAATATTTCAGAGTAGCTGTGG - Intergenic
1088384086 11:109233247-109233269 GATATGTTTCAGATTAAAAGAGG - Intergenic
1089236909 11:117036771-117036793 GAAATAACTCAGATGAAAGTTGG + Intronic
1089673972 11:120076987-120077009 GGGATGTTTCAGATTAAAGGAGG + Intergenic
1090163494 11:124520398-124520420 GACATATTTCAGAATGAAAGGGG - Intergenic
1091482409 12:847079-847101 GATTTAATTAAGATTAAAGGTGG + Intronic
1091931089 12:4395891-4395913 GAAATATTTTAGATGAAAGATGG + Intergenic
1093276203 12:17130999-17131021 GAAATAATTAATATTAAAGAGGG + Intergenic
1093322353 12:17728449-17728471 CAATTATTTAAGAGTAAAGGTGG - Intergenic
1093872018 12:24304403-24304425 GGAAATTTTCTGATTAAAGGAGG + Intergenic
1093974333 12:25404520-25404542 GAAAAATCTCAGATAACAGGAGG - Intergenic
1094241844 12:28236956-28236978 CAAATAAAACAGATTAAAGGGGG - Intronic
1094323204 12:29207757-29207779 GAAATATTTCAGCTTACAGCTGG + Intronic
1094427670 12:30332402-30332424 AAAATATTTCTTATTAAAGTTGG - Intergenic
1094702633 12:32884962-32884984 GAAATATTTCAAATTAACATGGG + Intronic
1095324825 12:40876530-40876552 AAAATATCTGAGAATAAAGGTGG - Intronic
1095715262 12:45338569-45338591 TAAATATTTTAGACTAAAGCAGG + Intronic
1096769008 12:53921017-53921039 GAATTAGTTCAGAATTAAGGAGG - Intergenic
1098176693 12:67799463-67799485 GAAGTAATTAAGATTAAATGAGG + Intergenic
1098260692 12:68667191-68667213 CACATATGTCTGATTAAAGGTGG - Exonic
1100114126 12:91282018-91282040 GAGATAATTAAGATTAAATGAGG - Intergenic
1100324122 12:93524989-93525011 CAAATATTTCACCTTGAAGGAGG + Intergenic
1100419076 12:94412643-94412665 AAAATATGTAACATTAAAGGAGG - Intronic
1102125272 12:110475536-110475558 GAAGTATTTAAGAATAAAGAGGG - Intronic
1103187171 12:118969027-118969049 GAAATAATTAAGATTAGAGCAGG - Intergenic
1103861998 12:124022970-124022992 CAAACATTTCAGAATAAATGGGG - Intronic
1104164189 12:126210871-126210893 AATTTATTTCAGATTTAAGGAGG - Intergenic
1104210177 12:126681376-126681398 CAATTATTTCTCATTAAAGGTGG + Intergenic
1105683841 13:22757619-22757641 GAAATATATCAGACTTAACGTGG + Intergenic
1105749971 13:23413939-23413961 GAAATGTTTAAAATTAAAAGAGG + Intronic
1106086403 13:26546256-26546278 CAAATATCTCAGATAAAAGCAGG + Intergenic
1106150370 13:27094762-27094784 TAAATGTTTCAGGTTAAAGAAGG + Intronic
1106237855 13:27880117-27880139 GGAATGTTTCAGATTAAAGGAGG + Intergenic
1107174272 13:37381713-37381735 GAAAAATTTCAGACTAAATGTGG + Intergenic
1108068280 13:46601558-46601580 GAAAAAATTCAGATTACAAGAGG - Intronic
1108078428 13:46707182-46707204 GAAATGTTCCAGATAAAAGAAGG - Intronic
1108783622 13:53867835-53867857 GAAATAATTAAGGTTAAATGAGG - Intergenic
1109003090 13:56832801-56832823 GAAATAATTAAGGTTAAATGAGG + Intergenic
1109802300 13:67397239-67397261 GAAAAATGTCAGAATAAGGGAGG + Intergenic
1110216852 13:73033195-73033217 GAACTATTCTAGATTAAAGAAGG - Intergenic
1111161794 13:84404640-84404662 GATATATTTAAGTTTAAATGAGG + Intergenic
1111461919 13:88556284-88556306 GAAGTAATTAAGATTAAATGAGG - Intergenic
1111666799 13:91279544-91279566 GAAATAATTAAGGTTAAAGGAGG - Intergenic
1111668442 13:91299183-91299205 GAAATGTTTCAGATTAAAGAAGG - Intergenic
1114229180 14:20765223-20765245 GAAATAATTTAGATGAACGGTGG - Intergenic
1114340737 14:21740386-21740408 GAAATATTTTTGATTATAGTAGG + Intergenic
1114585029 14:23803474-23803496 GAGGTAATTGAGATTAAAGGAGG + Intergenic
1115451881 14:33557301-33557323 GAAATATTTCGCAGCAAAGGTGG + Intronic
1116453152 14:45086687-45086709 GTATTATTTCAGGTTCAAGGGGG + Intronic
1118648630 14:67866319-67866341 AATATATTTGAGATTAAAGCTGG + Intronic
1118804383 14:69222387-69222409 GAAAGATGTCAGATTAAAGTTGG - Intronic
1120319601 14:82942316-82942338 GAAATATCTCAGAGAGAAGGAGG - Intergenic
1120755713 14:88242245-88242267 GAAATAACTCAGATGAAAGAAGG - Intronic
1121275530 14:92664982-92665004 GAGATATTCCAAATTAAAGGAGG - Intronic
1121720829 14:96107555-96107577 GAAGTAATTAAGATTAAATGAGG + Intergenic
1121882782 14:97515382-97515404 GAAGTAATTAAGATTAAACGAGG - Intergenic
1123197004 14:106626743-106626765 GAAATAATTAAGGTTAAATGTGG - Intergenic
1123198347 14:106638614-106638636 GAAATAATTAAGGTTAAATGTGG - Intergenic
1202890005 14_KI270722v1_random:147590-147612 GAAATATTTCAGATGAGAGAGGG + Intergenic
1123982836 15:25619620-25619642 GAGATATTCCAGCTTAAAAGGGG + Intergenic
1124419949 15:29512351-29512373 GAAACATTTCAGCTTAAGTGAGG + Intronic
1124904451 15:33855530-33855552 GGAATATATCAGATTCATGGAGG - Intronic
1125644271 15:41258500-41258522 GAAATGTTCCAGATTAAAGGAGG - Intronic
1126168884 15:45677534-45677556 GAAACATCACAGATTAAAGGAGG - Intronic
1126446387 15:48749753-48749775 GAAATGTTCTAGATTAAAGGAGG + Intronic
1126468072 15:48978944-48978966 GAGATAATTAAGATTAAATGAGG - Intergenic
1127028139 15:54830962-54830984 GAAATATTCAAAATTGAAGGAGG - Intergenic
1128047202 15:64628969-64628991 GAAATATTTCAGTCAAATGGTGG - Intronic
1128864200 15:71101115-71101137 CAAATATTTCAGAAGAAAGTAGG - Intronic
1128883541 15:71264974-71264996 GAACTAATTAAGATTAAATGAGG + Intronic
1128935449 15:71742504-71742526 GAAATATGTCATGTTGAAGGGGG - Intronic
1129490128 15:75916511-75916533 GAGATAGTTAAGATTAAATGAGG - Intronic
1130100419 15:80889503-80889525 AAAGTATCTCAGACTAAAGGTGG + Exonic
1130659544 15:85819669-85819691 TAAATATCTCAGTTAAAAGGTGG - Intergenic
1130747253 15:86668542-86668564 GAAATATTGCAGATAAAAGGGGG - Intronic
1131366140 15:91842795-91842817 GGAGGATTTCAGATTAAAGATGG + Intergenic
1131552160 15:93366312-93366334 GATAGATTTCAGATTTAAAGTGG - Intergenic
1131858588 15:96626817-96626839 GAAACATTTAAAAATAAAGGGGG + Intergenic
1131908847 15:97173640-97173662 GAAGTAATTAAGATTAAATGAGG - Intergenic
1131928373 15:97411983-97412005 TAAATATATCAGATTAAACTTGG - Intergenic
1131986219 15:98044846-98044868 GAAGTAATTAAGATTGAAGGAGG + Intergenic
1133654213 16:7844041-7844063 AAAAGGTTTCAGATTAAAAGGGG + Intergenic
1134033416 16:11010794-11010816 GAAATGTTCCGGAGTAAAGGAGG - Intronic
1137301078 16:47147967-47147989 GAAATAGTTAAGGTTAAATGAGG - Intergenic
1137315505 16:47316655-47316677 GAAACATTCCAAATGAAAGGAGG - Intronic
1137451322 16:48577460-48577482 GAAATGTTAGAGGTTAAAGGTGG - Intronic
1138630314 16:58289030-58289052 GAGATAATTAAGATTAAATGAGG + Intronic
1138630316 16:58289059-58289081 GAGATAATTAAGATTAAATGAGG + Intronic
1140110437 16:71999534-71999556 GAAATATTTCAGAGGAAAGATGG + Intronic
1141832708 16:86518558-86518580 GAAAAACTTCAGATGAAAGTGGG + Intergenic
1142520435 17:500810-500832 GAGAAAAATCAGATTAAAGGAGG - Intergenic
1142819417 17:2453344-2453366 GAACTATTCCAGATTGAAGGAGG - Intronic
1144470226 17:15533095-15533117 AAAATATTTCTGATAAAAAGTGG - Intronic
1144597293 17:16581394-16581416 AAAATATTCCAGACAAAAGGAGG + Intergenic
1144926115 17:18810585-18810607 AAAATATTTCTGATAAAAAGTGG + Intergenic
1145372839 17:22321812-22321834 AAAAGATTTTAAATTAAAGGGGG - Intergenic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1147973376 17:44232896-44232918 GAAATATTTTGAACTAAAGGAGG - Intergenic
1149073590 17:52573410-52573432 TAAATATTTCAAATGATAGGTGG + Intergenic
1150743523 17:67798471-67798493 CAAATTTTGCAGAATAAAGGCGG + Intergenic
1150935593 17:69631886-69631908 GAAATGTTTCAGATTATAAGAGG + Intergenic
1152326469 17:79642835-79642857 TAAATCTTTCAGTTAAAAGGTGG + Intergenic
1153186833 18:2495418-2495440 AAAAAATTTCAGACTAAAAGAGG - Intergenic
1153668854 18:7391464-7391486 CAAATAAAACAGATTAAAGGGGG + Intergenic
1155601186 18:27550005-27550027 GAAATATTTGAGATAAAATTTGG + Intergenic
1155644148 18:28057121-28057143 TAAATATTTCATCTTCAAGGAGG + Intronic
1155803693 18:30140440-30140462 GGAAGCTTTCAGATTACAGGGGG + Intergenic
1156989039 18:43384198-43384220 GAAATAATTAAGGTTAAATGAGG + Intergenic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1158497826 18:57972661-57972683 GAAATGCTCCAGACTAAAGGAGG - Intergenic
1158799874 18:60893787-60893809 GAAGTAATTAAGATTAAATGAGG + Intergenic
1159471625 18:68864914-68864936 GAAATAATCCAGATAAAAGTAGG - Intronic
1159968186 18:74617441-74617463 AAAATATTCCTGATTAAAGAAGG - Intronic
1160079840 18:75714889-75714911 TAAGTAATTAAGATTAAAGGAGG - Intergenic
1160229465 18:77035377-77035399 TAAATATTTCTGAGTAAAGAAGG + Intronic
1162221542 19:9181416-9181438 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1162474993 19:10894443-10894465 AAAATATTCCCGATCAAAGGAGG - Intronic
1164401404 19:27904655-27904677 GAAATATTTAAGAGAAAAAGTGG - Intergenic
1164487661 19:28674078-28674100 GACATTTTTCAAATTAAAGCTGG + Intergenic
1166281294 19:41795961-41795983 GAAATATATAATAATAAAGGTGG + Intergenic
1167651271 19:50730733-50730755 GAAATGTTCCAGATTCAAGGAGG - Intergenic
1168490643 19:56805766-56805788 GAGGTTTTCCAGATTAAAGGAGG + Intronic
1202665421 1_KI270708v1_random:114422-114444 GAAATATTTCAGATGAGAGAGGG + Intergenic
926509892 2:13761772-13761794 GTAATCTTTCTGATCAAAGGAGG + Intergenic
926653630 2:15373799-15373821 GAAATATTTGAGACTGATGGTGG - Intronic
926708940 2:15860110-15860132 GAAAAATTTCAGAATAGAAGAGG - Intergenic
927243306 2:20937167-20937189 GAAATATTTCAGTTGAAGCGAGG + Intergenic
928345861 2:30495366-30495388 GAAATATTTATTATGAAAGGGGG - Intronic
929441483 2:41968656-41968678 GATATATGTCAAAATAAAGGGGG - Intergenic
930371267 2:50504099-50504121 GAAATGTTCTAGATTAAAGGAGG + Intronic
930421190 2:51154484-51154506 GAAATATTTCAGAGAAAAACAGG - Intergenic
930726264 2:54684786-54684808 GAACTGTTCCAGATGAAAGGAGG + Intergenic
931329381 2:61264104-61264126 GAAATATTTCTGAATAAATTTGG - Intronic
932402787 2:71493340-71493362 GAAACGTTCCAGATTAAAGGAGG - Intronic
932921377 2:75918496-75918518 GATATGTTTCAGAATAAAAGTGG + Intergenic
933112435 2:78420669-78420691 GAAATAATTAAGGTTAAATGAGG - Intergenic
933151148 2:78916741-78916763 GAAATATTAAAGTTTAAGGGAGG + Intergenic
933445918 2:82379162-82379184 GAAATCTTTCAGATTAGGAGAGG - Intergenic
933790157 2:85877354-85877376 GAACGGTTTCAGATTAAAGAAGG - Intronic
933825031 2:86151759-86151781 TAATTAGTTCAGATTAAAAGAGG - Intronic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
935104988 2:100033328-100033350 GAAAGATTTGAGATTAACTGTGG + Intronic
935933874 2:108159912-108159934 GAAATGTTCCAGATAAAAGAAGG + Intergenic
936461510 2:112717819-112717841 GAAATGTTCCAGATTACAGGAGG - Intergenic
937649283 2:124301946-124301968 GACATAATTAAGATTAAATGAGG + Intronic
937728892 2:125202712-125202734 GAAATACTTGAGATTAAAAATGG - Intergenic
937781233 2:125840464-125840486 GAAGTTTTTCAGATAGAAGGTGG + Intergenic
938714261 2:134004892-134004914 AAAAAGTTCCAGATTAAAGGAGG + Intergenic
939528397 2:143325548-143325570 AAAATATTTGAAATTCAAGGAGG + Intronic
940334035 2:152506002-152506024 GAAATCTTTCAGACTAAACACGG - Intronic
940672468 2:156687655-156687677 GAAGTAATTAAGATTAAATGAGG - Intergenic
941425815 2:165344085-165344107 AAGATATTTCAGATTAATGGTGG - Intronic
942637847 2:178027830-178027852 GTGATATTTCACATTAAATGTGG - Intronic
943023706 2:182603909-182603931 GAGATATTTCAGAGTGAAAGAGG - Intergenic
944134692 2:196385909-196385931 GACATTTTTCACATTAAATGAGG - Intronic
944205465 2:197153471-197153493 GAAGTATTTCAAATTACATGAGG + Intronic
944209054 2:197187543-197187565 GAGATAATTCAGATTAAAAGAGG + Intronic
944224501 2:197336533-197336555 GAAATATGTCAGTATAAAAGGGG - Intergenic
944785354 2:203064689-203064711 GAAATGTTTCAGATTAAAAGAGG + Intronic
946460466 2:219864100-219864122 CTGATATTTAAGATTAAAGGTGG - Intergenic
1169833310 20:9849809-9849831 GAAATAATTAAGATTAGATGAGG + Intergenic
1170408455 20:16063960-16063982 GAACTGTCCCAGATTAAAGGAGG + Intergenic
1170470745 20:16665523-16665545 GAAATTATCCAAATTAAAGGAGG - Intergenic
1170918725 20:20655365-20655387 GAAATATTACAGACGTAAGGGGG + Intronic
1171038057 20:21732776-21732798 GAACTGTTCCAGATGAAAGGAGG - Intergenic
1171939827 20:31315911-31315933 GACACATTTGAGAATAAAGGGGG + Intergenic
1173148002 20:40542021-40542043 GAAATATTTTAGCTTAAAGGAGG - Intergenic
1175009606 20:55721877-55721899 GACACATTTAAGATGAAAGGAGG - Intergenic
1175434306 20:58931990-58932012 GAAATCCTTCACATGAAAGGTGG - Intergenic
1175530563 20:59671971-59671993 GCCACATTTCAGAATAAAGGAGG - Intronic
1176892921 21:14340240-14340262 AAAAGATTTCAGATTCATGGAGG - Intergenic
1176962841 21:15179045-15179067 GAAATATATCAGATTAAAGTTGG - Intergenic
1177045933 21:16170193-16170215 GGAATTTTTCAGATACAAGGAGG + Intergenic
1177091819 21:16778942-16778964 GAAATATTTCATATTGATGGAGG + Intergenic
1177872094 21:26586561-26586583 GAAATATTTCAGATTAATCAAGG - Intergenic
1178080593 21:29059862-29059884 GTCATATGTCATATTAAAGGTGG - Intronic
1178385592 21:32146909-32146931 CAAATATTAAAGATTAAACGTGG + Intergenic
1178613282 21:34106878-34106900 GAAGTAGTCCAGATTAAAGGGGG - Intronic
1178747287 21:35265220-35265242 GAAGTAATTAAGGTTAAAGGAGG + Intronic
1179159716 21:38884305-38884327 CAAATATATAAGAGTAAAGGGGG - Intergenic
1179216259 21:39369612-39369634 GAAATGTTTCAGATTAAAGGAGG + Intergenic
1179357250 21:40672141-40672163 GAAGTAATTAAGATTAAATGAGG - Intronic
1180237450 21:46472084-46472106 GAGATATTTAAGATCAAATGAGG + Intronic
1180332133 22:11491342-11491364 GAAATATTTCAGATGAGAGAGGG + Intergenic
1182390334 22:29989197-29989219 AAAATGTTCCAGATTAAAGAAGG - Intronic
1182701498 22:32243316-32243338 GAAATGTTCCAGATGAAAGGAGG + Intronic
1185112974 22:48912533-48912555 GAAAGATTTCAGAATATGGGGGG - Intergenic
949557159 3:5164843-5164865 GAAATGTTTCAGACTAACAGAGG - Intronic
949586683 3:5447084-5447106 GAAAAATTTGAAAGTAAAGGAGG + Intergenic
949772531 3:7594663-7594685 GAAGCATTTCAGATCAAAGCAGG + Intronic
949974863 3:9446877-9446899 AAAATATTTCATTTTAAATGTGG - Intronic
951319909 3:21231913-21231935 GAACTATTTCAGTGTAAAAGTGG - Intergenic
952100761 3:30010465-30010487 GCACTGTTCCAGATTAAAGGTGG - Intergenic
952273509 3:31855339-31855361 GAAGTGTTCCAGATTAAATGAGG - Intronic
952952391 3:38535515-38535537 GAACTCTCCCAGATTAAAGGAGG - Intronic
953593483 3:44284055-44284077 GAAATGTTCTAGATTAAAGGAGG - Intronic
953661161 3:44892763-44892785 AAATTGTTCCAGATTAAAGGAGG - Intronic
954725638 3:52606719-52606741 GAAATAATTAAGAATACAGGAGG + Intronic
954765995 3:52917314-52917336 GAAGTAATTAAGATTAAATGAGG + Intronic
955100399 3:55843635-55843657 GAAATATTTTACTTTAAATGTGG + Intronic
955815788 3:62841417-62841439 AAAGTATTTCATATTAAAGCTGG + Intronic
955859114 3:63308432-63308454 AAATTATTTCAGATGAAATGTGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956460287 3:69464948-69464970 GAAAACTTACAGATTAAAAGAGG + Intronic
956863555 3:73347923-73347945 GAGATAATTCAGGTTAAATGAGG - Intergenic
957377496 3:79377531-79377553 GTAATATTTTACAATAAAGGAGG - Intronic
957580351 3:82064650-82064672 GAAAGATTTCAGAGGAAATGAGG + Intergenic
957950945 3:87125682-87125704 GACATATTTAAGAGTAAAGCAGG - Intergenic
958270045 3:91488298-91488320 GAACTCATTAAGATTAAAGGAGG + Intergenic
958858980 3:99422090-99422112 GAACTACTTTAGATTAAAGGGGG + Intergenic
959286143 3:104413604-104413626 GAGGTAATTCAGATTAAATGAGG - Intergenic
959901319 3:111664745-111664767 AAAATATTCTAGATTAAAGGAGG + Intronic
960013373 3:112857842-112857864 GAAGTAATTAAGATTAAATGAGG - Intergenic
960238013 3:115307055-115307077 GAAATAATTAAGATTAAAAGAGG + Intergenic
960353012 3:116616687-116616709 GAAATATTTCAGAATCAAGGAGG + Intronic
961430562 3:126879580-126879602 GGAATGCTTTAGATTAAAGGAGG + Intronic
963299301 3:143581120-143581142 GTACTATTTTAGAATAAAGGAGG + Intronic
963526720 3:146424330-146424352 GAAGTAATTAAGATTAAATGAGG - Intronic
963749854 3:149165390-149165412 AAAATATTTGCTATTAAAGGAGG + Intronic
964293556 3:155208799-155208821 GAAAAATTTAAGATTAATGTTGG - Intergenic
964356584 3:155856553-155856575 TAATTATTTCAAATTAAAGAAGG - Intergenic
964465760 3:156990077-156990099 GAAATATTCTAGATTAAAGGAGG - Intronic
964602783 3:158520691-158520713 GAAATGTTTCAAATTAATTGTGG + Intronic
964907121 3:161730678-161730700 TAAGTATTTGAGTTTAAAGGTGG + Intergenic
965196058 3:165596406-165596428 GAAAAGTTGCAGGTTAAAGGAGG + Intergenic
965936801 3:174124000-174124022 GAGATAATTAAGATTAAATGGGG + Intronic
967452412 3:189641731-189641753 GAAATAATTCAAAAGAAAGGTGG - Intronic
970045044 4:11842483-11842505 AACATTTTACAGATTAAAGGAGG - Intergenic
971036582 4:22700136-22700158 TAAATATTTCCAATTCAAGGTGG - Intergenic
971165471 4:24178074-24178096 AAAATATTTGAGATAAAAGATGG + Intergenic
971532460 4:27706249-27706271 GAAATACTTCCGACTAAACGTGG - Intergenic
971855740 4:32041135-32041157 GAGATAATTAAGATTAAATGAGG + Intergenic
972025801 4:34375320-34375342 TAAATATTTCACATTAAATCAGG - Intergenic
972089991 4:35269420-35269442 GATGTGTTTCAGATTATAGGAGG - Intergenic
973345324 4:49048724-49048746 GAAATAATTAAGGTTAAATGAGG - Intronic
974142844 4:57909625-57909647 TAAATATTTCATATTACATGAGG - Intergenic
974337921 4:60575607-60575629 GAAATATTTCATACAAAAGATGG - Intergenic
974635205 4:64555153-64555175 TAAAAACTACAGATTAAAGGAGG + Intergenic
974808328 4:66912147-66912169 AAGATATTTCTGATTAAATGTGG + Intergenic
975663850 4:76714286-76714308 GAAATATCACAGATCAGAGGAGG - Intronic
976072207 4:81254325-81254347 GAAGTACTTAAGATTAAATGAGG + Intergenic
976338955 4:83923789-83923811 AAAATAATTTAGGTTAAAGGAGG + Intergenic
976428879 4:84939105-84939127 GAAGTGTTCCAAATTAAAGGAGG - Intronic
976434690 4:85003509-85003531 AACAAATTTCAAATTAAAGGAGG + Intergenic
976489754 4:85656324-85656346 GAAATGTTTCAGCTTAATGTTGG - Intronic
977079986 4:92513464-92513486 GAATTATTTTTGAGTAAAGGTGG - Intronic
977409302 4:96641008-96641030 AAAATATTTGAGATTCAAGTTGG - Intergenic
977778128 4:100947494-100947516 GAAATCTTTCAGATGAAACCTGG - Intergenic
979613143 4:122710777-122710799 GAAAAATTTCTGACTAAAAGGGG + Intergenic
979639253 4:122993459-122993481 TAAATATTTGAGACTAAAGAAGG - Intronic
979707865 4:123742546-123742568 GAAAAATTTCAATTTAAAGATGG + Intergenic
979831278 4:125307509-125307531 GAAATTTTTCCTATTAAAGCTGG + Intergenic
980183260 4:129428526-129428548 AGAATATTTCAGAAAAAAGGAGG + Intergenic
980221039 4:129915825-129915847 CACATAGTTCAGATTAAAGCTGG + Intergenic
980948124 4:139343475-139343497 AAACTGTTTCAGATTAAAAGAGG - Intronic
981364294 4:143884189-143884211 GAAATATTTCAGACAAAGGGAGG - Intronic
981385407 4:144124679-144124701 GAAATATTTCAGACGAAGGGAGG - Intronic
982578718 4:157151038-157151060 GAATAATTTCAGATTATAGAAGG - Intronic
982631344 4:157833318-157833340 GAAATAATTTAGACTAAAGGAGG - Intergenic
983550857 4:169015976-169015998 GAGATAATTAAGATTAAATGAGG + Intergenic
983603593 4:169558983-169559005 AAAATATTTCAAATTCAATGAGG + Intronic
983751369 4:171276576-171276598 GAAGTATATGAAATTAAAGGGGG - Intergenic
983913912 4:173270162-173270184 GAAATCTTTGAAATTAAAGTGGG + Intronic
984356757 4:178669945-178669967 GAAGTAATTCAGGTTAAATGAGG - Intergenic
984691409 4:182730749-182730771 AAAATATTTCATATAAAAGTTGG + Intronic
984787263 4:183579441-183579463 GAAATATTTCAGTATAATTGTGG + Intergenic
985381368 4:189398484-189398506 GAAGTAATTCAGATAAAATGAGG - Intergenic
986756932 5:10845598-10845620 GAAATAATAAAGATTAAAGCAGG + Intergenic
987110881 5:14685335-14685357 GAAATATTCAAGAATAAAGTAGG - Intronic
987871237 5:23620217-23620239 GAAATACTTTAAATAAAAGGGGG - Intergenic
987885830 5:23810458-23810480 GAAATAATTAAGATTAAATGAGG + Intergenic
987969539 5:24924730-24924752 GAAGTAATTCAGGTTAAATGAGG + Intergenic
990198680 5:53346999-53347021 TAAATATTGCATTTTAAAGGAGG + Intergenic
990919109 5:60943594-60943616 GGAATTTTACAGATTAAAAGAGG + Intronic
990976767 5:61567716-61567738 GAAATTTTTCACAGAAAAGGAGG - Intergenic
991218654 5:64186215-64186237 GAAAGGATTCAGATGAAAGGTGG - Intronic
992010707 5:72524252-72524274 GAAATGTTACACATTAGAGGTGG + Intergenic
992427899 5:76677205-76677227 GAAATATTTCCTAATAAAGGGGG - Exonic
992459847 5:76950651-76950673 GAAATATTTGAAAGTAATGGAGG + Intergenic
992788667 5:80194044-80194066 GAAGTTTTTGAGATTAAAAGTGG - Intronic
993667518 5:90719039-90719061 AAAATATTTAACATTAAAGCTGG + Intronic
994271957 5:97788252-97788274 GAAATTATTCAGATTTAAGCAGG - Intergenic
995368282 5:111388491-111388513 GAAATTTTTCAGATGCAAGGAGG - Intronic
995446769 5:112253438-112253460 AAAGTGTTCCAGATTAAAGGAGG + Intronic
996078939 5:119232927-119232949 GAAAAAAATCAGATTAAAGAAGG - Intronic
996266875 5:121551898-121551920 GATATATTTCAGGGAAAAGGGGG + Intergenic
996343834 5:122468595-122468617 GAAATATTTTTGATGAAATGTGG + Intergenic
997137681 5:131343990-131344012 TAAATACTTCAGATTTAAGTGGG + Intronic
997483508 5:134207891-134207913 GAAAAATTTCAGAATGAAGTAGG - Intronic
997788107 5:136732185-136732207 GATTTATTTCAGATTGAAGCTGG + Intergenic
998195775 5:140069455-140069477 GAAATGTTCCAGATTTAAGGTGG + Intergenic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
998305986 5:141077682-141077704 GAAATGTTCCAGCCTAAAGGGGG + Intergenic
998722088 5:144964291-144964313 GAAATCTCTCAGATAAAAGTGGG + Intergenic
998902420 5:146870313-146870335 GAGATAATTAAGATTAAATGAGG + Intronic
999091766 5:148942258-148942280 GAAATATCTCAGATGGAAGATGG + Intronic
999580661 5:153035010-153035032 GAGATATTTCACATAAAATGTGG - Intergenic
999690312 5:154140731-154140753 TAAATATCTCAGGTTAAGGGTGG + Intronic
1000167338 5:158665550-158665572 GAAATATATCATAATAAAGCAGG + Intergenic
1000829000 5:166080599-166080621 GCAATAATTTAGATTAAAGATGG - Intergenic
1000832029 5:166114461-166114483 GAAATGCTCCAGGTTAAAGGAGG - Intergenic
1001640050 5:173237541-173237563 GAAATATTACCGTTTAATGGGGG + Intergenic
1002669470 5:180854842-180854864 CAAATGTTCCAGATTAAAGAAGG + Intronic
1003789581 6:9528630-9528652 GAACTATTCCAAATTGAAGGAGG + Intergenic
1003956289 6:11168443-11168465 GGAATGTTTCTGATTAAAGGAGG - Intergenic
1004112922 6:12738112-12738134 AAATTATTCCAGATTAAAGAAGG - Intronic
1004758317 6:18638196-18638218 GAAATACTTCAGATCTAAGTGGG + Intergenic
1005224166 6:23622293-23622315 GAAATATTTGAGACTAAATTTGG - Intergenic
1005455120 6:26012227-26012249 GAGATATTTAAGGTTAAATGAGG + Intergenic
1006842849 6:37041240-37041262 GAGGTAATTAAGATTAAAGGAGG + Intergenic
1007844733 6:44743828-44743850 GAAATATTTTTGATCAAAAGAGG - Intergenic
1008279547 6:49579475-49579497 GAATTGTTCTAGATTAAAGGAGG + Intergenic
1008888631 6:56459340-56459362 AAAAAAGTTAAGATTAAAGGTGG - Intronic
1008985118 6:57533044-57533066 GAACTCATTAAGATTAAAGGAGG - Intronic
1009029866 6:58043850-58043872 GAAATATTACAGATTATTGTTGG + Intergenic
1009173152 6:60425999-60426021 GAACTCATTAAGATTAAAGGAGG - Intergenic
1009205393 6:60795088-60795110 GAAATATTACAGATTATTGTTGG + Intergenic
1009565675 6:65308555-65308577 CAAATGTTTCAGATTGAAGTGGG + Intronic
1010740509 6:79497587-79497609 GAAATGGTCCAGATAAAAGGAGG + Intronic
1010922922 6:81706534-81706556 AACATATTTCACTTTAAAGGAGG - Intronic
1010931114 6:81804461-81804483 GAAATGTTGCAGATTAATTGGGG - Intergenic
1010948975 6:82012671-82012693 GAAGTAATTCAGGTTAAATGAGG + Intergenic
1010966807 6:82219779-82219801 GAAATATTTCATATATAATGTGG + Intronic
1011929975 6:92699907-92699929 GAATTATTCCAGAATAATGGAGG - Intergenic
1012057373 6:94430111-94430133 ACAATATTTAAGATTAAAGGAGG - Intergenic
1012310255 6:97715070-97715092 GAGATAATTAAGATTAAATGAGG - Intergenic
1012426930 6:99124958-99124980 GAAATGCTCCAGATTAAAGGAGG + Intergenic
1012619770 6:101328575-101328597 GAAATATTTCATAATAACTGAGG + Intergenic
1012643801 6:101654823-101654845 GAAAGATTTCAGAGCAGAGGTGG - Intronic
1013413113 6:109899311-109899333 TAAATTTTCCAGATTAAATGAGG - Intergenic
1013631487 6:111990235-111990257 TACATATTTCATTTTAAAGGTGG + Intergenic
1013802490 6:113963673-113963695 GAAGTATTTCAGATTTGGGGAGG - Intronic
1014822864 6:126012531-126012553 GAAGTGTTACAAATTAAAGGAGG - Intronic
1014981520 6:127951332-127951354 GAATTGTTTCATATTAAAAGAGG - Intergenic
1015040558 6:128712754-128712776 GCTTTATTTCAGATTAAAGCTGG - Intergenic
1015069615 6:129075714-129075736 GAAATAGTATGGATTAAAGGAGG + Intronic
1015244237 6:131059889-131059911 GAAATGTTTCTAAATAAAGGTGG + Intronic
1015396608 6:132741719-132741741 GAAATAGATCATATCAAAGGGGG + Intergenic
1016206633 6:141475086-141475108 GAAAATTTTCTGATTAAATGGGG + Intergenic
1016911037 6:149199556-149199578 AAAATATTTAAGCTTAAATGAGG + Intergenic
1017655232 6:156621164-156621186 GAACTGTTGCAAATTAAAGGAGG + Intergenic
1017975907 6:159357099-159357121 AAAATATGGCAGATTAAATGTGG - Intergenic
1018690953 6:166343522-166343544 AAAATCTTTCAGTTAAAAGGTGG + Intergenic
1019885463 7:3900607-3900629 GAAATCTTCCAAAATAAAGGTGG - Intronic
1020774663 7:12437906-12437928 GAAATATTTCAAAATAATGGAGG + Intergenic
1020993273 7:15229341-15229363 AATATATTTAAGATGAAAGGTGG + Intronic
1021028937 7:15704878-15704900 GAAATAATACAGTTTATAGGAGG + Intergenic
1021364122 7:19755091-19755113 GAAATTTTTCACATGGAAGGAGG - Intronic
1022749308 7:33206882-33206904 GAAATTTTCCAAATTAAAAGAGG - Intronic
1024155783 7:46623255-46623277 GAAATATCTGAGATAAAAGAAGG - Intergenic
1024696750 7:51865765-51865787 GGAATGTTTCAGAAGAAAGGTGG - Intergenic
1024721695 7:52144069-52144091 GCTATATTTCAGATTAGAGGTGG - Intergenic
1026041944 7:66875437-66875459 GGAATAATTTAGGTTAAAGGAGG - Intergenic
1026811200 7:73467296-73467318 GAGATGTTTCAGGTTAAAGTGGG - Intronic
1027698867 7:81443884-81443906 GAAATGTTTAAGATTACACGTGG - Intergenic
1028846987 7:95492347-95492369 GAAATATTACAGATGAATTGAGG + Intronic
1028897998 7:96063664-96063686 GAAATAATTAAGATTAAATGAGG - Intronic
1030039904 7:105440202-105440224 GACATATTTCTGATTCAAGATGG - Intronic
1030388819 7:108900240-108900262 GAAGTATTTAAGGTTAAATGAGG - Intergenic
1030556062 7:111025101-111025123 GACATATTTCAGATGATATGGGG - Intronic
1030573240 7:111253176-111253198 GAAATATTTAATTTTAATGGAGG - Intronic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1030827717 7:114181343-114181365 GAAATATTTTAGGTTATAGAAGG - Intronic
1030836070 7:114287437-114287459 TAAATCTCTCAGATTAAAGAAGG + Intronic
1030928887 7:115497279-115497301 GAAGTATGTAACATTAAAGGTGG - Intergenic
1030938504 7:115616212-115616234 GAAGTAATTAAGATTAAAGGAGG + Intergenic
1031340912 7:120599861-120599883 GCATTATTTCTGATTACAGGAGG + Intronic
1031433870 7:121708882-121708904 GAAAAATGTGAGATTTAAGGAGG + Intergenic
1031802226 7:126261699-126261721 TAAATATATCTGCTTAAAGGAGG + Intergenic
1031827154 7:126579937-126579959 GAAATATTACAGAATAAATCAGG + Intronic
1035123805 7:156592636-156592658 GAAATAATTAAGGTTAAATGAGG + Intergenic
1036993199 8:13623907-13623929 TAAATATTGCAGATAAGAGGAGG + Intergenic
1037251786 8:16904143-16904165 AAAATATTACAGCTTAAAGTGGG + Intergenic
1037572357 8:20169250-20169272 GAACTTTTCCAGATTAAAAGAGG + Intronic
1038907301 8:31919607-31919629 GAAATATTTCAGATAACACAGGG + Intronic
1039426419 8:37490081-37490103 GAAATATTTCAGAATGACTGCGG + Intergenic
1039666570 8:39538953-39538975 GAAATAGTAAAGATTAAAGCAGG - Intergenic
1040748690 8:50678663-50678685 GAAATATTTCAGATAAAGTTTGG - Intronic
1041516721 8:58707922-58707944 GATATACTTCAGTGTAAAGGTGG + Intergenic
1041775935 8:61522883-61522905 GAGATAGTTAAGATTAAATGAGG - Intronic
1042610090 8:70589299-70589321 GAAATATTTCAGCTTACAAAAGG + Intronic
1042672114 8:71275741-71275763 GCAATAATACAGATTCAAGGAGG + Intronic
1043221528 8:77671623-77671645 GCAATACTTAAGATTAAAGCAGG + Intergenic
1043259859 8:78183133-78183155 AACATATTCTAGATTAAAGGGGG - Intergenic
1043571871 8:81613146-81613168 GAAATGTTCCAGATCAAAGGAGG + Intergenic
1043577104 8:81670619-81670641 GAAATGTTCCAGATCAAAGAAGG + Intronic
1044451789 8:92344053-92344075 GAAATTTTTTAGAATAAATGTGG - Intergenic
1044708738 8:95034494-95034516 GAAATGTTCCAGAATAAAGGAGG - Intronic
1044799604 8:95940516-95940538 GCAATAATTCAGATTAGAGATGG + Intergenic
1045667182 8:104501094-104501116 GAAATATTAATGAATAAAGGAGG - Intronic
1046355938 8:113085257-113085279 CAAATAATTCAGTTAAAAGGGGG + Intronic
1046627939 8:116595111-116595133 GAAGTAATTAAGGTTAAAGGAGG + Intergenic
1046734233 8:117759220-117759242 GAAATGTTTCAGATAAAAGGAGG + Intergenic
1047153368 8:122290006-122290028 CAAATATTTGAGATTAAATATGG + Intergenic
1047363056 8:124186634-124186656 GAACTATTCAAGATGAAAGGAGG + Intergenic
1047855010 8:128899950-128899972 GAAATATTTAAGATTTAATAAGG - Intergenic
1047913253 8:129554095-129554117 CAAATCTTTCAGAATAAAAGCGG + Intergenic
1047938129 8:129801574-129801596 GAAATTTTTCAGAATAAAAATGG - Intergenic
1048491585 8:134898758-134898780 GAAGTGTCTCAGATTAAAGGAGG - Intergenic
1048659385 8:136579337-136579359 TAAATATTTTAGAAAAAAGGTGG + Intergenic
1049113224 8:140662935-140662957 GAGCTGTTTCAGATGAAAGGAGG + Intronic
1050283703 9:4079058-4079080 AAGATATTTCATACTAAAGGAGG + Intronic
1050624451 9:7488064-7488086 GAGATAATTAAGGTTAAAGGAGG + Intergenic
1051049935 9:12920219-12920241 AAAATATTTAACATTAAGGGGGG + Intergenic
1051050294 9:12924355-12924377 GAAATATTTCATATTAATTAAGG - Intergenic
1051188857 9:14489253-14489275 GAAATATAACAGATTGATGGTGG + Intergenic
1051210409 9:14736403-14736425 CAAATATTAAAGATTTAAGGTGG + Exonic
1051263234 9:15286273-15286295 AAAATGTTTCAGATTAAAGGAGG - Intronic
1052163808 9:25296454-25296476 TAAATATTTGAGAATAAAGGTGG + Intergenic
1052367963 9:27634637-27634659 AATATATTTGAGATTTAAGGTGG + Intergenic
1052627192 9:30991759-30991781 TTAAGATTTAAGATTAAAGGAGG + Intergenic
1054958620 9:70942125-70942147 AAAATATCTCAGTTGAAAGGTGG - Intronic
1055440189 9:76329477-76329499 GAAACATTTCATATTAAAGGAGG - Intronic
1055546145 9:77375970-77375992 AAAATAAAGCAGATTAAAGGAGG + Intronic
1056070399 9:82980769-82980791 GAAATTTTTCAAAATAAGGGGGG - Exonic
1056372458 9:85970755-85970777 GAAATGCTCCAGATTAAAGGAGG + Intronic
1058087216 9:100761431-100761453 GAAACATTTCACATTAAACTGGG + Intergenic
1058188124 9:101879844-101879866 GAAATAGTTAAGTTAAAAGGTGG - Intergenic
1058717315 9:107734569-107734591 TAAATATGTGAGATTCAAGGGGG - Intergenic
1060227393 9:121801888-121801910 AAAATGTTCCAGATTAAAAGAGG - Intergenic
1060429008 9:123532408-123532430 GAACTATTCTAGATTAAAGGAGG - Intronic
1185958773 X:4523274-4523296 GAAATTTTACAGATAATAGGTGG - Intergenic
1186221088 X:7350004-7350026 GAAATATCAAAGAGTAAAGGTGG - Exonic
1187215603 X:17273028-17273050 GAAGTAATTAAGATTAAATGAGG - Intergenic
1187552536 X:20320498-20320520 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1187705757 X:22007806-22007828 AAAAGATTCCAGATTAAAGGAGG + Intergenic
1188749597 X:33888421-33888443 GAATTATTTGAGACTAAAGCTGG - Intergenic
1189009601 X:37034003-37034025 GAACTAGTCCATATTAAAGGAGG - Intergenic
1189068347 X:37836167-37836189 GAAATATCTCAAGTTAAAGCTGG + Intronic
1189113013 X:38313190-38313212 GACATATTTCAGAGAAAGGGTGG - Intronic
1189487655 X:41445551-41445573 GAAATGTTTCAGTTCACAGGTGG + Intergenic
1189600541 X:42620272-42620294 GAAATATTTCACAGGAAATGGGG + Intergenic
1189744970 X:44159631-44159653 GAAATATTTCAGTCTGCAGGAGG - Intronic
1190167298 X:48083716-48083738 GGAAGAATTCAGATTAAAGGTGG + Intergenic
1190386182 X:49884224-49884246 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1191692609 X:63956570-63956592 GAAATGTTTCAGATATAATGAGG - Intergenic
1192512948 X:71736368-71736390 GAAATATTTCCTAGTTAAGGGGG + Intergenic
1192513749 X:71745141-71745163 GAAATATTTCCTAGTTAAGGGGG - Intergenic
1193103958 X:77647401-77647423 GAAATAATACAGATTAGAGCAGG + Intronic
1193473744 X:81938942-81938964 GAAGTAATTAAGATTAAATGAGG + Intergenic
1194270098 X:91802181-91802203 GAAATCTTTCAAATTAAATTTGG + Intronic
1194695804 X:97048274-97048296 GAAATGTTCCACATTAAATGAGG - Intronic
1194738979 X:97549745-97549767 GAACTGTTCCAGATTAAAGGAGG - Intronic
1195197417 X:102513007-102513029 GAAGTAATTCAGATTAAATAAGG - Intergenic
1195798347 X:108678889-108678911 GAACTGTTTCAGATTAAAGAAGG - Intronic
1196198674 X:112861390-112861412 GAAATGTTCCAGATAAAATGGGG + Intergenic
1196940139 X:120767706-120767728 GAAATGTTCCAGATTAAAAGAGG - Intergenic
1198011307 X:132557904-132557926 GGAATGTTTCAGAATAAAAGAGG + Intergenic
1198386730 X:136135739-136135761 GAAATATTCTAGATCAAAGAAGG + Intergenic
1198640460 X:138750355-138750377 TAAATAATTCAAATTAATGGAGG + Intronic
1200587338 Y:5023620-5023642 GAAATCTTTCAAATTAAATTTGG + Intronic
1200832041 Y:7695701-7695723 GAACTATGTCAGGTTACAGGTGG + Intergenic
1201990265 Y:20015921-20015943 GAAATAATTCAGATGAGAGTAGG + Intergenic