ID: 1146704184

View in Genome Browser
Species Human (GRCh38)
Location 17:34988312-34988334
Sequence TGTTGGGGATGGAATTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146704172_1146704184 19 Left 1146704172 17:34988270-34988292 CCAGGTGATGATAAGGACAGCAT 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146704184 Original CRISPR TGTTGGGGATGGAATTTGGG AGG Intronic
901590855 1:10341265-10341287 TGTTGGGGAGGATAGTTGGGTGG + Intronic
901943872 1:12685107-12685129 TGTTGGGGATGGGACCTGGTGGG - Intergenic
902796966 1:18806358-18806380 GATTGGGGAGGGAATTGGGGAGG - Intergenic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
903869055 1:26419115-26419137 GGTTGGGGGTGGAATGGGGGTGG + Intronic
905925363 1:41745752-41745774 TGTGGGGGTGGGAATATGGGAGG + Intronic
906140987 1:43533305-43533327 TGTTGGTGAAGGAATTTGGCGGG + Intronic
909104872 1:71394614-71394636 TGTTGGAGGTGGAACTTGGTGGG + Intergenic
909157051 1:72091436-72091458 AGTTAGGGATGGAGTTAGGGAGG - Intronic
910013660 1:82495711-82495733 TGTAGGGGAAGGGATTTGGTGGG - Intergenic
910504334 1:87932559-87932581 TGTTGGGGTTGAAATGGGGGTGG - Intergenic
910504417 1:87933629-87933651 TGTTGGGGTTGAAATGGGGGTGG - Intergenic
912153622 1:106888488-106888510 TGTAGGGGATGGAAGTGGAGGGG + Intergenic
912313664 1:108647343-108647365 TTCTGAGGATGGAATTGGGGTGG - Intergenic
913101181 1:115568198-115568220 TGGTGGGGCTGGGACTTGGGAGG + Intergenic
913266592 1:117051135-117051157 TGCTGTGGAAGGGATTTGGGAGG + Intergenic
915891058 1:159774348-159774370 TTTGGGGGATGGGATTTGGGTGG + Intergenic
920539965 1:206770850-206770872 TGTAGGAGATGGTATTTTGGGGG + Intronic
921960372 1:221027668-221027690 TGTTGGGGATGGGACTTTGTGGG + Intergenic
923777468 1:236992735-236992757 TGTTGGGGGAGGAACTTGGTGGG - Intergenic
923821988 1:237454995-237455017 TGTTGGGGATGGAAGCTGTCAGG + Intronic
923899132 1:238306016-238306038 TGTTGGAGGTGGAGCTTGGGTGG + Intergenic
1062912201 10:1218622-1218644 TGTCGGAGGTGGAATTTGGTGGG + Intronic
1063110063 10:3027795-3027817 TGTTGGAGATGAAACTAGGGAGG + Intergenic
1063738883 10:8795115-8795137 AGTTGGAGATGAGATTTGGGTGG + Intergenic
1065351779 10:24802327-24802349 TGTGTGGGATGGAGTTAGGGTGG + Intergenic
1065751286 10:28890193-28890215 AGTTGGAGATGAGATTTGGGTGG + Intergenic
1069066998 10:63952168-63952190 AGCTGGGGATGGAGTGTGGGGGG + Intergenic
1069414458 10:68185441-68185463 TGTTGGGGAGGGTATGTGGATGG - Intronic
1069908152 10:71744296-71744318 TGTGGGGGTTGGAGTGTGGGTGG - Intronic
1071152310 10:82649833-82649855 TCTTAGTGGTGGAATTTGGGTGG + Intronic
1071574635 10:86716447-86716469 TGCTGGGGATGGAGTGTAGGTGG - Exonic
1073094552 10:100971729-100971751 AGTTGGGGATGGGATGGGGGTGG - Intronic
1073112298 10:101069972-101069994 GATTGGGGATGGAGTTGGGGTGG + Intergenic
1074783787 10:116821115-116821137 TGTTGGGAATAGACTTTGGTAGG - Intergenic
1077460025 11:2704444-2704466 TGGTGGGGATGTGATTTGGGTGG - Intronic
1082000888 11:47393241-47393263 TGCTGGGGATGGAGTGGGGGTGG + Intergenic
1082130861 11:48487786-48487808 TGTAAGGGATGGATTTGGGGAGG + Intergenic
1082217842 11:49596270-49596292 TGTGGTGGTGGGAATTTGGGAGG - Intergenic
1082245925 11:49922289-49922311 TGTAAGGGATGGATTTGGGGAGG - Intergenic
1082564360 11:54658659-54658681 TGTAAGGGATGGATTTGGGGAGG + Intergenic
1082729946 11:56783545-56783567 TGTTAGGCTTGGAATTTTGGAGG - Intergenic
1083215340 11:61215276-61215298 TGACGGGGATGGAATGTTGGTGG - Intergenic
1083218224 11:61234105-61234127 TGACGGGGATGGAATGTTGGTGG - Intergenic
1083428129 11:62599991-62600013 TGTTGGGGTTGGAAGCAGGGTGG - Intronic
1083434157 11:62631222-62631244 TCTTGGGGTTGGAAAATGGGAGG - Intronic
1083635601 11:64119210-64119232 TGTTGGGGATGGGAGTGAGGTGG + Intronic
1083871146 11:65489300-65489322 TGCTGGGAAAGGAATCTGGGTGG - Intergenic
1084026086 11:66450675-66450697 TGTTGGGGATGGAGCCTGGTGGG - Intronic
1084557639 11:69884345-69884367 TGTTGGGGAGGGAATAAGGAGGG + Intergenic
1085660767 11:78364641-78364663 TGTTTGGAGAGGAATTTGGGGGG - Intronic
1085767509 11:79295934-79295956 TGTGGGGTATGGGATTTTGGGGG - Intronic
1086432407 11:86748357-86748379 TGCTGGGAATGGAAGTCGGGTGG + Intergenic
1086545977 11:87967885-87967907 GGTTGGGGATGGCATGCGGGAGG + Intergenic
1087066430 11:94032050-94032072 TGTTTGAGATGGGGTTTGGGAGG - Intronic
1087436398 11:98124107-98124129 TATTGGAGATGACATTTGGGTGG + Intergenic
1088705658 11:112461943-112461965 TGTTTGAGATGAGATTTGGGTGG - Intergenic
1089013222 11:115147112-115147134 TGTTGGGTGTGGAGTATGGGTGG + Intergenic
1089122887 11:116152316-116152338 TGTTGGAGGTGGAATCTGGTGGG + Intergenic
1090769989 11:129911478-129911500 TGTTTGGAAAGGAAGTTGGGAGG - Intronic
1091924396 12:4333157-4333179 TTTTGGGGATGGAATTTCACTGG + Intronic
1092123508 12:6060446-6060468 TTTTGGGGATGGAAGTGTGGAGG - Intronic
1092209153 12:6635272-6635294 TTCAGGGGATGGAATTTTGGAGG - Intronic
1092641084 12:10510561-10510583 TCTTGGGGATGGAGTGTGGGTGG - Intronic
1095550032 12:43425250-43425272 TGTTGGGGGAGGAGTGTGGGGGG + Intronic
1096134784 12:49190408-49190430 TGTTGGTGATGAAATTTCAGAGG + Intronic
1096749252 12:53748300-53748322 TGTTGGGGATGGAGTTGGGGGGG - Intergenic
1096807304 12:54148651-54148673 TGTTGGGGAGGGAGAATGGGGGG - Intergenic
1096886760 12:54726295-54726317 TGTTGGGGAAGGGACTTGGTGGG - Intergenic
1097400251 12:59119626-59119648 TGTTGGAGGTGGAATCTGGTGGG - Intergenic
1097476201 12:60058729-60058751 TATTCAGGATGAAATTTGGGTGG - Intergenic
1098676221 12:73293266-73293288 TGTTGTGGAAGGAATGTGGTGGG + Intergenic
1100377983 12:94035079-94035101 TGTTGGGGGTGGGGTTGGGGAGG + Intergenic
1100795799 12:98180653-98180675 AGTAGGTGATGGAACTTGGGAGG - Intergenic
1100821928 12:98439676-98439698 TGGTGAGTCTGGAATTTGGGGGG - Intergenic
1100871402 12:98914078-98914100 TGTTGGAGGTGGAATCTGGTGGG + Intronic
1101418193 12:104526978-104527000 TGAGGAGAATGGAATTTGGGAGG - Intronic
1102184389 12:110936453-110936475 AATTGGAGATGAAATTTGGGTGG - Intergenic
1103033626 12:117638925-117638947 TGTTGGTCATGGAGTTTTGGGGG - Intronic
1103254563 12:119529761-119529783 TCTGTGGGAGGGAATTTGGGGGG + Intronic
1103259144 12:119570930-119570952 AGTTCGAGATGGGATTTGGGTGG + Intergenic
1103411133 12:120711779-120711801 ATTTGGGGATGGAAATTTGGGGG + Intronic
1104131381 12:125897584-125897606 GATTGGACATGGAATTTGGGTGG + Intergenic
1104746401 12:131213661-131213683 TTATGGGGATGAGATTTGGGTGG + Intergenic
1104939652 12:132389008-132389030 TGTTGGGGATGGAGTTGTGGGGG - Intergenic
1106249196 13:27971199-27971221 TGATGGGGTGGGAATGTGGGAGG + Intergenic
1106954008 13:34915633-34915655 TCTGGGGGATGGGATGTGGGAGG - Intergenic
1107082619 13:36391071-36391093 AGTTGGGGATGCTATATGGGTGG - Intergenic
1107173570 13:37373808-37373830 ATTTGGGGAGGGGATTTGGGAGG - Intergenic
1107985179 13:45769648-45769670 TGTTGGGGAAGGAAGGTGTGAGG + Intergenic
1108871951 13:54998831-54998853 TGTTGGGGATGAAATTTTAGGGG + Intergenic
1109863446 13:68230149-68230171 TGGTGGGGATGGGATTCAGGTGG - Intergenic
1111126426 13:83914589-83914611 GGTTGGGGATGAAATTAGAGGGG - Intergenic
1111778745 13:92694856-92694878 AGTAGGAGATGGAATTTGAGTGG - Intronic
1112742360 13:102489641-102489663 AGTTGGAGATGAGATTTGGGTGG - Intergenic
1112942605 13:104883476-104883498 TGTTGGAGAGGGAAGTGGGGAGG - Intergenic
1113167187 13:107454971-107454993 TGTTTGAGATGAAATGTGGGTGG - Intronic
1113808665 13:113124196-113124218 TATTGGGAATGGAAGTTGGCAGG + Intronic
1115177644 14:30582641-30582663 TATTGGGGATGGAGTTAAGGTGG + Intronic
1116625932 14:47263317-47263339 TTTTGGGGATGGAGGATGGGTGG - Intronic
1118452496 14:65916911-65916933 TGTTGGGGATGATGTTGGGGTGG + Intergenic
1119118605 14:72051582-72051604 TGTTGGGGATGGGGTGTGTGTGG + Intronic
1121695688 14:95909972-95909994 TGGTGGGACTGGAATGTGGGGGG + Intergenic
1122120120 14:99548585-99548607 TCCTGGGGAGGGCATTTGGGTGG - Intronic
1122386743 14:101353531-101353553 TGTTGGGGGTGGAGCTTGGTGGG + Intergenic
1125015351 15:34928342-34928364 TGTCGGGGATGGGAGTTGAGGGG - Intronic
1125524008 15:40364148-40364170 TGTTGGGGGTGGAGGTGGGGTGG - Intronic
1126024391 15:44432106-44432128 TGGTGGGGATAGAATTGTGGTGG + Intronic
1126993554 15:54412504-54412526 AGTTTGAGATGGGATTTGGGTGG + Intronic
1127902204 15:63349167-63349189 TGGTGGGGATGGGATGTGTGTGG + Intronic
1129476816 15:75791350-75791372 TGTAGGGGCTGGAACTTGGAGGG - Intergenic
1129923776 15:79343852-79343874 GTTTGGGGATGGAGTTTTGGTGG + Intronic
1132195546 15:99912202-99912224 GGCTGGGGATGGAATTTGTGAGG - Intergenic
1133103320 16:3492182-3492204 AATTGGAGATGAAATTTGGGTGG + Intergenic
1135640119 16:24112270-24112292 AGTGGGGGTTGCAATTTGGGAGG + Intronic
1135955928 16:26956153-26956175 TCCTGAGGATGGAATCTGGGTGG - Intergenic
1136861722 16:33708007-33708029 TGTTGGGTGTGGTATTGGGGGGG + Intergenic
1137799986 16:51254346-51254368 TGTTGGGGATGCACTTGAGGAGG + Intergenic
1138114671 16:54350930-54350952 TGTTGGAGATGGAACCTGGTGGG - Intergenic
1140017806 16:71205432-71205454 TGTTGGGGATGGGTTTCAGGGGG - Intronic
1140160300 16:72483990-72484012 TGTAGGGGAAGGAATTGGGATGG - Intergenic
1140261258 16:73382544-73382566 TGTGGGGAATGGATTGTGGGGGG + Intergenic
1141640624 16:85338987-85339009 TGTTGGGGCGGGTGTTTGGGTGG + Intergenic
1203123220 16_KI270728v1_random:1556191-1556213 TGTTGGGTGTGGTATTGGGGGGG + Intergenic
1142794987 17:2300671-2300693 TGTCGGGGAAAGAGTTTGGGAGG + Intronic
1143311294 17:5991669-5991691 TGTTGGTGGTAGAATTTGGTGGG + Intronic
1143574143 17:7780044-7780066 AGTTAGGGATGGAGTTAGGGTGG + Intronic
1143899033 17:10159545-10159567 TTTTGGTGATGGAGGTTGGGGGG - Intronic
1144466813 17:15503814-15503836 TGTTTGGGATAGAACTTCGGTGG - Intronic
1144711896 17:17406677-17406699 TGGGGGGGATGGAAGATGGGGGG - Intergenic
1145241192 17:21241829-21241851 TGCTGGAGAAGGAATGTGGGGGG + Exonic
1145269498 17:21397073-21397095 GCTTGGGGACTGAATTTGGGAGG + Intronic
1146487629 17:33256874-33256896 TGTTGGTTTTGGAATATGGGAGG + Intronic
1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG + Intronic
1148022041 17:44559668-44559690 TGTTGGGGAGTGTAGTTGGGGGG + Intergenic
1150997559 17:70336360-70336382 GGTTGGAGATGGAATTAAGGTGG - Intergenic
1153108738 18:1559499-1559521 AGTTGCGGATGGATTTTGTGTGG + Intergenic
1153283765 18:3438560-3438582 TGATGGGAATGGAAGATGGGGGG - Intronic
1154370419 18:13756421-13756443 TGTGGGGGGTGGGATTTGGCAGG + Intronic
1155392280 18:25350166-25350188 TGTTGGAGAGGGAAGTTGCGGGG - Intronic
1155551777 18:26972688-26972710 TGTTGGGAATGGACTCTGGGAGG + Intronic
1156170227 18:34474122-34474144 TCTTGGGGATGCATTTTGGGGGG - Intergenic
1156396369 18:36703660-36703682 AGTTGGTGTTGGGATTTGGGAGG + Intronic
1157353701 18:46914561-46914583 TGTCGGGGGTGGAGTTGGGGGGG - Intronic
1157470243 18:47982985-47983007 AGTTGGAGATGAGATTTGGGTGG + Intergenic
1157692731 18:49697232-49697254 TGGTAGGGATGGAGTGTGGGTGG - Intergenic
1157698870 18:49746733-49746755 CGTTGGGGATGGGACTTGGTGGG + Intergenic
1158583184 18:58703729-58703751 AGTTCGAGATGAAATTTGGGTGG + Intronic
1159089580 18:63832780-63832802 TTTTGGGGATGGAATTTATTGGG - Intergenic
1159658531 18:71062556-71062578 TGTTGGGGGTGGGTTTTGAGGGG - Intergenic
1159690355 18:71479425-71479447 TGTTGGGGGTGGAGATTGAGGGG + Intergenic
1160365197 18:78318810-78318832 TGATGATGAAGGAATTTGGGAGG + Intergenic
1160888294 19:1362726-1362748 CGTTGGTGATGGCGTTTGGGGGG + Intronic
1162450416 19:10750965-10750987 CTTTGGGGATGGAATGTTGGAGG + Intronic
1164523865 19:28999385-28999407 TGTTGGTGATGGAGCTTGGTGGG - Intergenic
1165739678 19:38197864-38197886 TGTTTGGGGGGGGATTTGGGGGG - Intronic
1165782892 19:38444122-38444144 GGGTGGGGATGGAATGGGGGTGG - Intronic
1165920286 19:39293210-39293232 TTTGGGGGCTGGAATTAGGGTGG - Intergenic
1166329824 19:42071293-42071315 GGTGGGGGGTGAAATTTGGGGGG + Intronic
1166950159 19:46421931-46421953 TGATGGGGCAGGAAGTTGGGGGG - Intergenic
1166965362 19:46526663-46526685 GGGTGGGGATGAGATTTGGGTGG + Intronic
925417124 2:3678165-3678187 TGTTGGGAATTGCATTTGTGCGG + Intronic
925688551 2:6496477-6496499 TGTTGGCGATGGTGTCTGGGTGG + Intergenic
926339932 2:11896547-11896569 TGTTGCTGATGGAATGTTGGAGG - Intergenic
926587161 2:14699427-14699449 GACTGGGGATTGAATTTGGGAGG - Intergenic
926631900 2:15144153-15144175 TGTTGGGGAGGGACCGTGGGTGG - Intergenic
926876609 2:17487227-17487249 AGTTCGAGATGAAATTTGGGTGG + Intergenic
927692102 2:25215745-25215767 TGGTGGGGATGGGACTCGGGTGG - Intergenic
929371263 2:41226357-41226379 TGTTGGGGATGGGAGATGTGGGG + Intergenic
929978470 2:46657021-46657043 TGTAGGGGCTGGGGTTTGGGAGG - Intergenic
930893035 2:56413036-56413058 TGTTGGGGATTGATTTAGAGAGG + Intergenic
932189209 2:69724862-69724884 TCCTGAGGATGGAATTTGAGAGG + Intronic
932400329 2:71476088-71476110 TGTTGTACATGGAACTTGGGGGG + Intronic
933142890 2:78815635-78815657 TGTTAATGATGGAATTGGGGAGG + Intergenic
935528007 2:104196611-104196633 ATTTGGGGAAGGAATTTGGTAGG - Intergenic
936756571 2:115720898-115720920 TGGTAAGGCTGGAATTTGGGTGG + Intronic
937216663 2:120317471-120317493 TGTTGGGGAAGGAAGTGGGAGGG + Intergenic
937334512 2:121053774-121053796 TGTTGGAGATGGAACCTGGTGGG + Intergenic
938697193 2:133844991-133845013 GATTGGGGTTGGAATATGGGTGG - Intergenic
939949686 2:148455278-148455300 GTTTGGGGATGGAGTATGGGAGG - Intronic
942640736 2:178058327-178058349 TGTTGTGGAAGGAATCTGGTGGG + Intronic
944700488 2:202241422-202241444 TGTTGGGGGAGGGACTTGGGAGG + Intergenic
945687138 2:212985431-212985453 TGTAGGGAATGGAATTAGTGTGG - Intergenic
947024365 2:225720239-225720261 TGTTGGGGGTGTGTTTTGGGGGG - Intergenic
947100684 2:226618149-226618171 TGCTGGGGATGGAAGCTGGTTGG - Intergenic
948486952 2:238287545-238287567 TGGGTGGGCTGGAATTTGGGAGG - Intronic
1169919258 20:10716954-10716976 TCTTGGTGATGGAAATTGTGAGG + Intergenic
1171341346 20:24431613-24431635 GGCTGTGGAGGGAATTTGGGAGG - Intergenic
1172182866 20:33014222-33014244 CTTTGGGGAGGGATTTTGGGTGG + Intronic
1172869233 20:38125575-38125597 TGTTGGGGAGGGAGGTGGGGAGG + Intronic
1173093172 20:39995792-39995814 TGTAGGGGAGGGAAACTGGGGGG - Intergenic
1173662330 20:44743320-44743342 AATTGGAGATGCAATTTGGGTGG - Intergenic
1174068896 20:47886216-47886238 TGGTGGGGATGGAGGTTTGGTGG + Intergenic
1174685711 20:52453040-52453062 AATTGGAGATGAAATTTGGGTGG - Intergenic
1175790365 20:61736811-61736833 TGTTGTGGATGGAGTTTCTGTGG - Intronic
1177334001 21:19700095-19700117 CATTTGAGATGGAATTTGGGTGG + Intergenic
1178002899 21:28183258-28183280 TGTTAGAGATGAGATTTGGGTGG - Intergenic
1178355977 21:31911044-31911066 CATTGGGGCTGGAATTTTGGGGG + Intronic
1178801277 21:35798059-35798081 GGTTGGTGTTGAAATTTGGGTGG + Intronic
1178945137 21:36940786-36940808 AGTTCGAGATGAAATTTGGGTGG - Intronic
1180002673 21:45002247-45002269 GGTTGGGGATGGAGCTAGGGAGG + Intergenic
1181593602 22:23899133-23899155 TGTTTGGGAAGGAGTTAGGGAGG - Intergenic
1181714985 22:24718935-24718957 TGCTGGGGTGGGAATTTGGATGG - Intergenic
1182271987 22:29159779-29159801 TGTTGAGGATGGCAGATGGGTGG + Intronic
1182363946 22:29765519-29765541 GATTTGGGATGTAATTTGGGAGG - Intronic
1182684803 22:32113749-32113771 TGGTGGGGATGGGATTAGGGAGG - Intergenic
1184453829 22:44598088-44598110 AGGTGGAGATGGAATGTGGGAGG - Intergenic
950250411 3:11460694-11460716 TGACTGGGATGAAATTTGGGAGG - Intronic
951207645 3:19941519-19941541 TGTTGAGGATGGAATCTTTGAGG - Intronic
951821559 3:26819630-26819652 TGTAGGGTTGGGAATTTGGGTGG - Intergenic
951889717 3:27556985-27557007 TGTTGGAAAAGAAATTTGGGTGG - Intergenic
952524160 3:34192555-34192577 TGTGGAGGATGGCATTTGGGAGG - Intergenic
952821706 3:37491624-37491646 TGTTGGGGATGTTGTTTGTGGGG + Intronic
953144842 3:40265515-40265537 TGATGGGAATGGGATGTGGGTGG - Intergenic
953154839 3:40360319-40360341 TGTTGGGGATGGAAGAGGGAGGG + Intergenic
953665097 3:44920041-44920063 TTTTGGGGATGGAATTCTAGAGG + Intronic
953874940 3:46661318-46661340 TGTTGGGGGTGGAGTGGGGGAGG - Intergenic
954315645 3:49799928-49799950 GGGTGGGGATAGAATCTGGGAGG - Intergenic
955189105 3:56743856-56743878 TGATAGGGATGCAAGTTGGGAGG - Intronic
955833119 3:63025913-63025935 AATTGGAGATGAAATTTGGGTGG + Intergenic
956714629 3:72067774-72067796 AGTCGGGGATGGAAATTAGGAGG - Intergenic
958553455 3:95644690-95644712 TGTTGGGGAAGGAATCTGGTGGG - Intergenic
959864366 3:111249338-111249360 GGATGGGGATGGAATTTGACTGG - Intronic
959910849 3:111762045-111762067 TGTGGCGGATGGGATTGGGGGGG - Intronic
961061240 3:123831080-123831102 TGTTGGGGATGGAACACAGGTGG - Intronic
962319629 3:134379518-134379540 TCTTTGGAATGGAATTTGGTGGG - Intergenic
963570178 3:146983835-146983857 TGATGGAGATGGCAATTGGGAGG - Intergenic
964036752 3:152208443-152208465 TATTGGAGATGAGATTTGGGTGG - Intergenic
964168777 3:153741731-153741753 TGTGGGGGATGGATATTGGGAGG - Intergenic
964638834 3:158886480-158886502 TGTTGGTGATGGAGTCTGGTGGG + Intergenic
964727767 3:159832547-159832569 TGTTAGGGGTGGAAGCTGGGTGG - Intronic
965227139 3:166004199-166004221 TGTAGGGGATGAAGTTTGGTTGG + Intergenic
965337549 3:167445990-167446012 CATTGGGGATGGAAATTGAGAGG - Intronic
966740364 3:183227242-183227264 TGGTGGGGATTGATGTTGGGTGG + Intronic
968523787 4:1046217-1046239 TGTTGGGGAAGGGCTCTGGGAGG - Intergenic
970062605 4:12051511-12051533 TGTTGGAGATGGCATCTGGTGGG + Intergenic
970276192 4:14403791-14403813 TGTTGGGGAAGGAACCTGGTGGG - Intergenic
970314970 4:14820418-14820440 TGTTGGGGTTGGCTTTTGGATGG + Intergenic
970406136 4:15766153-15766175 AGTTGGGGATGGAGGTAGGGTGG + Intergenic
970554995 4:17222301-17222323 TTTTGGGGATGTATTTTGGAAGG + Intergenic
970631985 4:17957154-17957176 TGATGGGAATAGTATTTGGGAGG + Intronic
970673831 4:18425681-18425703 TGTTGGCAATGAGATTTGGGAGG - Intergenic
970813070 4:20118518-20118540 TGTTGGGAGTGGAGTCTGGGAGG - Intergenic
971029546 4:22621530-22621552 TGTTGGGAATGGACTCTGGGAGG + Intergenic
971945544 4:33271504-33271526 TGTTGGGGAAGGGATCTGGTGGG - Intergenic
972041456 4:34605912-34605934 TGGTGGAGATGAGATTTGGGTGG + Intergenic
972161800 4:36236259-36236281 TAATGGGGAGGGAGTTTGGGAGG - Intronic
972353122 4:38255842-38255864 TGTGTGGGAAGGAATTAGGGAGG + Intergenic
973046959 4:45546008-45546030 GGTTGAGGATGGAAGTTAGGAGG + Intergenic
973550648 4:52032301-52032323 TGTTGGGGAGGGGATGTTGGTGG - Intronic
973747530 4:53978381-53978403 TTTTGGGAATGGGATTGGGGTGG + Intronic
973859929 4:55053197-55053219 TGTTGGGGGAGGGATCTGGGAGG - Intergenic
974969851 4:68809686-68809708 CCTTGGGGTTGGATTTTGGGTGG - Intergenic
975184912 4:71390059-71390081 TGTGGGGGATGGAAGTGGGTTGG + Intronic
975448208 4:74492823-74492845 TGTTGGAGATGGGATCTGGTGGG + Intergenic
975588019 4:75970646-75970668 AGTTCGAGATGAAATTTGGGTGG - Intronic
976576241 4:86675191-86675213 TGTTGGGGATGAAATGGGTGTGG + Intronic
978688480 4:111478707-111478729 AGTTTGAGATGAAATTTGGGTGG + Intergenic
980031109 4:127831786-127831808 TGTAGGAGATGGAATTTCAGGGG + Intronic
981177026 4:141693329-141693351 AGTTCGAGATGAAATTTGGGTGG + Intronic
981486431 4:145291463-145291485 AGTTTGAGATGAAATTTGGGTGG - Intergenic
981738400 4:147977008-147977030 TGTTAGGGATGGGATTGAGGTGG + Intronic
982211263 4:153038664-153038686 TCCTGGAGATGGAACTTGGGTGG - Intergenic
985202842 4:187502253-187502275 AAGTGGGGATGGAATTTAGGAGG - Intergenic
986318211 5:6605486-6605508 TTTTGGGGATTGAATTCTGGAGG - Intronic
986360839 5:6976282-6976304 TGTTGGAGGTGGAACTTGGTGGG + Intergenic
989007773 5:36834285-36834307 TGTTGATGGTGGGATTTGGGAGG - Intergenic
989272542 5:39550027-39550049 GGTTGGGGATGGACTATGGAGGG - Intergenic
989507864 5:42248108-42248130 TGTTGGGGAAGGGACTTGGTAGG - Intergenic
991442319 5:66663851-66663873 TGTTGAGGATAGATTGTGGGAGG + Intronic
992751493 5:79866963-79866985 TGGTTGTGATGGTATTTGGGGGG + Intergenic
993903667 5:93601238-93601260 TGTGGGGGGTGGAATTATGGAGG + Intergenic
993945753 5:94115540-94115562 TGTCATGGATGGATTTTGGGAGG - Intergenic
994529762 5:100954599-100954621 AGTTCGAGATGAAATTTGGGTGG - Intergenic
994558463 5:101334613-101334635 TCTTGAGGGTGGAATGTGGGAGG + Intergenic
994992910 5:107020051-107020073 TGTTGGAGGTGCAGTTTGGGTGG - Intergenic
997816382 5:137022788-137022810 TGTTAGGGCTGGTATTTGGGTGG + Intronic
997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG + Intronic
998979854 5:147690209-147690231 TGTTAGGCATGGTGTTTGGGAGG + Intronic
999321842 5:150619988-150620010 TGTAGGAGACTGAATTTGGGCGG - Intronic
999380724 5:151119232-151119254 GGCTGGGGTTGGAAGTTGGGGGG + Intronic
999657061 5:153820901-153820923 TCTTGGATAAGGAATTTGGGGGG - Intergenic
1000907077 5:166976685-166976707 TGCTGGGGATGGCATTATGGGGG - Intergenic
1001310665 5:170607922-170607944 TCTTGGAGAATGAATTTGGGGGG + Intronic
1001323386 5:170701137-170701159 TGTGGGGTAGGGAAGTTGGGAGG - Intronic
1001599338 5:172918918-172918940 TGGTGGGGAGTGAATGTGGGTGG - Intronic
1003417645 6:5926872-5926894 TGTTGGGGAGGGATTTTTTGGGG + Intergenic
1006189111 6:32196742-32196764 TGTTGAGGGTGGGAGTTGGGGGG + Intronic
1008349579 6:50473984-50474006 TGTTGGGGTTGGGTTTCGGGTGG - Intergenic
1008831697 6:55771780-55771802 GGATGGGGATGGAGTTAGGGAGG - Intronic
1009504348 6:64456168-64456190 TGTTTGACATGGAATTTGAGTGG - Intronic
1010886575 6:81250556-81250578 AGTGAGGGATGGAAATTGGGAGG - Intergenic
1011294540 6:85811681-85811703 TGTTGAGGAAGGAATCTGGTGGG - Intergenic
1013632415 6:111998120-111998142 TGTTGGGGATGGGAATTTGTGGG + Intergenic
1015760601 6:136656078-136656100 TTTTTGCCATGGAATTTGGGTGG - Intronic
1015939700 6:138435567-138435589 TTTTGGGAATAGAATTTTGGTGG - Intronic
1016522430 6:144961788-144961810 TGTAGGGAGTGGAAGTTGGGCGG + Intergenic
1017447812 6:154524228-154524250 TGTTGGAGGTGGAACTTGGTGGG - Intergenic
1017724960 6:157270368-157270390 TGTTGGTGATGGTATTGTGGTGG - Intergenic
1019009289 6:168828845-168828867 TGTTGTTGATGGACTTAGGGTGG + Intergenic
1019383539 7:740660-740682 TCTTGGGGATGGCATCTAGGCGG + Intronic
1020458030 7:8396398-8396420 TGTTGGAGATGGGACTTGGTGGG + Intergenic
1020546729 7:9541779-9541801 TGTTGGAGATGGGATCTGGCAGG + Intergenic
1021940461 7:25673924-25673946 TGCTGGGGAAGGAAATTGAGAGG - Intergenic
1022251027 7:28608575-28608597 TGGTGGGGAGGGAGATTGGGAGG - Intronic
1022853066 7:34285256-34285278 GATTGGGGATGGAATGTGAGAGG + Intergenic
1023490159 7:40731102-40731124 TGGTTGGTAGGGAATTTGGGAGG + Intronic
1025258666 7:57402687-57402709 TGTTGGGTATAAAAATTGGGGGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026309730 7:69173224-69173246 TGTGGGGGATGGAAAGCGGGAGG - Intergenic
1026375544 7:69746829-69746851 TGTTGAGAATGGAGTTTGTGGGG + Intronic
1027650205 7:80857072-80857094 TATTGGTGATGAAATTTGTGAGG - Intronic
1027682909 7:81242374-81242396 TCTTGGGGTTGGAATATAGGGGG - Intergenic
1027989675 7:85341735-85341757 TGTGGGAGAATGAATTTGGGAGG + Intergenic
1030787286 7:113678035-113678057 CAATGGGAATGGAATTTGGGTGG - Intergenic
1031089951 7:117342475-117342497 TTGTGGGGGTGGAATTTTGGTGG - Intergenic
1032283884 7:130526864-130526886 GGTTTGGGATGGGGTTTGGGTGG + Intronic
1032284615 7:130531096-130531118 GGTTGGGGATGGGGTTTGGGTGG + Intronic
1032680158 7:134174163-134174185 GATTGGGGAAGGAAGTTGGGGGG + Intronic
1032759439 7:134925704-134925726 TGTTGAGGAAGGAATGTGGTGGG - Intronic
1034502933 7:151462722-151462744 TGTTGGGTATAAAAGTTGGGGGG - Intergenic
1035407647 7:158609966-158609988 TGTTGGGGAGGGAGTGAGGGGGG + Intergenic
1036637573 8:10562438-10562460 TGTTGGAGATGGAATCAGAGGGG - Intergenic
1038848509 8:31251905-31251927 AATTGGGGATGAGATTTGGGTGG + Intergenic
1040102601 8:43518838-43518860 AGTGGGGGTTGGAAGTTGGGAGG + Intergenic
1040572503 8:48623241-48623263 TGTTAGGGATGCCATTTTGGGGG + Intergenic
1041339210 8:56823700-56823722 TGTTGTGGAAGGAACTTGGTGGG + Intergenic
1041670843 8:60490288-60490310 TGTTGGGGAGGGAACCTGGTGGG - Intergenic
1042391152 8:68236388-68236410 TGTTGGGGCTGGTATATGTGTGG + Exonic
1045894183 8:107194432-107194454 AGTTGGAGATGAGATTTGGGTGG + Intergenic
1046018399 8:108634234-108634256 TTTTGGGGATGGAGGTGGGGAGG - Intronic
1046985376 8:120381994-120382016 TGTAGGAGATGGAATTAGAGAGG + Intronic
1047010087 8:120663021-120663043 TGGTGGGGGGGGTATTTGGGTGG + Intronic
1047597756 8:126395739-126395761 TGTTGGGGGTGGGGTGTGGGTGG - Intergenic
1048034817 8:130667509-130667531 TGTCAGGGCTGGAATTTAGGGGG - Intergenic
1048495625 8:134933456-134933478 AGTTGGGGCTGGAACTTTGGGGG + Intergenic
1049543307 8:143218248-143218270 TGTTGGGGGTGGTGTTGGGGTGG - Intergenic
1049543321 8:143218282-143218304 TGTTGGGGGTGGTGTTGGGGTGG - Intergenic
1050804923 9:9663538-9663560 TGATAGGGATGGAATTTGTTAGG - Intronic
1050928919 9:11300420-11300442 TCTGGGAGATGAAATTTGGGTGG + Intergenic
1051262220 9:15275676-15275698 TGGTGGGGAAGGAATTAGGCAGG + Intronic
1052462174 9:28779329-28779351 GGTGGGAGATGGAATTTGAGAGG - Intergenic
1053065711 9:35067492-35067514 TGTTGGGGTTGGAATGAGGTGGG - Intronic
1053175414 9:35918861-35918883 TGTTGGGTCTGGAGTATGGGTGG + Intergenic
1053273251 9:36764849-36764871 TGTGAGGGAAGGAATTTCGGAGG + Intergenic
1054713013 9:68530199-68530221 TGTTGGGGATGGGATGGGGGAGG - Exonic
1056111069 9:83395478-83395500 TGTTGGGGGTGGAGAGTGGGAGG - Intronic
1057797546 9:98169500-98169522 AGTTGGGGGTGGAATATGCGAGG - Intronic
1059458791 9:114416412-114416434 TGTTGGGGGAGGAATCTGGTGGG + Intronic
1059461975 9:114437494-114437516 GGTTAGGGTAGGAATTTGGGGGG - Intronic
1060205892 9:121682663-121682685 TGTGGGGGATGGACTTTGTAAGG + Intronic
1060295569 9:122340786-122340808 TGGTGGGGATGGAGGTGGGGTGG + Intergenic
1061414883 9:130442222-130442244 TGTTGGGGAGGAAATGTTGGAGG + Intergenic
1061830793 9:133293083-133293105 TGTTGGGGATCTGATTTGGAAGG - Intergenic
1203655890 Un_KI270752v1:24299-24321 TGTTGAGGATGTTATTTGAGAGG + Intergenic
1185565844 X:1094719-1094741 TGTTGGGGATGGATTCTGGGAGG - Intergenic
1186528294 X:10269735-10269757 AATTGGGGATGGATTTGGGGAGG + Intergenic
1186877570 X:13831325-13831347 TGGTTGGGATGGGAATTGGGAGG + Intronic
1187034011 X:15518670-15518692 TTTTGGGGAGGGATTTTGGGGGG + Intronic
1187441529 X:19325053-19325075 TGTTGGGGGTGTAAACTGGGAGG + Intergenic
1187948959 X:24453233-24453255 TGTTGGAGATGGGATCTGGTGGG - Intergenic
1188512982 X:30957007-30957029 TTTTGGAGATGGAAATTGTGTGG - Intronic
1189456347 X:41194107-41194129 TTTTGGAGGTAGAATTTGGGGGG - Intronic
1191800816 X:65077335-65077357 GGTTTGGAATGGAAATTGGGTGG + Intergenic
1192180768 X:68914370-68914392 GGTTGGGGTTGGAATGTGTGTGG - Intergenic
1192237241 X:69303712-69303734 TGGTGGGTGTGGAATATGGGTGG - Intergenic
1193593630 X:83419884-83419906 TGTTGGGGGTGGGAATGGGGTGG - Intergenic
1193975274 X:88110750-88110772 TGTTGGGGAGGGAAAGGGGGAGG - Intergenic
1194026586 X:88760233-88760255 TGTGGGGGCTGGAGTTGGGGTGG - Intergenic
1195139757 X:101947628-101947650 GTTTGGGCATGGAATTTTGGGGG - Intergenic
1195176062 X:102316566-102316588 ATTTGGGGATTGGATTTGGGAGG + Intronic
1195182802 X:102370527-102370549 ATTTGGGGATTGGATTTGGGAGG - Intronic
1195217205 X:102713342-102713364 AGGTGGGGATGGAAGGTGGGGGG - Intronic
1195884385 X:109624511-109624533 AGTTGGGGGTGGAAGGTGGGAGG + Exonic
1197158473 X:123296427-123296449 GGTTGGGGTGGGAATTGGGGAGG - Intronic
1198806729 X:140501646-140501668 AGTGGGGGATGGAATGCGGGGGG + Intergenic
1199415500 X:147577870-147577892 GGTTGGGGAGGGAATCAGGGTGG + Intergenic
1199758101 X:150883486-150883508 CTCTGGGGGTGGAATTTGGGAGG - Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic