ID: 1146705199

View in Genome Browser
Species Human (GRCh38)
Location 17:34996102-34996124
Sequence TGGGGGCCACAGCATGATCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146705195_1146705199 -9 Left 1146705195 17:34996088-34996110 CCCCAGGCTTTTCCTGGGGGCCA 0: 1
1: 0
2: 2
3: 32
4: 264
Right 1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 266
1146705188_1146705199 11 Left 1146705188 17:34996068-34996090 CCCACTTTAAGGACTACATTCCC 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 266
1146705186_1146705199 29 Left 1146705186 17:34996050-34996072 CCTTCTGCTTTCAGGTGGCCCAC 0: 1
1: 0
2: 0
3: 25
4: 217
Right 1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 266
1146705189_1146705199 10 Left 1146705189 17:34996069-34996091 CCACTTTAAGGACTACATTCCCC 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 266
1146705185_1146705199 30 Left 1146705185 17:34996049-34996071 CCCTTCTGCTTTCAGGTGGCCCA 0: 1
1: 0
2: 3
3: 13
4: 192
Right 1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 266
1146705196_1146705199 -10 Left 1146705196 17:34996089-34996111 CCCAGGCTTTTCCTGGGGGCCAC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG 0: 1
1: 0
2: 2
3: 25
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146705199 Original CRISPR TGGGGGCCACAGCATGATCT TGG Exonic
900333981 1:2151873-2151895 TGGAGGGCAGAGCATGATCACGG + Intronic
901187013 1:7380521-7380543 GGAGTGCAACAGCATGATCTCGG - Intronic
902066594 1:13693347-13693369 TGGGCGACACAGCAGGATGTGGG - Intergenic
903068503 1:20714886-20714908 TGGTGGCCACAGCAACATGTAGG - Intronic
904169758 1:28583299-28583321 CGGGAGCAACAGCAGGATCTGGG - Intergenic
905498858 1:38419834-38419856 TGTGGGCCAAAGAATGAGCTTGG - Intergenic
907335606 1:53697471-53697493 TGGGGGCCACTGTCTGTTCTGGG + Intronic
909495032 1:76268912-76268934 TGGGGGTGACAGAGTGATCTGGG - Intronic
909859531 1:80587567-80587589 TGGGGGCCAGAGGTTGAACTTGG - Intergenic
911838720 1:102654933-102654955 TGAGGGCCACACCAACATCTTGG - Intergenic
912159148 1:106959866-106959888 TGGGTTCCACAGGATGATATAGG - Intergenic
915188735 1:154130321-154130343 AGAGTGCAACAGCATGATCTTGG + Intronic
915764304 1:158348111-158348133 TTCCGGACACAGCATGATCTTGG - Intergenic
918345420 1:183603554-183603576 CGAGTGCAACAGCATGATCTCGG + Intergenic
919113545 1:193251451-193251473 TGGGAGCCAGAGTATGATTTGGG + Exonic
920351245 1:205339411-205339433 TGGGGGCCAGAGCAGGATAGAGG + Intronic
920809088 1:209265224-209265246 TGGGGGCCAGGGGATGAACTAGG + Intergenic
921096128 1:211888881-211888903 TGGGGCCCACATTTTGATCTTGG - Intergenic
921130473 1:212215457-212215479 TGAGTGCCATGGCATGATCTTGG + Intergenic
921798108 1:219371262-219371284 TGGGGACCAGAACATGATGTAGG - Intergenic
922331734 1:224582946-224582968 TGGGGCACACAGCATGTGCTGGG + Intronic
923387422 1:233478922-233478944 TGGGAGCCATAGAATGTTCTGGG + Intergenic
1063027520 10:2195734-2195756 TGGAGAAGACAGCATGATCTTGG + Intergenic
1063087623 10:2833779-2833801 TGTGGGCCACTGCATGTCCTGGG + Intergenic
1063678731 10:8165497-8165519 TGGGTGCAACAGCACGACCTCGG + Intergenic
1071080589 10:81805466-81805488 GGAGGGCAGCAGCATGATCTCGG + Intergenic
1072717429 10:97761043-97761065 TGGGGGCTGCAGCCTGGTCTGGG + Intergenic
1076702248 10:132279913-132279935 TGGAGGCCTCAGCGTGATCACGG - Intronic
1076702368 10:132280519-132280541 TGGAGGCCTCAGCGTGATCACGG - Intronic
1078663936 11:13309142-13309164 TTGGGGCCCCATCATGAACTTGG + Intronic
1079013786 11:16851497-16851519 TGGAGTCAAGAGCATGATCTCGG + Intronic
1079259004 11:18859737-18859759 GGAGGGCAGCAGCATGATCTCGG - Intergenic
1079941885 11:26690754-26690776 TGTTGGCCATGGCATGATCTTGG - Intronic
1080623537 11:34007871-34007893 TGGGTGCAATGGCATGATCTCGG + Intergenic
1081688674 11:45060146-45060168 TGGGCGACAAAGCAAGATCTTGG + Intergenic
1082066105 11:47901618-47901640 GGAGTGCAACAGCATGATCTCGG - Intergenic
1084156891 11:67318111-67318133 CGCGGGCCACAGCCAGATCTCGG - Intronic
1084350836 11:68597927-68597949 TGGAGTGCACAGCATGATCTTGG - Intronic
1084391282 11:68878805-68878827 GGAGGGCCATGGCATGATCTTGG - Intergenic
1084592744 11:70099919-70099941 CGAGGGCCACAGAAGGATCTGGG + Intronic
1084641801 11:70430662-70430684 TAGGGGCCAAAGGATGAACTGGG - Intronic
1084969327 11:72761692-72761714 TGGAGCACACAGCATGATCTCGG - Intronic
1085097095 11:73770059-73770081 GGAGGGCAACGGCATGATCTTGG - Intergenic
1087484698 11:98746997-98747019 GGAGGGCAGCAGCATGATCTTGG + Intergenic
1088201121 11:107336168-107336190 TGGGTGACAGAGCCTGATCTTGG - Intronic
1089326969 11:117664029-117664051 TGGGAGCCACGGCATTTTCTGGG - Intronic
1090305678 11:125688971-125688993 TGGAGGCCCCCGCATGGTCTGGG - Intergenic
1093524802 12:20093588-20093610 TGCGGGCCAGAGCAAGTTCTGGG - Intergenic
1093616744 12:21234229-21234251 AGGGGGCCACAGGATGAGATAGG + Intronic
1093873956 12:24327464-24327486 GGAGTGCAACAGCATGATCTCGG + Intergenic
1095654157 12:44649525-44649547 TGGGGACCACTGCAGGATGTGGG - Intronic
1095694597 12:45130139-45130161 GGAGTGCAACAGCATGATCTTGG - Intergenic
1096483876 12:51963293-51963315 GGAGTGCCATAGCATGATCTCGG + Intronic
1096859710 12:54516494-54516516 TGGGTGCAATGGCATGATCTCGG + Intronic
1097867859 12:64574258-64574280 GGAGTGCAACAGCATGATCTTGG - Intergenic
1098077944 12:66753420-66753442 TGCGTGCCACAGAATGATTTGGG - Intronic
1099147622 12:79066515-79066537 TGGAGGCCATATCATCATCTGGG + Intronic
1101963398 12:109266107-109266129 TGGGGACCACAGCAGGGACTCGG + Intronic
1103660970 12:122516741-122516763 GGAGTGCAACAGCATGATCTTGG + Intronic
1103804941 12:123565100-123565122 TGGGGCCCCCAGCATGCTCTGGG - Intergenic
1104954106 12:132455344-132455366 TGGGGACCACAGAAAGGTCTAGG + Intergenic
1105962047 13:25350982-25351004 GGAGTGCAACAGCATGATCTCGG + Intergenic
1109262693 13:60163390-60163412 TGGGGGCAACACAAAGATCTGGG + Intronic
1110555151 13:76851556-76851578 TGGGGGCCATATCATGGTTTAGG + Intergenic
1112633549 13:101188733-101188755 GGGGTACAACAGCATGATCTCGG + Intronic
1114769055 14:25408172-25408194 TTGGGGCCACTGCAGGATGTTGG + Intergenic
1114919508 14:27309072-27309094 TGGAGGCCACAGTATTACCTTGG - Intergenic
1115153781 14:30315256-30315278 TGGGCCCCACAGCAGCATCTGGG - Intergenic
1115542422 14:34433910-34433932 GGAGTGCAACAGCATGATCTCGG - Exonic
1117540699 14:56744023-56744045 TGGGGCCCACTGCATGCTCTTGG + Intergenic
1118754374 14:68828305-68828327 TGGAGTGCACAGCATGATCATGG - Intergenic
1124432890 15:29622254-29622276 TGGGGGCAATGGCATGATCTCGG + Intergenic
1127797399 15:62450486-62450508 TGGGGGCCACTTAATGATGTAGG - Intronic
1129521668 15:76190197-76190219 GGGGGGCCACCGTGTGATCTGGG + Intronic
1132740221 16:1408398-1408420 TGTGGGCATCAGCGTGATCTCGG - Intronic
1133131738 16:3680392-3680414 TGGGGGCCACATCTTGATGGTGG - Intronic
1133262907 16:4563617-4563639 GGTGGGCAGCAGCATGATCTTGG + Intronic
1133842527 16:9422913-9422935 TGGCTGCCACAGCATGAGCTCGG - Intergenic
1134384290 16:13757562-13757584 GGAGTGCAACAGCATGATCTCGG + Intergenic
1134403444 16:13933655-13933677 TGGAGGCAATGGCATGATCTCGG - Intronic
1135187811 16:20330193-20330215 TGGGTGCAATGGCATGATCTTGG + Intergenic
1135666574 16:24340671-24340693 TGGTGGCCACAGCTTCATCCTGG - Intronic
1136187440 16:28596507-28596529 TGGGGGCCAGAGCCTGATGTGGG + Intronic
1136319047 16:29470723-29470745 TGGGGGCCAGAGCCTGGTGTGGG - Intergenic
1136433618 16:30210067-30210089 TGGGGGCCAGAGCCTGGTGTGGG - Intergenic
1137429331 16:48405721-48405743 TGGGGGCCAGACCATGGCCTGGG + Intronic
1137698673 16:50479713-50479735 TGGTGGCCACAGCATAGCCTTGG - Intergenic
1137714117 16:50587468-50587490 TGGGGGGAAAAGCATTATCTAGG + Intronic
1137921920 16:52498478-52498500 TGGGAGCCCCCGCATGATCCTGG + Intronic
1140486858 16:75300336-75300358 GGAGTGCAACAGCATGATCTTGG + Intronic
1140644236 16:77012118-77012140 GGAGTGCCACGGCATGATCTTGG - Intergenic
1141431165 16:83970760-83970782 TGGGGGCCACCGCAGAAGCTGGG + Intronic
1143297063 17:5879136-5879158 GGAGGGCAACAGCACGATCTCGG + Intronic
1143781393 17:9231397-9231419 TGGGGGCCACAGCAGGGTGGGGG - Intronic
1144307039 17:13978175-13978197 TGGGGGCCCCAGCATAGTCTTGG + Intergenic
1146369300 17:32255105-32255127 TGGGGGCAACAGCATGATTCAGG + Intergenic
1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG + Exonic
1146721610 17:35127949-35127971 GGGGAGCCACAGCATCCTCTGGG - Intronic
1146885675 17:36469267-36469289 TGGGCTCCACAGCAGCATCTAGG + Intergenic
1146954368 17:36928585-36928607 TGGGGGCCACACCAAGAACAGGG - Intergenic
1147515585 17:41114584-41114606 TGGGCCCCACAGCAGCATCTAGG - Intergenic
1147925290 17:43942015-43942037 TGGGGGACACAGAATGAACTCGG + Intronic
1148622272 17:49043606-49043628 AGGGGGACTCAGCATGCTCTGGG + Intronic
1149237326 17:54607497-54607519 TGGGCCCCACAGCAGCATCTCGG - Intergenic
1150454762 17:65298385-65298407 TGGGGGCCACAGCATGTCATGGG - Intergenic
1151460712 17:74252578-74252600 TGGGGCCCAGAGCAAGAGCTGGG + Intronic
1151667622 17:75554567-75554589 TGGGTGCTACGGCATGATTTCGG - Intronic
1152570286 17:81118701-81118723 AGGAGGCCACTGCATGACCTTGG - Intronic
1152822299 17:82443574-82443596 TTTGGGCCACAGCAAGACCTCGG - Exonic
1152872540 17:82764592-82764614 GGAGTGCAACAGCATGATCTCGG - Intronic
1153263061 18:3242557-3242579 TGAGGGCAGCGGCATGATCTCGG + Intergenic
1153654114 18:7266893-7266915 TGGGGAACACAGGCTGATCTTGG - Intergenic
1153691536 18:7599612-7599634 TGGGGTTCACAGGATCATCTGGG + Intronic
1153877673 18:9389420-9389442 AGGAGGCTACATCATGATCTTGG + Intronic
1154177154 18:12093149-12093171 TGAGGGCCAAAGCAGGATCAGGG + Intergenic
1155148501 18:23103926-23103948 GGGGGGCAATAGCGTGATCTCGG + Intergenic
1155549671 18:26951886-26951908 TGGGAGCCAGAGGAAGATCTTGG + Intronic
1157401308 18:47390783-47390805 TGGGGGCCACTGTGTGATTTAGG + Intergenic
1158714531 18:59866342-59866364 TGGAGGGCAGCGCATGATCTTGG + Intergenic
1159087393 18:63809417-63809439 TGGGTGCAACAGCATGATCCAGG + Intergenic
1160409290 18:78664203-78664225 TGGGGGCCACACCCTGCTATGGG - Intergenic
1162668677 19:12237165-12237187 TGGGGGCCACGGGAGGATCATGG - Intronic
1163534482 19:17869308-17869330 CTGGGGACACAGCATGATCCAGG - Intergenic
1165258729 19:34596004-34596026 TGGGTGGCACAGCCTAATCTAGG - Exonic
1166034420 19:40157120-40157142 GGAGTGCAACAGCATGATCTTGG - Intergenic
1168078691 19:53993810-53993832 TGGGGGTCATAGAATCATCTGGG - Intronic
925328225 2:3039186-3039208 TGGGGGGCACAGTTTGATTTAGG - Intergenic
925919718 2:8630671-8630693 TGGTGGTCACCGCAGGATCTTGG + Intergenic
926013293 2:9425134-9425156 TGGGGGGCCCAGGATGTTCTAGG + Intronic
926704003 2:15823652-15823674 CCTGGGCCTCAGCATGATCTTGG - Intergenic
926854941 2:17245158-17245180 TGGGGGCAGTGGCATGATCTCGG - Intergenic
927014524 2:18944194-18944216 AGAGTGCCACGGCATGATCTCGG - Intergenic
927258187 2:21059200-21059222 AGGGTGCCACAGCTAGATCTGGG - Intergenic
927558594 2:24052920-24052942 GGAGTGCAACAGCATGATCTCGG - Intronic
928124822 2:28608014-28608036 TGGGGGTCTCTGCCTGATCTGGG - Intronic
928879905 2:36086512-36086534 TGGGTGTCACAGCATGGGCTGGG + Intergenic
929968805 2:46555388-46555410 TGGGGGCCCCAGTAGGAACTAGG + Intronic
930292198 2:49509257-49509279 GGAGTGCCACAGCGTGATCTTGG + Intergenic
930795555 2:55386520-55386542 GGAGTGCAACAGCATGATCTCGG + Intronic
931830038 2:66041086-66041108 GGAGTGCAACAGCATGATCTCGG - Intergenic
932736026 2:74255341-74255363 GGGGTGCAATAGCATGATCTCGG + Intronic
933767839 2:85722552-85722574 GGGGTGCAGCAGCATGATCTCGG - Intergenic
934564136 2:95329195-95329217 TGGGAGCCACAGCACTAACTAGG - Intronic
934684037 2:96307284-96307306 GGTGGGCCACAGCCTGATCATGG - Intergenic
935129906 2:100253914-100253936 GAGTGGCCACAGCTTGATCTGGG + Intergenic
936774615 2:115957745-115957767 GGAGTGCAACAGCATGATCTTGG - Intergenic
936915146 2:117632795-117632817 TGGGCGACAGAGCAAGATCTGGG - Intergenic
936948853 2:117956939-117956961 AGAGTGCAACAGCATGATCTCGG + Intronic
939626687 2:144485668-144485690 GGGGTGCAACGGCATGATCTCGG + Intronic
941813170 2:169774486-169774508 TGAGGGCCATAGAATGTTCTAGG + Intronic
946854125 2:223936110-223936132 GGAGGGCAGCAGCATGATCTTGG + Intronic
947618365 2:231573413-231573435 TGGGGGCGACTGCAGGACCTGGG - Intergenic
947837424 2:233185689-233185711 TCGGGGCCTCAGCATCATTTAGG - Intronic
948254345 2:236555047-236555069 TGGATGCCTCAGCATGAGCTTGG - Intergenic
948965309 2:241374995-241375017 GGAGTGCCACGGCATGATCTCGG + Intronic
1168852526 20:986317-986339 TGGAGGCCACAGCAGCATCAGGG + Intronic
1168985930 20:2049217-2049239 TGATGGCCACTGCATGCTCTAGG - Intergenic
1169020421 20:2326796-2326818 GGAGTGCCACGGCATGATCTCGG - Intronic
1170193642 20:13668674-13668696 TGGGTGCAATGGCATGATCTCGG + Intergenic
1170417091 20:16156326-16156348 GGGGGGCAATGGCATGATCTTGG + Intergenic
1170737149 20:19022122-19022144 TGGAGGCCACAGCAGGTGCTGGG - Intergenic
1170954417 20:20965081-20965103 GGAGTGCAACAGCATGATCTTGG - Intergenic
1171541825 20:25965030-25965052 GGAGTGCAACAGCATGATCTTGG + Intergenic
1172086868 20:32392135-32392157 TGGGTGGCACAGCAAGACCTTGG - Intronic
1172859789 20:38039453-38039475 GGAGTGCAACAGCATGATCTAGG + Intronic
1172871481 20:38138272-38138294 TGTGGGCCAGAGCATGAACATGG - Exonic
1173016829 20:39233389-39233411 TGGAGGCCACTGCATCTTCTGGG + Intergenic
1173372823 20:42453719-42453741 GGAGGGCAACAGCGTGATCTTGG + Intronic
1174164294 20:48573908-48573930 TGGAGTCCAGGGCATGATCTTGG + Intergenic
1175553714 20:59833017-59833039 TGGGGCCCACAGCACTGTCTAGG + Intronic
1176192768 20:63820777-63820799 GGAGTGCCACAGCACGATCTCGG + Intronic
1178677906 21:34646755-34646777 TGGGGGCCAAGGCATCATCCAGG + Intergenic
1179998726 21:44985616-44985638 TGGGGCCCACAGCCTCATCTCGG - Intergenic
1181113743 22:20618160-20618182 GGAGTGCAACAGCATGATCTTGG + Intergenic
1181490765 22:23259565-23259587 GGAGTGCCACAGCATGGTCTCGG + Intronic
1181558765 22:23687584-23687606 TGGGGTCCACAGTGTGATCTCGG - Intergenic
1182638315 22:31747159-31747181 GGAGTGCAACAGCATGATCTCGG + Intronic
1183074994 22:35421292-35421314 TGGGGGCAACAGCGTGCTCAGGG - Intronic
1183987765 22:41578716-41578738 TGGGGGCCACAGCCTGGTCTTGG + Intronic
1184378633 22:44131190-44131212 TGGGTGCAATGGCATGATCTTGG + Intronic
1184466062 22:44669314-44669336 TGGGGGCCACAGGCTGAGCCAGG - Intronic
1184805509 22:46792779-46792801 TGGGAGCCACAGCCTGATGTGGG + Intronic
1185389547 22:50551505-50551527 TGGGTGCCTCAGCAGGATCTGGG - Intronic
949953804 3:9251169-9251191 TGGAGCACACAGCATGAGCTGGG + Intronic
952314217 3:32218546-32218568 TGGGGGCCTCAGCAGGAAATTGG + Intergenic
952461179 3:33527910-33527932 GGGGGGCAGCAGCATGATCTCGG - Intronic
954983050 3:54763150-54763172 TGGGGACCACATCATGATATGGG + Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
961818932 3:129565403-129565425 TGTGCGCCGCAGCATGAGCTTGG + Exonic
967292794 3:187937525-187937547 GGAGTGCAACAGCATGATCTCGG - Intergenic
968687009 4:1967525-1967547 GGAGTGCAACAGCATGATCTCGG - Intronic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
971329796 4:25673115-25673137 TGGTGCCCACAGCAAGATCCGGG - Exonic
972684069 4:41334901-41334923 TGGTGGCCACAGCATGAAGATGG + Intergenic
974526063 4:63051402-63051424 GGAGCGCAACAGCATGATCTTGG - Intergenic
976624053 4:87158856-87158878 GGAGGGCAGCAGCATGATCTCGG - Intergenic
980496604 4:133592694-133592716 TGGGCCCCACAGCAGCATCTTGG - Intergenic
981042685 4:140237906-140237928 GGGAGGCAACAGCCTGATCTTGG + Intergenic
982682550 4:158448951-158448973 GGAGTGCAACAGCATGATCTCGG - Intronic
982711986 4:158767481-158767503 TGCTGGCCACAGTATGACCTGGG + Intergenic
983156831 4:164358240-164358262 AGGAGGCCACAGCATCCTCTTGG + Intronic
984775517 4:183478328-183478350 TGGGTGACACAGCAAGATCTTGG - Intergenic
984998600 4:185462511-185462533 TAGAGGCCACAGCATATTCTAGG - Intronic
985206036 4:187538131-187538153 TAGGAGGCACAGCATGAACTGGG - Intergenic
986596304 5:9425904-9425926 AGGAGGCCTCAGCATGACCTTGG + Intronic
987187780 5:15443284-15443306 TGGGGTCCACATCATGATGGTGG + Intergenic
987247417 5:16062484-16062506 GGAGTGCCACAGCGTGATCTTGG + Intergenic
987602541 5:20090482-20090504 GGAGTGCAACAGCATGATCTTGG - Intronic
988349698 5:30086227-30086249 GGGGTGCAATAGCATGATCTCGG + Intergenic
989047144 5:37284205-37284227 TGTCGCCCAGAGCATGATCTTGG - Intergenic
991094046 5:62720551-62720573 TGGGGCCCACAGAATAATCCAGG + Intergenic
993091675 5:83433869-83433891 GGAGTGCAACAGCATGATCTTGG - Intergenic
993184254 5:84596434-84596456 GGAGTGCAACAGCATGATCTCGG + Intergenic
996521872 5:124436566-124436588 TGGGTGACACAGCAAGACCTTGG - Intergenic
997146325 5:131438037-131438059 GGGGTGCAATAGCATGATCTTGG + Intronic
997327000 5:133029957-133029979 GGAGTGCCCCAGCATGATCTTGG + Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998176468 5:139904719-139904741 TGGGGGCCTGAGCATGATTGGGG + Intronic
1000337318 5:160251534-160251556 TGGGGGCAGCAGCAAGACCTCGG - Intergenic
1003192346 6:3885775-3885797 TGGAGGCCACAGTCTGACCTCGG - Intergenic
1003924784 6:10867567-10867589 GGAGTGCAACAGCATGATCTTGG + Intronic
1005139259 6:22609183-22609205 GGAGTGCAACAGCATGATCTTGG + Intergenic
1005935679 6:30519189-30519211 TTCCGGACACAGCATGATCTTGG + Intergenic
1007380926 6:41489670-41489692 TGGGGGCCAGCGCAACATCTGGG - Intergenic
1007833074 6:44653706-44653728 AGGTGGCCACAGCATGACATAGG - Intergenic
1008603192 6:53115787-53115809 TGTGGGCCACAGCTTGCTTTGGG - Intergenic
1008612180 6:53194967-53194989 GGAGTGCCACAGCATGATCTCGG - Intergenic
1008779114 6:55080781-55080803 GAGGGGCCACAGCATGTTCTGGG + Intergenic
1008896322 6:56560321-56560343 TGGGGGCCTCAGGAGTATCTGGG + Exonic
1010748895 6:79596180-79596202 TGGGTGACAGAGCAAGATCTTGG - Intergenic
1012574539 6:100776790-100776812 TGGGAGGGACAGCATGTTCTTGG - Intronic
1013809323 6:114026751-114026773 GGAGTGCAACAGCATGATCTCGG - Intergenic
1015278668 6:131408882-131408904 GGGGGGCCACAGCATAAGCAAGG - Intergenic
1019079785 6:169422440-169422462 TGGGGCCCACAGCAAGCACTCGG + Intergenic
1019465413 7:1185538-1185560 TCGGGGCCACAGCATGACCATGG - Intergenic
1019720100 7:2564159-2564181 GGGGTGCAATAGCATGATCTTGG - Intronic
1022531555 7:31070048-31070070 TGGGGGCCAGAGCCAGCTCTGGG + Intronic
1023130595 7:36999096-36999118 CCGGGGCCACAGCATTGTCTAGG + Intronic
1024063000 7:45713034-45713056 TGGGGGCAGCAGCATGGTGTCGG - Intronic
1024280091 7:47711384-47711406 GGAGTGCAACAGCATGATCTCGG - Intronic
1026103114 7:67398921-67398943 TGGGGGGCACAGCATGAAAAGGG + Intergenic
1026839632 7:73662719-73662741 GGAGGGCAACGGCATGATCTTGG + Intergenic
1027886411 7:83912442-83912464 AAGGGGTCACAGCATGACCTTGG - Intergenic
1027973696 7:85120615-85120637 TGGTGGGCAGGGCATGATCTCGG - Intronic
1031990696 7:128197138-128197160 TGGGTGCCACAGCATGACTGTGG - Intergenic
1032395295 7:131585100-131585122 GGAGTGCAACAGCATGATCTTGG - Intergenic
1034480872 7:151319811-151319833 TGGGGCCAACAGCCTCATCTGGG - Intergenic
1036942786 8:13067506-13067528 GGAGGGCCACCCCATGATCTGGG - Intergenic
1036950550 8:13135025-13135047 TGAGGGCAACTGCATCATCTTGG - Intronic
1037635781 8:20700230-20700252 TGGGGGAGACAGCAGGAGCTAGG + Intergenic
1037892983 8:22633692-22633714 TGTGGGCCTCAGCATCACCTGGG + Intronic
1037967965 8:23148186-23148208 TGAGGGCAATGGCATGATCTTGG - Intronic
1039049941 8:33484140-33484162 GGAGGGCCACAGCATGATCTCGG + Intronic
1040305868 8:46211479-46211501 ATGGGGCCACAGGATGATGTCGG + Intergenic
1040413446 8:47177883-47177905 TGGGTGTCTCAGCATGAGCTAGG - Intergenic
1040495777 8:47964170-47964192 GGAGTGCAACAGCATGATCTTGG - Intronic
1041030284 8:53729552-53729574 TGGGGGCCACATGATGTGCTGGG + Intronic
1042837514 8:73091897-73091919 TGGGAGCCTCAGCATTTTCTGGG - Intronic
1046707988 8:117477460-117477482 TGTGGGCCACAGCTTTATCCAGG + Intergenic
1046766460 8:118074852-118074874 TGAGGGTCACAGCTTGCTCTGGG + Intronic
1047200228 8:122759041-122759063 TGGAGCCCAAAGCGTGATCTGGG - Intergenic
1048746597 8:137621230-137621252 TGTGGGCCTGAGCAGGATCTGGG - Intergenic
1048784195 8:138033242-138033264 TGGGGGCCAGTGCAAGATCAAGG - Intergenic
1049433403 8:142575532-142575554 TGGGGGCCGCAGCTTGCACTGGG + Intergenic
1049782502 8:144435343-144435365 TGGGGGCCACAGGATCCTCCTGG + Intronic
1050780521 9:9328685-9328707 TGGAGCGCACGGCATGATCTTGG + Intronic
1052105383 9:24508841-24508863 GGAGTGCAACAGCATGATCTTGG - Intergenic
1052553221 9:29979817-29979839 GGAGTGCAACAGCATGATCTCGG + Intergenic
1052972477 9:34385483-34385505 TGGGTGCAATGGCATGATCTCGG - Intronic
1054163254 9:61694624-61694646 GGAGTGCAACAGCATGATCTTGG - Intergenic
1054760865 9:69002930-69002952 GGAGAGCAACAGCATGATCTTGG - Intronic
1056774600 9:89501741-89501763 TAGGAGTCACAGCATGGTCTTGG - Intergenic
1057304323 9:93903558-93903580 TGGAGCCCACAGCAGGAGCTGGG + Intergenic
1057598941 9:96440404-96440426 TGAGGGCAATGGCATGATCTCGG + Intergenic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1060346075 9:122816887-122816909 TGGCGGCCTCAGCATCACCTGGG - Intronic
1060580424 9:124740791-124740813 TGGGTGCCAAATCATGATCACGG - Intronic
1060632174 9:125168809-125168831 TGGGGTGCAATGCATGATCTCGG + Intronic
1061625316 9:131837870-131837892 TGGGGGAGACAGCAGGAGCTGGG - Intergenic
1187156900 X:16728612-16728634 GGGGTGCAACGGCATGATCTTGG - Intronic
1187268673 X:17760267-17760289 AGGAGGCCACAGGATGACCTTGG - Intergenic
1189324632 X:40105202-40105224 TGGGGGCCGCAGGGTGGTCTCGG - Intronic
1190430337 X:50372542-50372564 TGGGGGCTAAAGCATGGCCTGGG - Intronic
1193144843 X:78065975-78065997 GGAGTGCCACGGCATGATCTTGG - Intronic
1195295713 X:103474250-103474272 GGAGTGCCACAGCATGATCTTGG - Intergenic
1195554499 X:106206343-106206365 TGGGGGCTGCAGCATGCCCTGGG + Exonic
1198401693 X:136274896-136274918 TGGGAGTCACAGGATGTTCTAGG - Intergenic
1199263736 X:145805940-145805962 TAGGGACCCCAGCATGTTCTGGG + Intergenic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1199736155 X:150688546-150688568 AAGGAGCCACAGCAAGATCTTGG - Intergenic
1199802536 X:151265844-151265866 GGAGTGCAACAGCATGATCTTGG + Intergenic
1200172960 X:154091936-154091958 TGGTCGCCACAGCGTGATCTGGG - Intronic
1200383199 X:155861033-155861055 GGAGTGCAACAGCATGATCTTGG - Intergenic
1201638702 Y:16155140-16155162 CGGGGGCAGTAGCATGATCTTGG + Intergenic