ID: 1146707385

View in Genome Browser
Species Human (GRCh38)
Location 17:35011148-35011170
Sequence CTTTCCGCATAAACTAAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146707377_1146707385 -4 Left 1146707377 17:35011129-35011151 CCTCCACCCATTGCTTCCCCTTT 0: 1
1: 0
2: 0
3: 41
4: 493
Right 1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG 0: 1
1: 0
2: 1
3: 5
4: 95
1146707379_1146707385 -10 Left 1146707379 17:35011135-35011157 CCCATTGCTTCCCCTTTCCGCAT 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG 0: 1
1: 0
2: 1
3: 5
4: 95
1146707376_1146707385 2 Left 1146707376 17:35011123-35011145 CCACTGCCTCCACCCATTGCTTC 0: 1
1: 0
2: 0
3: 54
4: 538
Right 1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG 0: 1
1: 0
2: 1
3: 5
4: 95
1146707373_1146707385 25 Left 1146707373 17:35011100-35011122 CCAAGCCAAAATTAAGGAGAAGG 0: 1
1: 0
2: 1
3: 18
4: 254
Right 1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG 0: 1
1: 0
2: 1
3: 5
4: 95
1146707375_1146707385 20 Left 1146707375 17:35011105-35011127 CCAAAATTAAGGAGAAGGCCACT 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG 0: 1
1: 0
2: 1
3: 5
4: 95
1146707378_1146707385 -7 Left 1146707378 17:35011132-35011154 CCACCCATTGCTTCCCCTTTCCG 0: 1
1: 0
2: 1
3: 27
4: 307
Right 1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146707385 Original CRISPR CTTTCCGCATAAACTAAGGA TGG Exonic
905780175 1:40702042-40702064 CTTTCCTCAGAAGCTATGGATGG - Intronic
906583408 1:46955107-46955129 CTTTCTGCAGAAACTAAGGGAGG + Intergenic
906618228 1:47250409-47250431 CTTTTCCCTTAAACTTAGGAAGG + Exonic
909420440 1:75458685-75458707 CCTTTCACAAAAACTAAGGAAGG + Intronic
910920650 1:92342855-92342877 CCTTCCCCCAAAACTAAGGATGG - Intronic
915262321 1:154685881-154685903 TTCTCAGCATAAAATAAGGAGGG - Intergenic
917448145 1:175124041-175124063 CTTTCATCATCAACTGAGGATGG - Intronic
921418125 1:214914206-214914228 CTTTCCTCACAAAGTAAGTAAGG + Intergenic
923888822 1:238188250-238188272 CTTTCTGCCTTACCTAAGGAGGG - Intergenic
1066217540 10:33302348-33302370 CTTTGCGTAAAAGCTAAGGATGG + Intronic
1067361294 10:45581791-45581813 CTTTCCCCGTAAACTAAGCTGGG - Intronic
1070431103 10:76338536-76338558 CTTGATGCCTAAACTAAGGATGG - Intronic
1077398830 11:2342466-2342488 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
1079536257 11:21519042-21519064 TTTTTCCCATAAACTAAAGAAGG + Intronic
1087881727 11:103424082-103424104 CTTTCCCCCTAAACAAAGGATGG - Intronic
1088001441 11:104886638-104886660 CTTTCTGAATAGACTAAGCAGGG + Intergenic
1098636391 12:72789313-72789335 ATTTCTGCATAAACTACTGAGGG + Intergenic
1099590882 12:84588142-84588164 CTGGCCGCATAAACTAAGTTTGG - Intergenic
1099646036 12:85358319-85358341 CTTTCAGCATAAAGTAAAGAAGG - Intergenic
1106832413 13:33599169-33599191 CTTTTCAAATAAACTAATGAGGG - Intergenic
1109297050 13:60546750-60546772 CTTTTCCCTTAAACTTAGGAAGG - Intronic
1110044062 13:70806862-70806884 CTATCCACACAGACTAAGGAAGG + Intergenic
1110732641 13:78896841-78896863 CTTTCCCCCTAAAATAAAGAGGG + Intergenic
1112518527 13:100077074-100077096 CTTTCTGCATAAAGTAAAAATGG - Intergenic
1114766970 14:25384148-25384170 CTTTCAGCATTAACTAAAGGAGG - Intergenic
1116679810 14:47952190-47952212 GTTCCCGCATAGACTAAGGTAGG - Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117315889 14:54569642-54569664 CTTCCCGCTGAAATTAAGGAAGG - Intronic
1120295872 14:82640011-82640033 CTTTCCCCTTAAGATAAGGAAGG + Intergenic
1120945079 14:89987264-89987286 TTTTCCTCATACACTAAGCAGGG + Intronic
1127462946 15:59216300-59216322 CTTTACAGATAAACTAAGGGAGG - Intronic
1127988299 15:64092575-64092597 CTGTCCACATAATCTAGGGATGG - Intronic
1130892687 15:88146621-88146643 CATTCTGCACAAACAAAGGAAGG - Intronic
1135830855 16:25771561-25771583 CTTTCCACAGAAGATAAGGAAGG - Intronic
1140835368 16:78788905-78788927 CTTTCCCCACATACTAAGCAGGG - Intronic
1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG + Exonic
1146803234 17:35844270-35844292 ATTTCCGCATGACCTAAGAAAGG - Exonic
1148814375 17:50316654-50316676 GTTTCTGCATAAATTAATGATGG - Intergenic
1203173216 17_GL000205v2_random:170695-170717 CTTTCCTCTTAAACTGAGAACGG - Intergenic
1153625573 18:7019529-7019551 CTTTCACCACAAACCAAGGAGGG + Intronic
1157288718 18:46394808-46394830 CTTCCTGAATAAACAAAGGAAGG + Intronic
1157693425 18:49701759-49701781 CTTTCTGCCTAGACTGAGGAAGG - Intergenic
1160362101 18:78292355-78292377 CTCTGCGCATCAACAAAGGAAGG - Intergenic
1163973069 19:20819257-20819279 CTTTCCGCAAAAAGTAAAAATGG - Intronic
1167171605 19:47836124-47836146 CCATCTGCCTAAACTAAGGATGG - Intronic
1167676126 19:50887220-50887242 CTTTCCGCAGAGGCTCAGGATGG + Intergenic
926666547 2:15530631-15530653 TTTTCCACAAAAACAAAGGAGGG + Intronic
926864448 2:17342511-17342533 CTTTCCGGAAATACTAAGGGAGG + Intergenic
927839431 2:26429828-26429850 CTGTCCTAATAATCTAAGGAGGG + Intronic
928931660 2:36631389-36631411 CTTTCTGCAGAAAGTAAAGATGG + Intronic
929124733 2:38512850-38512872 CTTTCTGCATAAACCCAGGAAGG - Intergenic
931515535 2:63048748-63048770 CTTTCCTCGGAACCTAAGGAAGG + Intergenic
935670088 2:105547851-105547873 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
937057121 2:118948170-118948192 CTTTCTGCAGAAAGTAAAGATGG - Intronic
937057650 2:118952925-118952947 CTTTCTGCAGAAAGTAAAGATGG - Intronic
938158496 2:128961354-128961376 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
939585198 2:143996063-143996085 CTTTCCACATCCACTAAGGTAGG + Intronic
948084662 2:235237468-235237490 CTTTCAGCATATACTACAGAGGG - Intergenic
1171059409 20:21941816-21941838 CTTTTTGCATAAAATCAGGATGG + Intergenic
1171510006 20:25674540-25674562 GTTTCAACATAAATTAAGGAGGG + Exonic
1176329201 21:5532337-5532359 CTTTCCTCTTAAACTGAGAACGG - Intergenic
1176398556 21:6288614-6288636 CTTTCCTCTTAAACTGAGAACGG + Intergenic
1176438601 21:6700490-6700512 CTTTCCTCTTAAACTGAGAACGG - Intergenic
1176462863 21:7027560-7027582 CTTTCCTCTTAAACTGAGAACGG - Intergenic
1176486424 21:7409338-7409360 CTTTCCTCTTAAACTGAGAACGG - Intergenic
1179108048 21:38421243-38421265 CTTTCAGTAAATACTAAGGACGG + Intronic
1180152206 21:45955269-45955291 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1182037819 22:27213327-27213349 CTTTCTGCATAATCTTAAGAAGG + Intergenic
1184020607 22:41818787-41818809 CTTGCTGCATAAACCAAGAACGG - Intronic
953458230 3:43060994-43061016 CTTCCCAGATAAGCTAAGGAGGG - Intergenic
956496854 3:69836800-69836822 TTTTCTGCTTAAACTAGGGAGGG - Intronic
961954033 3:130782217-130782239 CTTTTCACATAAACTATGTAAGG + Intergenic
967623544 3:191661848-191661870 CTTTCCGGAGAGACTAAGGGGGG + Intergenic
970262387 4:14241645-14241667 CTTGATGCATAAACTAAGGTGGG - Intergenic
973887594 4:55338966-55338988 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
973888125 4:55343291-55343313 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
978366463 4:107988250-107988272 CTTTCCGCAGAAAGTAAAAATGG + Intergenic
981506616 4:145507783-145507805 CTTTTGACATAAACTAAGGCAGG + Intronic
992424811 5:76646032-76646054 CTTTCAGTATGGACTAAGGAAGG + Intronic
992631066 5:78681360-78681382 CATTCCTCATAAATTATGGAAGG + Intronic
993054772 5:82969183-82969205 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
997335003 5:133101276-133101298 ATTTCCTCATAAACTAAATAAGG - Intronic
998826081 5:146102974-146102996 CTTTTCTCAGAAACAAAGGAAGG + Intronic
1002948434 6:1784790-1784812 CTTTACACATAAGCAAAGGAAGG - Intronic
1013510372 6:110839418-110839440 TTTTCCCCATAAACTAAGCATGG + Intronic
1016343270 6:143084698-143084720 CTTTCTGGAGAGACTAAGGAAGG - Intronic
1018602104 6:165555365-165555387 CTGTCCCCATAAACAAAAGATGG + Intronic
1018944614 6:168338713-168338735 AGTTCCTCATAAAATAAGGAGGG + Intergenic
1031315349 7:120250933-120250955 CTGCCCGCATAAAATAAGGTTGG - Intergenic
1039961479 8:42251185-42251207 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1051034050 9:12721700-12721722 ATTTTCGCATAAAGTAAAGATGG - Intergenic
1051818914 9:21142079-21142101 CTTCCTACATAAAGTAAGGAGGG - Exonic
1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG + Intronic
1203432896 Un_GL000195v1:107986-108008 CTTTCCTCTTAAACTGAGAACGG + Intergenic
1186679717 X:11859504-11859526 CATTTTGCATAAAGTAAGGAAGG + Intergenic
1189051142 X:37646954-37646976 AGTTCCGAATAAACTCAGGATGG - Intronic
1194920084 X:99754471-99754493 CTTGCTGCATAAACTAAGGAAGG + Intergenic
1197145511 X:123167803-123167825 CATTACTCATACACTAAGGATGG + Intergenic
1199082000 X:143587566-143587588 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1199282600 X:146020078-146020100 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
1199617939 X:149672576-149672598 GTTTCTGCATAGACTAAAGACGG - Intergenic
1199624703 X:149730673-149730695 GTTTCTGCATAGACTAAAGACGG + Intergenic