ID: 1146711295

View in Genome Browser
Species Human (GRCh38)
Location 17:35043970-35043992
Sequence CTTTATCTTTAGAAGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146711295_1146711300 -3 Left 1146711295 17:35043970-35043992 CCCCCAACCTTCTAAAGATAAAG 0: 1
1: 0
2: 0
3: 19
4: 200
Right 1146711300 17:35043990-35044012 AAGCCTTTAACTGATATTTAAGG 0: 1
1: 0
2: 1
3: 12
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146711295 Original CRISPR CTTTATCTTTAGAAGGTTGG GGG (reversed) Intronic
901196789 1:7444789-7444811 CTTTGTTTTTAGAGGGTTGGGGG - Intronic
901375714 1:8837138-8837160 ATTGAACTTTAGATGGTTGGAGG - Intergenic
903077172 1:20780150-20780172 CTATAAATTTAGAAGGTTGGAGG + Intronic
903820282 1:26096789-26096811 CTGTATCTTGAGATGGGTGGTGG - Intergenic
904094213 1:27965204-27965226 CTTTGTCTGTTGAGGGTTGGGGG + Intronic
904341038 1:29834787-29834809 CTTTATCTTTAAAATGGGGGAGG + Intergenic
905475357 1:38222895-38222917 CTTGTTTTTTAGAAGGATGGAGG - Intergenic
909166409 1:72232053-72232075 CTTTATTTTAAGAAGCTTTGGGG + Intronic
910094650 1:83507421-83507443 CTTTATGTATATATGGTTGGTGG + Intergenic
910756188 1:90694222-90694244 CTTCATTTTTAGAAGGTTCTGGG - Intergenic
915749700 1:158194677-158194699 TTTTATCTTTAAAAGCTAGGGGG - Intergenic
916889364 1:169101737-169101759 CTTTATTTTTTGAAGCTTAGAGG + Intergenic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
918283843 1:183032459-183032481 CTTTTTGTTTTGAAAGTTGGAGG + Intronic
918569924 1:185977971-185977993 CTTTATTTTAAGTAGGTTGAAGG + Exonic
919886358 1:201937910-201937932 CTTTATGTTTACAAGGAGGGAGG - Intronic
921784223 1:219208287-219208309 ATTTGTATTTAAAAGGTTGGTGG + Intronic
922829000 1:228541353-228541375 CTCTATCATTAGAATGTTTGAGG + Intergenic
922830546 1:228551249-228551271 CTTTATCATAAGAAAGTTTGGGG + Intergenic
923904204 1:238364516-238364538 ATATATATTTAGAAGATTGGAGG - Intergenic
1066163838 10:32764253-32764275 CTTCATCTTTAGGGGGCTGGTGG - Intronic
1067949924 10:50724725-50724747 ATTTTTTTTTAGAAGGTAGGAGG - Intergenic
1068916881 10:62442548-62442570 TGTTACCTTTAGAAGTTTGGAGG + Intronic
1070885256 10:79889927-79889949 ATTTTTTTTTAGAAGGTAGGAGG - Intergenic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1074001373 10:109376857-109376879 CTTCACCTATAAAAGGTTGGTGG - Intergenic
1074551617 10:114448530-114448552 GTTAATCATTAGAGGGTTGGCGG + Intronic
1074834629 10:117277422-117277444 CTTTTTCTTTATAAGGCTGTTGG - Exonic
1081920391 11:46769936-46769958 CTCTATCTTAAGAAGGTTAAAGG - Intronic
1086177808 11:83913539-83913561 CTATAACTTTGGAAGGATGGAGG + Intronic
1086772272 11:90781300-90781322 CTTTATGTTTTGCAGGTTGTTGG + Intergenic
1086940579 11:92793924-92793946 TTTTTTTTTTAGAAGGTTGTTGG - Intronic
1087117062 11:94536815-94536837 CTTTATCATTAGGAGGCTTGTGG - Intergenic
1088238253 11:107748048-107748070 CTTTAGGTTTAGAAGTTTGGTGG + Intergenic
1089159696 11:116428112-116428134 CTTTTTATTTAGAGGGGTGGGGG + Intergenic
1090105496 11:123850847-123850869 CTTTATTTTTGGAAGGTTTTAGG + Intergenic
1090339828 11:126007555-126007577 TTTTATCATTAGAAGTTTAGTGG + Intronic
1091542756 12:1477341-1477363 CTTTAGCTTTAAAAGGGGGGAGG - Intronic
1092992955 12:13920818-13920840 CACAATCTTTAGAAGGCTGGAGG - Intronic
1093827023 12:23705453-23705475 CTTTATCTTTCTAATGTTGAGGG + Intronic
1094313638 12:29113984-29114006 ATTTTTCATTAGAAGGTTGATGG + Intergenic
1095936056 12:47682913-47682935 CTTTATCTTGAAAAGTATGGGGG - Intronic
1096857566 12:54495681-54495703 TTTTATCTGTAGAGGGGTGGGGG + Intergenic
1097197554 12:57251791-57251813 TTTTATCTGTAGGTGGTTGGAGG + Intronic
1102895924 12:116598546-116598568 CCTTATCTGTACAAGGGTGGTGG - Intergenic
1104296166 12:127515890-127515912 CTTTATCTTTAAAAAGTGAGAGG - Intergenic
1105543473 13:21335012-21335034 CATTTTCTTTACAAGGTTAGGGG + Intergenic
1106037812 13:26060660-26060682 CTTTAGCTTTAGAAGGAGAGGGG + Intergenic
1108179114 13:47823414-47823436 CTTTATCTTTACAATATTAGGGG + Intergenic
1109485540 13:63014435-63014457 CTTTTTCTCTAGAAGTTTTGTGG + Intergenic
1109691835 13:65904801-65904823 CTTTATTTTTAGAGAGTTGTAGG - Intergenic
1109974694 13:69815851-69815873 TTTTATATTTAGATGGTTGGAGG - Intronic
1111312002 13:86501591-86501613 TTTTATATTTACAAGGTTTGAGG + Intergenic
1113883784 13:113646655-113646677 CCTTCTCTTTGGAAGGATGGAGG + Intergenic
1119493251 14:75055939-75055961 TTTTATCTTTGTAAGGTTGGTGG - Intronic
1120330197 14:83082673-83082695 CTCCACCTTTAGAAGGGTGGAGG + Intergenic
1124083758 15:26526578-26526600 CTTTTTCTTTAAATGTTTGGTGG + Intergenic
1125179925 15:36870963-36870985 CTTTATCTTAAGAATGGTGGTGG + Intergenic
1127654168 15:61040216-61040238 CTTTATCTTAAATAGGTAGGTGG + Intronic
1128581376 15:68812458-68812480 CCTTATGCTGAGAAGGTTGGAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1133813165 16:9177061-9177083 CTTTAGCTTTAGGACGCTGGTGG - Intergenic
1135893806 16:26380315-26380337 ATTTAGCTTCAGAAGGTAGGTGG + Intergenic
1138156691 16:54712262-54712284 CTTCATCTATAGAAGGAAGGAGG - Intergenic
1138264917 16:55653565-55653587 CATTATCTTGGAAAGGTTGGAGG + Intergenic
1140026792 16:71298160-71298182 CTGTATCTTCAGAGTGTTGGGGG - Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1146264651 17:31444353-31444375 TTTTCTCTTTAGAAGGGTGGGGG - Intronic
1146711295 17:35043970-35043992 CTTTATCTTTAGAAGGTTGGGGG - Intronic
1146820847 17:35982738-35982760 CCTTATCTGTGGAAGGCTGGAGG + Intergenic
1148490271 17:48019006-48019028 CCTTGTGTTTGGAAGGTTGGAGG - Intergenic
1148544028 17:48503302-48503324 CTTTATCTTTAGAGGCTTTTAGG + Intergenic
1149257033 17:54837935-54837957 GTTTATCTTTGGCAGGTTGTGGG + Intergenic
1149856177 17:60084960-60084982 CTTTTTCTTGGGAAGGGTGGGGG + Intergenic
1150053092 17:61984650-61984672 CTTTAATTTCAGAAGGTTTGGGG + Exonic
1150580479 17:66469212-66469234 CTTTCTCTTTAGCAGATTTGTGG - Intronic
1155089591 18:22493662-22493684 CTCTTTCTTCTGAAGGTTGGTGG + Intergenic
1155135968 18:22993207-22993229 CTTTATCAAAAGAAGCTTGGGGG - Exonic
1156055280 18:32994757-32994779 CATTGTGTTTAGAAGGCTGGAGG + Intronic
1156381944 18:36570456-36570478 TTTTATCTTTAAATGTTTGGTGG - Intronic
1157049998 18:44152543-44152565 ATTTATTTTTGGAAGGATGGTGG + Intergenic
1160313956 18:77822879-77822901 CTTCCTGTTTAGAAGGGTGGAGG + Intergenic
1160576955 18:79861578-79861600 CTTTGTCTTTAGACAGTTTGTGG + Intergenic
1162175958 19:8830555-8830577 CCTTATATTTTGAAGTTTGGTGG + Intronic
1162530871 19:11235811-11235833 CTTTATATTTGGAAAGTGGGCGG - Intronic
1167063652 19:47167761-47167783 CTATATTTTAAAAAGGTTGGTGG - Intronic
930571757 2:53094815-53094837 CAGTATTTTAAGAAGGTTGGTGG - Intergenic
931239949 2:60443306-60443328 CTTTATCTTTAGGCTGTTTGTGG + Intergenic
932594600 2:73086265-73086287 CCTTGTCTTTAGCAGGATGGAGG - Intronic
934687874 2:96334918-96334940 ATTTATTTTTTGAAGGGTGGGGG + Intergenic
937541716 2:122963920-122963942 TTTTATATTTGGAAGCTTGGGGG + Intergenic
937738986 2:125326615-125326637 TTTTATCTTCAGTAGGTGGGAGG - Intergenic
940278009 2:151959711-151959733 CTTTATATTTGGAATGTGGGAGG + Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
944848597 2:203693580-203693602 CTGAATCTTTATAAAGTTGGTGG + Intergenic
944941587 2:204633833-204633855 CTTAATTTTTAAAAGGTTTGTGG + Intronic
944956470 2:204817052-204817074 TTTTATCTCTAGAAGTTTGTTGG + Intronic
946705445 2:222454197-222454219 CTTTATCTTCAGATGCTTGCAGG - Intronic
946708237 2:222480170-222480192 CTGTATCTTTAAAAGGTTAGAGG + Intronic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169631962 20:7643577-7643599 CTAAATATTTTGAAGGTTGGGGG + Intergenic
1175734819 20:61377803-61377825 CCTTGTCCTTAGAAGGCTGGAGG + Intronic
1177585555 21:23089706-23089728 CTTTATGTCTAAAAGGTTGTGGG - Intergenic
1181846432 22:25712978-25713000 CATTTTCTTTAAAAGGGTGGGGG + Intronic
1182410982 22:30186112-30186134 CTTAATTTTGAGGAGGTTGGGGG - Intergenic
953306516 3:41835626-41835648 CTTTTCCTTTAGAATGTAGGTGG - Intronic
954031932 3:47825729-47825751 CTTCAGCTCTATAAGGTTGGTGG - Intronic
954859851 3:53678507-53678529 ATTTATCTTTAGAAGTTTAAGGG + Intronic
955208913 3:56922835-56922857 CTTTATCCCTAGCAGGTTGCAGG + Intronic
958010498 3:87872851-87872873 ATTTTTCTTTAAAAGTTTGGCGG - Intergenic
961135339 3:124504849-124504871 CTTTATTATTAGAATTTTGGTGG + Intronic
962490718 3:135891419-135891441 CTTTATTTGTTTAAGGTTGGTGG - Intergenic
963850339 3:150204615-150204637 CTTTCTCTTTACAAGGAGGGAGG + Intergenic
966168582 3:177050814-177050836 CTTTTTTTTTAGAGGGGTGGGGG + Intronic
966605013 3:181812940-181812962 CTCTTTCTTCAGAAGGTTGTAGG + Intergenic
967452071 3:189636622-189636644 GTCTATATTTAGAAGATTGGTGG - Intronic
967683470 3:192392719-192392741 CTTTATCTTAAAAAGGTCGTGGG - Intronic
967720862 3:192814964-192814986 CTCCATTTTTAGATGGTTGGGGG - Intronic
969680989 4:8643392-8643414 CTTTCTCTTTACAGGGTTGAGGG - Intergenic
973553137 4:52055150-52055172 CTTTATGTTAATAATGTTGGTGG + Intronic
974971348 4:68832458-68832480 CTTTCTTTTTTGAAAGTTGGGGG - Intergenic
977073206 4:92418995-92419017 CTCTTTCTTTTGAAGGTTTGGGG + Intronic
978509600 4:109501893-109501915 CCTGCTCTTAAGAAGGTTGGTGG + Intronic
979028267 4:115605286-115605308 CTTTTTATTTAAAAGGATGGAGG + Intergenic
979486155 4:121272688-121272710 CCTTATCTTTAGAATATTAGAGG - Intergenic
980169577 4:129273027-129273049 TTTTTTCTTTAGAATGTTTGTGG + Intergenic
982159513 4:152553679-152553701 CTTTAGCATTAGAAATTTGGGGG + Intergenic
982717859 4:158827686-158827708 CTTTATCTTTAGCGTGTTGAGGG + Intronic
984278905 4:177643317-177643339 CTGTATCTTTAGAATGTTTTAGG - Intergenic
984748648 4:183250175-183250197 CTTTAGCTTTTGGTGGTTGGGGG - Intronic
987154069 5:15070283-15070305 CTTAATCTTTTGAAAGTTGTCGG - Intergenic
987465931 5:18271857-18271879 CTTCATATGTAGAAAGTTGGAGG - Intergenic
988698804 5:33651649-33651671 CTTTATTTTTATAAGTTTGGGGG + Intronic
989502928 5:42190292-42190314 CTAAATATTTACAAGGTTGGGGG - Intergenic
989735425 5:44697774-44697796 TTTTATTTTTACAAGGTTGCAGG + Intergenic
993208261 5:84914081-84914103 CTTTATCTTCAAAAGGTGAGGGG + Intergenic
993994717 5:94709115-94709137 ATTTATTTTTACAAAGTTGGGGG - Intronic
995728573 5:115210179-115210201 TTTTTTTTTTAGAAGGTAGGAGG - Intergenic
995744799 5:115392434-115392456 CCTTATCTTTAAAAGGGAGGAGG - Intergenic
998937112 5:147241040-147241062 CCTTATTTTTAGAAGGTTCATGG - Intronic
1000850285 5:166331355-166331377 TTTTATTTTTGGAAGGGTGGTGG + Intergenic
1001425732 5:171621046-171621068 CTCTATGTGTAGAAGGCTGGAGG - Intergenic
1002137184 5:177114940-177114962 CTTCCTCTTTAGAAGCTAGGAGG - Intergenic
1002472202 5:179442195-179442217 CTTTATCTTTAGCAGGTATTTGG - Intergenic
1003408504 6:5842771-5842793 CATTTTCTTTACAAGGTTAGGGG - Intergenic
1003929457 6:10909564-10909586 CTTTGTTTTTAGAATGTTGGGGG + Intronic
1005631757 6:27714744-27714766 GTTTATCTTTGGAATGTGGGGGG - Intergenic
1006063382 6:31442327-31442349 CTTTTTCTTTATAAGGGGGGGGG + Intergenic
1006774080 6:36578382-36578404 CTTTATCTTTGGAGGAGTGGGGG - Intergenic
1010843947 6:80681697-80681719 CTTTATTTTTAGAAGATTGTGGG + Intergenic
1010984475 6:82407804-82407826 CTTTAAATTTGGAATGTTGGAGG + Intergenic
1011096828 6:83675168-83675190 CTTTATCTCTATAAGCTTAGAGG - Intronic
1012285584 6:97383912-97383934 CTTTATCTTTATGGGGTTGTTGG - Intergenic
1012567431 6:100676385-100676407 TTTTACCTCTAGAAGGTTTGTGG - Intronic
1015602569 6:134924683-134924705 CCTTTTCTTTAGTAGGTTTGTGG - Intronic
1016476103 6:144430625-144430647 CATTATCTTTATGAAGTTGGTGG - Intronic
1017199303 6:151734918-151734940 TTAAATCTTTTGAAGGTTGGAGG - Intronic
1017207842 6:151823214-151823236 CTTAATTTTTTGAAGGCTGGAGG + Intronic
1018268911 6:162055253-162055275 CTTTCTGTTTAGAAGATTTGAGG - Intronic
1018310259 6:162501197-162501219 ATTTATCTTTTGGAGCTTGGGGG - Intronic
1018526806 6:164720554-164720576 CTTTATTTTTTTAAGGCTGGTGG + Intergenic
1019132851 6:169890221-169890243 GTTTCTCTTTAGAAAGATGGAGG - Intergenic
1019877808 7:3830443-3830465 CTTTAATTTTAGCAGTTTGGGGG + Intronic
1020121646 7:5507418-5507440 CTTTCTCTTTTGGAGGATGGAGG - Intronic
1020598027 7:10236269-10236291 TTTCATCTTTAGAAGTTTGGAGG + Intergenic
1023216529 7:37868779-37868801 CTTTTACTTTAGATGGTTTGTGG + Intronic
1025034354 7:55583995-55584017 CTTTCTCATAAGAAGTTTGGGGG + Intergenic
1027332410 7:77112468-77112490 CTTTATTTTCAGAGAGTTGGTGG - Intergenic
1027720895 7:81740198-81740220 CTTACTCTCTAGAAAGTTGGAGG - Intronic
1028260918 7:88663628-88663650 CTTTTTCTTGTTAAGGTTGGGGG + Intergenic
1031648537 7:124257039-124257061 CTTTATTTTTAGAATGTTTTTGG + Intergenic
1031723640 7:125208815-125208837 CCGTATATTCAGAAGGTTGGGGG + Intergenic
1032791618 7:135246775-135246797 CTTTGCATTTAGCAGGTTGGAGG + Intronic
1033557982 7:142505664-142505686 CTTTATCTTTTGAAGACTGGTGG + Intergenic
1036192892 8:6687364-6687386 CCTTCTCTTTAGAAGCCTGGTGG + Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1037318081 8:17617714-17617736 CTGTATCTTTAGTAGGTTTGGGG - Intronic
1038369645 8:26975597-26975619 CTTTATTTTTAAAAGGGAGGGGG - Intergenic
1039301432 8:36213343-36213365 CTTTGTCTCTAAGAGGTTGGGGG + Intergenic
1039828866 8:41197091-41197113 CTTTTTCTTTCCAAAGTTGGGGG + Intergenic
1041545872 8:59041538-59041560 CTTTGTGTTTAGAAGCATGGAGG + Intronic
1045244854 8:100434007-100434029 CTTTATTTTTATGGGGTTGGGGG + Intergenic
1046137352 8:110045789-110045811 CTTTTTCTTAAGAATTTTGGTGG - Intergenic
1046519953 8:115311225-115311247 TTTTACCTTAAAAAGGTTGGAGG - Intergenic
1050018392 9:1259774-1259796 CTTTAGCTTTAGTAGAATGGAGG + Intergenic
1050584845 9:7099958-7099980 ATTTATCTTGAGGAGTTTGGGGG + Intergenic
1051033394 9:12712003-12712025 TTTTATCTTTTTAATGTTGGGGG - Intergenic
1051443126 9:17108829-17108851 ATTTTTCTTTACATGGTTGGTGG + Intergenic
1052180614 9:25522109-25522131 CTTTGTCTCTAGGATGTTGGAGG - Intergenic
1055372805 9:75618620-75618642 CTATATCTTGATGAGGTTGGTGG - Intergenic
1057297440 9:93857572-93857594 GTTTAGCTTTGGAAGGGTGGGGG - Intergenic
1057356689 9:94337716-94337738 CTTTTTCTATTGAATGTTGGGGG - Intergenic
1058955220 9:109940638-109940660 CTAGATCTCTAGAAGTTTGGAGG + Intronic
1185538830 X:885798-885820 CTTAAACTTTAGATGGTTTGGGG + Intergenic
1186045204 X:5528490-5528512 CTTGATCATTAAAAGTTTGGAGG + Intergenic
1186283234 X:8017034-8017056 GTTTTTCTTTAAATGGTTGGAGG + Intergenic
1188604016 X:32006008-32006030 CTTTAGCTTTAGACGGTGGGTGG + Intronic
1190483259 X:50898623-50898645 CTTTTGCATTAGAAGTTTGGGGG + Intergenic
1190985067 X:55492430-55492452 CTGTTGCTTCAGAAGGTTGGAGG - Intergenic
1191232637 X:58108064-58108086 CTTTATCATTAGAATGTCTGTGG - Intergenic
1191236499 X:58138567-58138589 CTTTATCCTTAGAATGTGTGGGG - Intergenic
1191236952 X:58141792-58141814 CTCTATCATTAGAATGTGGGAGG - Intergenic
1191240981 X:58189921-58189943 CTTTATCTTTAAAATGTGGGAGG - Intergenic
1191241401 X:58192851-58192873 CTTTATCTTTAGAATGCCAGGGG - Intergenic
1191243237 X:58205787-58205809 CTTTATCATTAGAATGCTGAGGG - Intergenic
1191243567 X:58208249-58208271 CTCTATCTTTAGAATGCTTGAGG - Intergenic
1191243819 X:58210195-58210217 CTCTATCTTTAGAATGTTTGAGG - Intergenic
1191243970 X:58211421-58211443 CTTTATCCTTAGAATGATGGAGG - Intergenic
1191244556 X:58215727-58215749 CTCTATCCTTAGAATGCTGGAGG - Intergenic
1191246189 X:58230100-58230122 CTCTATCATTAGAATGTTTGTGG - Intergenic
1191246266 X:58230730-58230752 CTTTATCTTTAGAATGCCTGAGG - Intergenic
1191249342 X:58252876-58252898 CTTTATCCTTAGAATGTCTGAGG - Intergenic
1191995076 X:67085720-67085742 GTTTGTCTTTATAAGTTTGGTGG + Intergenic
1194016594 X:88628926-88628948 GATTATCTTTAGAAGCTTTGGGG - Intergenic
1194042076 X:88953424-88953446 TTTTATGTTAAGAAAGTTGGTGG - Intergenic
1195725711 X:107913870-107913892 TTTTATCTTAAGAACGATGGGGG - Intronic
1196249202 X:113439228-113439250 CTTTATCTTTGGAAGTTTTGGGG - Intergenic
1196900252 X:120375543-120375565 GTTCATCTTTAGAAGGATGCAGG - Exonic
1197697076 X:129561753-129561775 GTTTGTCTTTAGAAGGTATGTGG + Intronic
1200303197 X:154999061-154999083 CTTTTTTTATACAAGGTTGGAGG + Intronic