ID: 1146711740

View in Genome Browser
Species Human (GRCh38)
Location 17:35047993-35048015
Sequence CTGTGGAAGGCCAAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39697
Summary {0: 1, 1: 4, 2: 292, 3: 4332, 4: 35068}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146711740_1146711748 21 Left 1146711740 17:35047993-35048015 CCATTCACCTTGGCCTTCCACAG 0: 1
1: 4
2: 292
3: 4332
4: 35068
Right 1146711748 17:35048037-35048059 CCACTGCACTCAGCCCATTAAGG 0: 1
1: 0
2: 12
3: 110
4: 628
1146711740_1146711745 -8 Left 1146711740 17:35047993-35048015 CCATTCACCTTGGCCTTCCACAG 0: 1
1: 4
2: 292
3: 4332
4: 35068
Right 1146711745 17:35048008-35048030 TTCCACAGTGCTGGGATTATAGG 0: 12
1: 1582
2: 43288
3: 340827
4: 246976

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146711740 Original CRISPR CTGTGGAAGGCCAAGGTGAA TGG (reversed) Intronic
Too many off-targets to display for this crispr