ID: 1146716108

View in Genome Browser
Species Human (GRCh38)
Location 17:35088710-35088732
Sequence CGGCCTGCTTACCCCTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146716108_1146716114 16 Left 1146716108 17:35088710-35088732 CCTTTAAAGGGGTAAGCAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1146716114 17:35088749-35088771 GTTTCTTCTGACGTACAAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146716108 Original CRISPR CGGCCTGCTTACCCCTTTAA AGG (reversed) Intronic
903663833 1:24994990-24995012 CTGCCTGCTTACCCCATTAGAGG - Intergenic
912411932 1:109485660-109485682 GGGCCTGCTTCCCCATTTAAAGG - Intronic
918275787 1:182952946-182952968 CGGCCCGCTTTCCCCTTCACCGG + Exonic
921494928 1:215827700-215827722 CTGTCTGCTTAAACCTTTAAAGG - Intronic
922311362 1:224394790-224394812 CCGCCTGCTTATCCTCTTAATGG + Intronic
1064043589 10:11990430-11990452 CGGCCTCCTAACCCTTTTTAAGG - Intronic
1074391001 10:113058093-113058115 CCACCTTCTTCCCCCTTTAAAGG - Intronic
1077506271 11:2931271-2931293 CAGCCTGCCTACCCCATTGAGGG + Intergenic
1080396943 11:31898916-31898938 CTGACTTCTTACCCCTTTTATGG + Intronic
1084431125 11:69111989-69112011 CGCCCTCCTTTCCCCTTCAAGGG + Intergenic
1095127037 12:38492029-38492051 GGGCTTGTTTACCCCTTTCACGG - Intergenic
1105702933 13:22947459-22947481 CTCCCTGCTTTCCACTTTAATGG + Intergenic
1105855690 13:24370246-24370268 CTCCCTGCTTTCCACTTTAATGG + Intergenic
1106555835 13:30807703-30807725 TGGCCTGCTAATCTCTTTAATGG - Intergenic
1107122511 13:36811286-36811308 CAGCCTGCATCCCCCTTTAAGGG + Intergenic
1110920282 13:81075686-81075708 TTGCCTGTTTATCCCTTTAAAGG - Intergenic
1119216151 14:72870775-72870797 CAGCCTCGTTACCCTTTTAATGG - Intronic
1123042477 14:105496062-105496084 CAGCCTGCTCTCCCCTTTTAGGG + Intronic
1143389255 17:6550525-6550547 CGGCATCCTTTCCCCTTTCAAGG - Intronic
1144073887 17:11700055-11700077 CGCCCTGCTTTCCTCTTTCAGGG + Intronic
1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG + Intronic
1146716108 17:35088710-35088732 CGGCCTGCTTACCCCTTTAAAGG - Intronic
1157417754 18:47520326-47520348 GGGGCTGCTTACCACTTAAAGGG - Intergenic
1164147267 19:22519665-22519687 TGGCCTGCTTCCCCCGTTACCGG - Intronic
932713553 2:74085398-74085420 CTGCCTGGCTACCCCTTTCAGGG + Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948614669 2:239190913-239190935 CGACCTGCGCACCCCTTTTACGG + Intronic
1169477793 20:5948277-5948299 TGGCCTCCTTATCCCTCTAACGG - Intronic
1183533859 22:38383277-38383299 CAGCCTGCTAATCCCATTAAGGG + Intronic
1184820879 22:46908439-46908461 CAGCCTGCTTGCCACGTTAAAGG + Intronic
1184978400 22:48079359-48079381 CCGCCTGATTACATCTTTAAAGG - Intergenic
959174480 3:102889262-102889284 TGCCCTACTTACCTCTTTAAAGG - Intergenic
959619176 3:108381641-108381663 AGGCCTGCTTACCTCTGGAAGGG - Intronic
961406885 3:126685925-126685947 CAGCCTGCTTCCACTTTTAAAGG - Intergenic
965874742 3:173302341-173302363 CGAAATGCTTTCCCCTTTAAAGG - Intergenic
968728599 4:2259588-2259610 CTACCTGCCTACCCCTTGAAGGG + Intronic
977702732 4:100038177-100038199 CAGCCTTTTTACCCCTATAAAGG - Intergenic
977785704 4:101032255-101032277 CAGCCTGCTTACCGCTTTGCAGG + Exonic
985768428 5:1794343-1794365 CTGCTTGCTCACCCCTTTTAAGG - Intergenic
989685179 5:44077568-44077590 CTGCCTCCTTTCCCCTTTAGTGG + Intergenic
998441023 5:142162155-142162177 CTGCCTGTTTTCCCCTTTATTGG + Intergenic
1007119133 6:39365934-39365956 CGGCCTGCTTTTCCATTTAAAGG + Intronic
1016861018 6:148718810-148718832 AGGCCTTCTTACCCCTTCAAAGG - Intergenic
1017772752 6:157655700-157655722 CTGACTGCTGACCCCTTTGAAGG - Intronic
1019714067 7:2530328-2530350 GGGCCTGCTTCCCCTTTTGAGGG - Intergenic
1022594982 7:31704810-31704832 GGGTCTGCATATCCCTTTAATGG + Intronic
1032507856 7:132449557-132449579 CTGCCTCCTCACCCCTTTATGGG - Intronic
1034092934 7:148381037-148381059 CCGCGTGCTTACCCCTGCAAGGG - Intronic
1039692571 8:39878674-39878696 ACCCCTCCTTACCCCTTTAATGG - Intergenic
1042168108 8:65966100-65966122 AGGCCTGCTTTCCCCTTTGCAGG - Intergenic
1043026615 8:75078641-75078663 CGGACTTCTTACCACTTCAATGG - Intergenic
1043395524 8:79832076-79832098 CGACCTGCTGACCCCTTTATAGG - Intergenic
1044715103 8:95092878-95092900 CGGCCTGCTGAAGCCTTTTAAGG + Intronic
1058979360 9:110155092-110155114 TGGGCTGCTTAGCCCTTTACTGG - Intronic
1194011586 X:88568878-88568900 CAGTTTGCTTTCCCCTTTAAGGG + Intergenic
1202593586 Y:26512730-26512752 CAGCCTGCTAATCCCATTAAGGG - Intergenic