ID: 1146716293

View in Genome Browser
Species Human (GRCh38)
Location 17:35089319-35089341
Sequence GCGCGGAGGGCGGGAGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 1, 2: 11, 3: 92, 4: 691}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146716293_1146716308 12 Left 1146716293 17:35089319-35089341 CCGGCCGCTCCCGCCCTCCGCGC 0: 1
1: 1
2: 11
3: 92
4: 691
Right 1146716308 17:35089354-35089376 GACTCGGCCCCGCCCCCTCTCGG 0: 1
1: 0
2: 2
3: 21
4: 191
1146716293_1146716301 -4 Left 1146716293 17:35089319-35089341 CCGGCCGCTCCCGCCCTCCGCGC 0: 1
1: 1
2: 11
3: 92
4: 691
Right 1146716301 17:35089338-35089360 GCGCGGCCCCGCCCCTGACTCGG 0: 1
1: 1
2: 1
3: 16
4: 224
1146716293_1146716309 13 Left 1146716293 17:35089319-35089341 CCGGCCGCTCCCGCCCTCCGCGC 0: 1
1: 1
2: 11
3: 92
4: 691
Right 1146716309 17:35089355-35089377 ACTCGGCCCCGCCCCCTCTCGGG 0: 1
1: 1
2: 2
3: 36
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146716293 Original CRISPR GCGCGGAGGGCGGGAGCGGC CGG (reversed) Exonic
900100606 1:960564-960586 CGGCTGCGGGCGGGAGCGGCGGG + Intergenic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900310215 1:2029863-2029885 GCGTGGGGGGCTGGAGCTGCTGG + Intronic
900314555 1:2050436-2050458 GCGCGCGGGGCGGGACCGTCCGG - Intergenic
900314561 1:2050458-2050480 GCGCGCGGGGCGGGAGCGGGGGG - Exonic
900342240 1:2194678-2194700 GCCCGGCGGGCGGGTGAGGCCGG - Exonic
900416170 1:2535745-2535767 GCGCGGAGTGTGGGAACCGCCGG + Intergenic
900513270 1:3070099-3070121 GGCCCGAGGGCGGCAGCGGCGGG - Intronic
900671299 1:3856808-3856830 GCGCGGGGCGCGGGCGCCGCGGG - Intronic
900786770 1:4654657-4654679 GCGCGGTGGGCGCGGGCGGCGGG + Intergenic
901066603 1:6497352-6497374 GGGCGGCGGGCGGGGGCGCCGGG + Intronic
901641368 1:10694687-10694709 GCGCGGCGGGGGCGCGCGGCGGG - Intronic
901741963 1:11347664-11347686 GGGGGGAGGGAGGGAGAGGCAGG - Intergenic
901759776 1:11463246-11463268 GCGGGGAGGGAGAGAGAGGCAGG - Intergenic
902415636 1:16237115-16237137 GCCCGGCGGGCTGGGGCGGCGGG - Exonic
902465177 1:16613147-16613169 GGGCTGCGGGCGGCAGCGGCAGG + Intronic
902476727 1:16692441-16692463 GCGCGGCGGGGAGGCGCGGCGGG + Intergenic
902510912 1:16966478-16966500 GCGCAGTGAGCGGGAGCGCCGGG + Exonic
902762258 1:18589806-18589828 TGGCGGAGGGGGGGAGCGGCGGG - Intergenic
902775336 1:18671041-18671063 GCGAGGAGGGAGGGAGCGAGGGG - Intronic
902998060 1:20243060-20243082 GCGAGGAGGGTGGGAGCGGAGGG - Intergenic
903034483 1:20485451-20485473 GCGCTGGGGCCGGGGGCGGCCGG + Exonic
903044290 1:20553888-20553910 GCGCGGGCGGCGGGGGCGCCGGG - Exonic
903078110 1:20787345-20787367 GCGCGGGAGGCGGGGCCGGCGGG - Intergenic
903132768 1:21290327-21290349 GCCTGGAGGGCGGGGGCGGGAGG - Intronic
903142223 1:21345533-21345555 GCGCCGAGTGCCGGAGGGGCGGG + Intergenic
903155630 1:21440524-21440546 GGGCTGAGGGCGGCAGCGGCAGG - Intronic
903233797 1:21937113-21937135 GGGCGGGGGGCGGGGGCGGAGGG - Intronic
903792834 1:25906315-25906337 ACGCGGTCGGCGGGAGGGGCTGG - Intronic
903925139 1:26826635-26826657 CCGCGGCGGGCGGTGGCGGCGGG + Intergenic
904505810 1:30952684-30952706 GGGGGGGGGGCGGGAGGGGCAGG + Intronic
904696649 1:32335288-32335310 GCGCAGAGGGCGCGACCGGCAGG + Intronic
905167054 1:36088914-36088936 GCGGCGATGGCGGCAGCGGCAGG + Exonic
905617075 1:39408783-39408805 GCGCGGTGGGCGTGGGCTGCGGG + Intronic
905793457 1:40802447-40802469 GCCCCGAGAGCGGGAGGGGCCGG - Intronic
905869416 1:41394670-41394692 GAGGGAAGGGCGGTAGCGGCCGG - Intergenic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906027026 1:42682608-42682630 GCGCTGAGGGCGGGGGCGGCGGG - Exonic
906528422 1:46509797-46509819 GCGGGGAGGGTGGGGGTGGCAGG - Intronic
907184917 1:52602332-52602354 GCGCGGGGGGCGGGAGGAGGCGG - Intergenic
907442874 1:54489421-54489443 GCGCGCAGCGCGGGAGCCCCCGG + Intergenic
909698197 1:78491074-78491096 GCGCGGAGGGGACGAGCGGCTGG + Exonic
912798598 1:112707166-112707188 GCGGGGAGGGCGGGCCCGGCAGG + Intronic
915359703 1:155278398-155278420 GTGCTGAAGGCGGGGGCGGCGGG + Intronic
915463190 1:156081737-156081759 GCGCCGCGGGCGGCGGCGGCGGG + Exonic
916048897 1:161021177-161021199 GCGCGGAGGGCGGGGCCGGGCGG - Exonic
916605980 1:166343069-166343091 GCGGGGAGGGCGGGGGCGCGTGG + Intergenic
916802141 1:168225855-168225877 GCGCGGCGGGCCGGAGGGGCTGG - Intergenic
917838468 1:178959027-178959049 GCGCGGGGGGCAGGGGTGGCGGG + Intergenic
917974714 1:180231129-180231151 GCGCCGCGGGCAGTAGCGGCTGG - Intronic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
920071791 1:203307441-203307463 GCGCCCAGGGCGGGGGCGGAAGG - Exonic
920367726 1:205456917-205456939 GCGCGGAGGGCGGGGTGGGCCGG - Intergenic
920922737 1:210311572-210311594 ACACGGAGGGCGGGGGCGGGGGG + Intergenic
921060257 1:211578978-211579000 GGGCGGCGGGCGAGGGCGGCAGG + Intergenic
921089696 1:211830773-211830795 GGGCGGCGGGAGGAAGCGGCGGG + Intergenic
921432545 1:215082017-215082039 GCGCGGTGGGTGGGAGCAGCAGG - Intronic
922196527 1:223364334-223364356 GCGCGGAGAGAGGGAGTGGGTGG + Intergenic
922279964 1:224114264-224114286 GCGCGGGGGCTGGGAGCGCCTGG - Exonic
922677348 1:227561021-227561043 GCGTAGAGGGGGAGAGCGGCCGG + Intergenic
922891125 1:229062553-229062575 GCTGGGAGGGAGGGAGTGGCTGG + Intergenic
923107893 1:230868523-230868545 GGGCGCGGGCCGGGAGCGGCGGG - Exonic
923684025 1:236142115-236142137 GCGCGCAGTGCGGGAGCGCGCGG + Intergenic
924118467 1:240771578-240771600 GCGCGCAGGGCAGGGGCGGGCGG + Intergenic
924539851 1:244970630-244970652 GCGGGGCGGGGCGGAGCGGCGGG - Exonic
924584908 1:245353693-245353715 GTGGGGAGGGCGGGAGGAGCAGG - Intronic
1062843695 10:689419-689441 GCGCGGAGGGCTGGGGGCGCGGG - Intronic
1062895005 10:1096692-1096714 GCGCGCAGAGCGGGGGCTGCTGG + Intronic
1063663495 10:8048951-8048973 GGGCGGAGTGCGGGGGCGGGGGG + Intergenic
1064086542 10:12349787-12349809 GCGCGGCGCGGAGGAGCGGCCGG - Exonic
1064208922 10:13347640-13347662 GTGCGCGCGGCGGGAGCGGCCGG - Intronic
1064418282 10:15168826-15168848 GCGGGCAGGGCGGGGCCGGCGGG - Intergenic
1065090580 10:22229184-22229206 ACGCGCAGAGCTGGAGCGGCGGG + Intergenic
1065186507 10:23174554-23174576 GCGGGCAGGGCGGGGGAGGCCGG + Intergenic
1065240156 10:23695903-23695925 TCGCGGAGGGCGACAGCGCCCGG + Intronic
1065845032 10:29736706-29736728 GCGAGGAGGGCGGGCGCAGTCGG - Intronic
1065883695 10:30059117-30059139 GCGCGGAGGGCCTGGGGGGCCGG - Intronic
1066180469 10:32957553-32957575 GCGCCGCGGGCGGGGGCGGCGGG - Intronic
1066429220 10:35336468-35336490 GCGGCGAGGGCGGGCGCCGCTGG + Intronic
1067079061 10:43203443-43203465 GGGCGGAGGGAGGGTGAGGCAGG + Intronic
1067091353 10:43267100-43267122 GCGGGGAGCGGGGGAGCGGGCGG + Intergenic
1070800746 10:79243258-79243280 GCGCGGGGGGCGGGGGCGCACGG - Intronic
1070976302 10:80608678-80608700 GCACGGAGGGCGGGAGGAGGAGG - Intronic
1071291856 10:84194609-84194631 GGGCACGGGGCGGGAGCGGCGGG - Intergenic
1072453988 10:95560814-95560836 AGGCGGAGGGAGCGAGCGGCGGG - Intronic
1072465187 10:95656504-95656526 GCGCGAGGGGCGTGAGCGCCGGG - Intronic
1072613723 10:97035755-97035777 GAGCAGAGGGAGGGAGGGGCAGG - Intronic
1073207463 10:101776370-101776392 GCGGGAGGGGCGGGGGCGGCCGG + Intronic
1073423166 10:103440542-103440564 GCGGGGCGGGCGGGAGTGCCGGG + Exonic
1074503132 10:114044026-114044048 GCGCAGAGGGAGGTCGCGGCCGG - Intergenic
1074618309 10:115092943-115092965 GCGCGGGGTGCGGGTGGGGCCGG + Intergenic
1075411785 10:122233787-122233809 ACTCGGTGGGCAGGAGCGGCTGG + Intronic
1075629376 10:123991872-123991894 GCGGGGCGGGCGGCTGCGGCGGG + Intergenic
1075802209 10:125160584-125160606 GTGGGGAGGGCGGGAGGGGGAGG - Intronic
1075802408 10:125161208-125161230 GCGCGGCGGGCGGGAGGGCCAGG + Intergenic
1075806587 10:125193510-125193532 GCACGGAGGGCTGGAACTGCAGG - Intergenic
1076035550 10:127196277-127196299 GCGCGCGGGGAGGCAGCGGCTGG + Intronic
1076306154 10:129467056-129467078 GGGCGGAGCCCGGGAGGGGCGGG - Intergenic
1076395909 10:130136960-130136982 GCCCGCCGGGAGGGAGCGGCAGG + Intronic
1076631952 10:131856759-131856781 GCGGGGTGGGCGGGGGAGGCTGG + Intergenic
1076639028 10:131901382-131901404 GCCCGGAGGCCGCGCGCGGCCGG - Intronic
1076891077 10:133283712-133283734 GCAGGGAGTGCGGGAGAGGCAGG - Intronic
1076986010 11:236432-236454 GCGCCGGGGGCGGGGGCGGTAGG - Intronic
1076987508 11:249541-249563 GCAGGGAGGGGGAGAGCGGCGGG + Intronic
1076987518 11:249565-249587 GCGGGGAGGGGGAGAGCGGCGGG + Intronic
1076987528 11:249589-249611 GCGGGGAGGGGGAGAGCGGCGGG + Intronic
1077008512 11:369969-369991 GCGCGGGGGGCGCGGGGGGCGGG + Intronic
1077008541 11:370032-370054 GCGCGGGCGGCGCGGGCGGCGGG + Intronic
1077192993 11:1263275-1263297 GCAAGGAGGGCAGGAGAGGCTGG - Intergenic
1077289790 11:1783708-1783730 GCCTGGAGGGCAGGTGCGGCTGG - Intergenic
1077319919 11:1936518-1936540 GGCACGAGGGCGGGAGCGGCTGG + Intronic
1077421118 11:2450478-2450500 GAGGGGAGGGCGGCAGCGTCTGG + Intronic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1077923112 11:6655900-6655922 GCGCGGAGCGCGGGTGGGGGCGG - Intergenic
1078168513 11:8911108-8911130 TGGCGGAAGGCGGGAGAGGCGGG - Intergenic
1078190852 11:9091636-9091658 GCTCGGGGGGCGGGCGGGGCCGG - Intronic
1079126000 11:17719339-17719361 GCAGGGAGGGAGGGAGCGACCGG - Intergenic
1079714632 11:23730525-23730547 GCGGGGAGGGCGGGGGTGTCCGG - Intergenic
1081831963 11:46121662-46121684 GCGGGGAGGGAGGGGGCCGCCGG + Intergenic
1083546260 11:63551108-63551130 GCGGGAGGGGCGGGAGGGGCGGG + Intergenic
1083656986 11:64234572-64234594 GCGGGGACGGCGGGGGCGGCGGG - Exonic
1084033627 11:66495074-66495096 GAGCGGGCGGCGGGAGCAGCAGG - Intronic
1084046028 11:66568243-66568265 GCGCCGGGGGCGGGGGCGCCAGG - Intronic
1084070120 11:66728314-66728336 GCGCGGGGGGCGCGCGGGGCGGG + Intronic
1084215537 11:67645233-67645255 GCCAGGAGGGCTGGAGGGGCGGG - Intronic
1084673870 11:70623222-70623244 GCGGGAAGGGTGGGAGAGGCAGG - Intronic
1084680192 11:70662416-70662438 GGGCGGGGAGGGGGAGCGGCTGG + Intronic
1086064932 11:82733901-82733923 GGGCGGAGGGAGGGAGCGCGCGG + Intergenic
1087175229 11:95089891-95089913 GCGCGGCGGGGCCGAGCGGCTGG - Exonic
1088406041 11:109480268-109480290 GAGCGGGGGGCGGGGGCGGGGGG - Intergenic
1089729454 11:120511511-120511533 GCGGGGGCGGCGGGAACGGCGGG - Intergenic
1089729457 11:120511520-120511542 GCGGGGGCGGCGGGGGCGGCGGG - Intergenic
1089796652 11:120986279-120986301 GCGCAGAGGCCGGGCGGGGCGGG + Exonic
1090187349 11:124747083-124747105 GGGGGGAGGGCGGGACCGACAGG - Exonic
1090412936 11:126521328-126521350 GCGTGCGGGGCGGGAGCGGATGG + Exonic
1090699073 11:129278912-129278934 GCGCGGGGCGCGGGCGCGGGAGG + Intronic
1091250753 11:134141814-134141836 GACAGGAGGGCGGGAGCTGCAGG + Intronic
1091286984 11:134412920-134412942 GCGGGGAGGCCGGGGGCAGCGGG + Intergenic
1091915658 12:4270657-4270679 GCGCGGGGGTGGGGGGCGGCGGG - Intergenic
1092127586 12:6085713-6085735 GCGGGGAGGGGGGGCGCGGGGGG + Intronic
1092247844 12:6873331-6873353 GAGCTGGGGGCGGAAGCGGCCGG - Exonic
1092810476 12:12267259-12267281 GCGGGGAGGGCCGAAGCGGCCGG - Intergenic
1092833122 12:12464321-12464343 GTGGGGAGGGCAGGAGGGGCGGG - Intronic
1093728705 12:22544204-22544226 GCGCCGAGCGCGGGGCCGGCGGG + Intronic
1094565032 12:31591179-31591201 GCGGGGCGGGCGGGGGCGCCGGG + Intergenic
1094580413 12:31729071-31729093 GCGCGGTGGGCGGGAGTTGGCGG - Exonic
1095465497 12:42484064-42484086 GATCGAAGGGCGGGATCGGCAGG - Intronic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1096220979 12:49828075-49828097 GCGCGGGGGGCGGGAGGGGGTGG + Intronic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1096809617 12:54161161-54161183 GGGAGGAGGGCGGGAGGGGGAGG - Intergenic
1097007866 12:55931951-55931973 GCGCCGGGCGCGGGCGCGGCGGG + Intronic
1097190409 12:57216842-57216864 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1097190412 12:57216851-57216873 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1098369305 12:69739407-69739429 TGGCGGCGGGCGGGCGCGGCCGG + Exonic
1098426111 12:70366679-70366701 GCGCCGGGGGCGGGAGGGGGCGG + Exonic
1100260515 12:92928868-92928890 GCGGGGAGGGCGGGTGGGGCCGG - Intronic
1100391364 12:94148607-94148629 GCGGGGAGGGCTGGAGAGGTTGG - Intergenic
1100869405 12:98894892-98894914 GCGCGGGGGGCGGGGGCAGTGGG - Intronic
1100869501 12:98895174-98895196 GCGCGGCGCGCGGGGGCTGCAGG + Intronic
1101910567 12:108857657-108857679 GCGCGGGAGGCGGGAGCTGGGGG - Intergenic
1102349290 12:112180175-112180197 GGGCTGAGGGTGGGAGAGGCAGG + Intronic
1102501816 12:113358520-113358542 GGGCCGAGGGCGGGCGGGGCCGG - Intronic
1102677565 12:114668879-114668901 TCGCGGGGGGGGGGAGGGGCGGG - Intergenic
1102854039 12:116277759-116277781 GCGCGGGGGGAGCGAGGGGCGGG + Intergenic
1103325335 12:120116579-120116601 GCGGTGAGGGCCGCAGCGGCCGG - Exonic
1103488201 12:121296750-121296772 GCGCGGGGGGCGGGGGCGGGAGG + Intronic
1103527832 12:121579487-121579509 GGGCGGGCGGCGGGGGCGGCTGG - Intronic
1103534828 12:121627089-121627111 GGGCTGCGGGCGGGAGCAGCCGG - Intronic
1103595597 12:122022708-122022730 GCCCGGGAGGCGGGAGCGGGCGG - Intronic
1103764590 12:123271455-123271477 CCGCGGAGGCCGGGGGCGGGGGG - Intronic
1103848953 12:123918607-123918629 GGGCAGAGGGCAGGAGGGGCAGG - Intronic
1103915096 12:124372123-124372145 AGAAGGAGGGCGGGAGCGGCAGG - Exonic
1103930128 12:124445598-124445620 GCGAGGAGGCCGTGAGCGCCAGG + Intronic
1104876204 12:132036510-132036532 GGGCGGGGGGCAGGAGAGGCAGG + Intronic
1104983369 12:132583559-132583581 GCGCGGCGGGCGAGAGGCGCGGG - Exonic
1104983384 12:132583611-132583633 GCGCCGAGGGCGGCGGCGGCGGG - Exonic
1104986033 12:132598170-132598192 GCGCGGAGAGGAGGAGGGGCGGG - Intergenic
1106935107 13:34709614-34709636 GAGGGGAGAGAGGGAGCGGCTGG + Intergenic
1107371635 13:39756743-39756765 GGGCGGGGGGCGGCAGTGGCGGG + Intronic
1107603924 13:42040497-42040519 GGGCGGCGGGGGGGAGGGGCGGG + Intronic
1108751468 13:53452369-53452391 GCGCGCAGCGCGGGACTGGCAGG - Intergenic
1110436185 13:75481052-75481074 GGGCGAGCGGCGGGAGCGGCCGG - Intronic
1110436222 13:75481197-75481219 GGGAGCAGGGCGGGAGGGGCGGG - Intronic
1112041569 13:95552983-95553005 GGGCTGAGGGCGGGGGCCGCGGG - Intronic
1112271606 13:97975242-97975264 GGGGGGAGGGCGGGGGGGGCTGG + Intronic
1112506804 13:99980686-99980708 GCCGGGAGGGCGGGCGGGGCGGG + Intergenic
1112692777 13:101916204-101916226 ACGCGGAGGGCAGGAGCCGCCGG + Intronic
1113541970 13:111115808-111115830 GCGCGGAGCGGCGGCGCGGCCGG + Intronic
1113751239 13:112777838-112777860 GCGCATGGGGAGGGAGCGGCAGG - Intronic
1113775673 13:112943619-112943641 GCGCGGGGGGCGGGACCTGCCGG + Intronic
1113781276 13:112979003-112979025 GGGCAGAGGGTGGGAGCTGCTGG + Intronic
1114487260 14:23070214-23070236 GGGCGGGGGGTGGGAGCTGCAGG + Intronic
1115028326 14:28767206-28767228 GCGCGGCGGGCGGCGGCGACCGG - Exonic
1117828501 14:59727345-59727367 GCGAGGCGGGCGAGGGCGGCGGG + Exonic
1118030360 14:61812655-61812677 GCGCGGCGGGGGCGCGCGGCAGG + Intergenic
1118220809 14:63853241-63853263 GAGCCGGGGGCGGGGGCGGCGGG + Intronic
1118299378 14:64601718-64601740 GCGCAGGGGTCTGGAGCGGCTGG + Intergenic
1118312575 14:64704570-64704592 TGGCGGTGGGCGGGAGCGGTCGG + Exonic
1118463907 14:66013737-66013759 GCGCTGAGGGCGGGGGCGGCGGG + Intergenic
1118971485 14:70641862-70641884 GGGAGGAGGGCGGGAGCGGGCGG + Exonic
1119263152 14:73250127-73250149 GCCCGGAGGCAGGGAGGGGCTGG - Intronic
1119410282 14:74426091-74426113 GCGGGGCGGGCGGCGGCGGCGGG - Exonic
1120864396 14:89283610-89283632 GCGGGGAGGGTGGGAGTGGCGGG + Intronic
1120993557 14:90398109-90398131 GGGCGGGGGGGGGGGGCGGCGGG + Intronic
1121453727 14:94025609-94025631 GCGCGGGGGGCGGGGGCGGGGGG + Intergenic
1121456972 14:94044501-94044523 ACGCGAAGGGAGGGAGCGGAGGG + Intronic
1122065957 14:99174735-99174757 GCGCGGCGGGCGGCAGCTCCAGG + Exonic
1122329845 14:100904705-100904727 GGGCGGGGGGCGGGGGCTGCAGG + Intergenic
1122505468 14:102229118-102229140 GCGCGGGCCGCGGGTGCGGCAGG + Exonic
1122666682 14:103334721-103334743 GCGCGCGGGGAGGGGGCGGCCGG - Intronic
1122688607 14:103521471-103521493 GCGCTGCGGGCTGGAGGGGCGGG - Intronic
1122690311 14:103529129-103529151 GCGCGGAGGGGGGGAGGGGGAGG + Intergenic
1122817765 14:104321933-104321955 GCACTGGGGGCGGGGGCGGCTGG + Intergenic
1122838542 14:104443276-104443298 GTGGGGAGGGCCGGAGTGGCTGG - Intergenic
1122889046 14:104724209-104724231 GCGCGGACGCCGGCGGCGGCGGG + Intronic
1122908745 14:104815992-104816014 ACCCGGCGGGCGGGAGCGGATGG + Intergenic
1122913149 14:104843573-104843595 GCCAGGAGGGAGGGAACGGCGGG - Intergenic
1122917582 14:104865954-104865976 GCGCACAGGCCGGGAGAGGCAGG - Intronic
1123030798 14:105450192-105450214 GGGCCCAGGGCGGGAGCTGCTGG - Intronic
1123684337 15:22786633-22786655 GCTCGGAGGGCGGGCGCGGGCGG + Exonic
1124469320 15:29968962-29968984 GCGGCGGCGGCGGGAGCGGCCGG - Intergenic
1125814858 15:42575610-42575632 GCGCGTGGGGCGGGCGGGGCTGG + Intergenic
1126407015 15:48331889-48331911 GCGCGGGGGGCGGGGGGGGTGGG + Intronic
1126786214 15:52179689-52179711 GCGGGGACGGCGGGGGCGGTGGG - Intronic
1127269394 15:57387099-57387121 GCTCGCAGGGAGGGAGTGGCTGG - Intronic
1127342906 15:58065892-58065914 GGCCGGGGGGCGGGAGCGCCGGG - Exonic
1127763575 15:62164451-62164473 GCGCAGGAGGCGGCAGCGGCGGG + Exonic
1127855850 15:62953203-62953225 GAGCTGAGGGCGGGGGCGGGCGG - Intergenic
1128327427 15:66734084-66734106 GCCGGGAGGGAGGGAGAGGCCGG + Intronic
1128454252 15:67823682-67823704 GAGCAGAGCGCGGGGGCGGCGGG - Intronic
1128455079 15:67827565-67827587 GTGCGGGCGGCGGGGGCGGCGGG - Intronic
1128506645 15:68277730-68277752 GAGGAGAGGGCGGGAGCGGGAGG - Intergenic
1128635358 15:69299107-69299129 CCGCGGAGGGCGGGTGCGCGTGG - Intronic
1129162158 15:73752968-73752990 GAGGGGAGGGGGCGAGCGGCGGG + Intergenic
1129273828 15:74433082-74433104 GCGGGCAAGGGGGGAGCGGCCGG + Intronic
1129358791 15:75011585-75011607 AAGCAGAGGGCGGGAGCAGCTGG + Intronic
1129780177 15:78264732-78264754 GCGGGGGGGGCGGGCGAGGCCGG - Intronic
1130417110 15:83704125-83704147 GCGGGGAGGGGGAGAGAGGCAGG + Intronic
1130868655 15:87952939-87952961 ACGCGGAGGGCCGGCGTGGCTGG - Intronic
1131055317 15:89371464-89371486 GCGCTGCGTGTGGGAGCGGCCGG - Intergenic
1131225775 15:90623549-90623571 GAGCGCAGGGAGGGAGAGGCAGG - Intronic
1131257585 15:90872103-90872125 CCGGGGAGGGGAGGAGCGGCCGG + Intronic
1131263616 15:90902954-90902976 GCGCGGAGGCCGGGCGCTGACGG + Intronic
1131431730 15:92393821-92393843 GAGAGGAGGGAGGGAGGGGCAGG + Exonic
1131620968 15:94067661-94067683 GGGCGGGGGGCGGGGGCGGGGGG + Intergenic
1132055492 15:98648272-98648294 GCGGTGGGGGCGGGAGCGGGTGG + Intergenic
1132512744 16:352448-352470 GCGCGGCGGGCGGGACCCGGCGG + Exonic
1132531205 16:450818-450840 GCGGGGAGGGAGGGAGCGGGAGG - Intronic
1132544797 16:528104-528126 GCGGGGAGCGCGGGCTCGGCGGG + Intronic
1132741268 16:1414506-1414528 GCGCGGAGGCCGGGGGGCGCGGG + Intronic
1132814893 16:1820985-1821007 GCGGCGAGGCCGGGAGAGGCAGG + Intronic
1132831239 16:1929519-1929541 GCGCGGCCGGTGGGAACGGCAGG - Intergenic
1132834052 16:1943494-1943516 GCGCGAGGGGCGGCAGGGGCGGG - Intergenic
1132852089 16:2029394-2029416 GTGCAGAGGGAGGGAGCCGCTGG + Intronic
1132875614 16:2135661-2135683 GCCAGGCGGGCGGGCGCGGCGGG + Exonic
1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG + Intronic
1132968438 16:2673083-2673105 GCGCGGAGGGCGGGGGAGGCCGG - Intergenic
1133021595 16:2969322-2969344 GCCAGGAGGACGGGCGCGGCCGG - Exonic
1133212887 16:4272894-4272916 GGGAGGCGGGCGGGAGGGGCGGG + Exonic
1134519372 16:14911692-14911714 GCCAGGCGGGCGGGCGCGGCGGG - Intronic
1134539568 16:15054114-15054136 GCGCGGCGGGCAGGAGGGGAAGG - Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1134554561 16:15154536-15154558 GCCAGGCGGGCGGGCGCGGCGGG + Intergenic
1134707042 16:16310347-16310369 GCCAGGCGGGCGGGCGCGGCGGG - Intergenic
1134960498 16:18401777-18401799 GCCAGGCGGGCGGGCGCGGCGGG + Intergenic
1136111014 16:28063603-28063625 GCGCGGGGGGCGTGCGGGGCGGG + Intergenic
1136365111 16:29806243-29806265 GCGCGGAGGGGGGGTGGGACGGG - Intronic
1136414825 16:30096473-30096495 GCGCGGAGCGAGGAAGCGGGTGG + Intronic
1136532858 16:30881672-30881694 GAGCGGAGGGAGGGAGGGGCAGG - Intronic
1136550477 16:30979979-30980001 GGGCGGAGGGCGGCGGCGCCGGG - Exonic
1136672897 16:31874007-31874029 GGGCGGTGGTCGGAAGCGGCGGG + Intronic
1136768430 16:32811388-32811410 GCTCTGAGGGCGGGAGCGGCAGG - Intergenic
1137621039 16:49876720-49876742 GGGCGAGGGGCGGGAACGGCTGG + Intergenic
1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG + Intergenic
1138501484 16:57447613-57447635 GCGCGGAGGGGGCGCGAGGCCGG + Intronic
1138507693 16:57486376-57486398 GCGCGGCTGGCGGGGGCGGCAGG + Exonic
1139511554 16:67431048-67431070 GGGCGGGGAGCGGGAGGGGCGGG - Intronic
1139597841 16:67968568-67968590 GCTGGGACGGCGGGTGCGGCGGG - Exonic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1139917881 16:70439238-70439260 GGGCGGAGGGAGGGAGAGACGGG - Intergenic
1140122659 16:72096897-72096919 GCAGAGAGAGCGGGAGCGGCGGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141028753 16:80570600-80570622 GCGGGGAGGGTGGGAGTGGTGGG - Intergenic
1141608541 16:85169139-85169161 CGGCGGCGGGCGGGAGGGGCGGG - Intergenic
1141959058 16:87392480-87392502 GCGAGGGCGGCGGGTGCGGCGGG + Intronic
1142044214 16:87914710-87914732 GGGCGCAGGGCGGGAGCACCGGG + Intronic
1142132607 16:88437827-88437849 GTGCGGAGGCCGGGAGCGCCGGG + Exonic
1142160522 16:88555079-88555101 GCGGGGAGGCTGGGAGCTGCAGG - Intergenic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142252584 16:88999575-88999597 GGGCGGAGGGCGGGGGGGGGCGG + Intergenic
1142252626 16:88999667-88999689 GGGCGGAGGGAGGGGGCGGGGGG + Intergenic
1142395282 16:89828394-89828416 GCGCGGAGGGCGCGGGGGGCGGG - Intronic
1203070822 16_KI270728v1_random:1073404-1073426 GCTCTGAGGGCGGGAGCGGCAGG - Intergenic
1142631720 17:1229859-1229881 CGGGGGAGGGCGGGAGCTGCGGG + Intergenic
1142637794 17:1268602-1268624 CGGGGAAGGGCGGGAGCGGCCGG + Intergenic
1142670579 17:1485849-1485871 GCGCGGGAGGCGGGGGAGGCCGG - Intronic
1142741094 17:1932427-1932449 GGGCTGAGGGCGGCCGCGGCTGG + Intergenic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1143750508 17:9023428-9023450 GGGCCGCGGGCGGGAGCTGCTGG + Intronic
1143863106 17:9905357-9905379 TTGTGGAGGGCGGGAGCGGTGGG + Exonic
1144950047 17:18989163-18989185 GCTCGGAGGGTGGGAGGGGTGGG - Intronic
1145041285 17:19579909-19579931 ATGCGGAGGCTGGGAGCGGCTGG - Intergenic
1146057691 17:29589414-29589436 GCGTGGGGGGCGCGGGCGGCGGG + Exonic
1146167431 17:30600832-30600854 GCGGGGTTGGCGGGGGCGGCGGG - Intergenic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1146895184 17:36535485-36535507 GCGCGGGAGGCGGAAGCGGCTGG + Intronic
1147168605 17:38605715-38605737 GCGCGGGGGGCGGGGGCCCCGGG + Exonic
1147184361 17:38705550-38705572 GGGGGGAGGGAGGGAGCGGGGGG - Exonic
1147187944 17:38722735-38722757 GCGGGGAGGCCAGGAGCTGCTGG - Exonic
1147382224 17:40062783-40062805 GGGCGGGGGGCGGGGGCGGGCGG + Intronic
1147648907 17:42050783-42050805 GCGCGTGGGGCGGCAGGGGCTGG - Intronic
1147677707 17:42219269-42219291 GCGGGCAGGGCAGGAGGGGCTGG - Intronic
1147688329 17:42300302-42300324 GCGGGCAGGGCAGGAGGGGCTGG + Intronic
1147864861 17:43545618-43545640 GTGCGGCCGGAGGGAGCGGCCGG - Exonic
1147921227 17:43918179-43918201 GCGCTGAGGGTGGGAGAGGCCGG - Intergenic
1147926933 17:43952288-43952310 GCGCCCAGGGCTGGAGTGGCTGG - Intergenic
1147970896 17:44218858-44218880 GCCCGGGAGGGGGGAGCGGCGGG - Intronic
1147994714 17:44354420-44354442 GCCCGGGGGGCGAGGGCGGCGGG - Exonic
1147996812 17:44363977-44363999 GCGCAGAGCGCGGGGGCTGCGGG - Intergenic
1148698947 17:49576747-49576769 GCGGGGAGGGAGGGAGCGGGAGG - Intronic
1148945898 17:51261062-51261084 GCGCGGAGGGTCGCAGCTGCGGG + Intronic
1150003189 17:61454747-61454769 GAGCGCAGGGCGCGAGCCGCAGG + Intronic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150283462 17:63942799-63942821 GCGGGGCGGGCTGGACCGGCAGG - Intronic
1150373512 17:64661891-64661913 GCGGGGGCGGCGGGGGCGGCGGG + Exonic
1150561900 17:66302279-66302301 GGGAGGAGGCCGGGAGTGGCGGG - Intergenic
1150562059 17:66302778-66302800 GCCGGGTGGGCGGGGGCGGCGGG - Intronic
1150643555 17:66964866-66964888 GCGCGGCGGGCCGGGCCGGCGGG + Intergenic
1150692747 17:67378853-67378875 GCGCGCGAGCCGGGAGCGGCGGG + Intronic
1151296799 17:73192314-73192336 GCGGGCTGGGCGGGAGAGGCTGG - Intergenic
1151457029 17:74232476-74232498 GCGCGGTGAGCTGGGGCGGCTGG + Intronic
1151969890 17:77452125-77452147 GCGGGGAGGGAGGGTGCTGCTGG + Intronic
1152008486 17:77696747-77696769 AGGCGGAGGGAGGGAGAGGCTGG + Intergenic
1152229354 17:79106737-79106759 GGTCGGAGGGGTGGAGCGGCTGG + Exonic
1152293828 17:79455268-79455290 GAGCGGAGAGGGGGAGAGGCAGG + Intronic
1152361970 17:79837017-79837039 GCGAGGAGGGGAGGAGCAGCCGG - Intronic
1152541935 17:80981176-80981198 GCGCGGAGGGCAGCAGAGACTGG - Intergenic
1152695229 17:81740885-81740907 GCACGCAGGGCGGGAGGCGCGGG + Intergenic
1152703959 17:81833350-81833372 TGGCGGAGGGCGGGGGCGGCCGG + Intergenic
1152714337 17:81891347-81891369 GCGCGGCCGGCGGAGGCGGCAGG - Exonic
1152728767 17:81960055-81960077 GCGGGGAGCGCGGGAGGCGCGGG + Intronic
1152789895 17:82273276-82273298 GGGCGGCGGGCGGGGGCGGCGGG + Intronic
1152821586 17:82440282-82440304 GCGCGGAGAGCGGGACCCGCAGG + Intronic
1153457599 18:5296538-5296560 GCGCGGAGGGCGAAAGTGGCCGG - Intronic
1153805366 18:8705501-8705523 GTGCGGGGGGCGGGGACGGCGGG + Intergenic
1153805369 18:8705510-8705532 GCGGGGACGGCGGGAGCGCGGGG + Intergenic
1154151315 18:11908615-11908637 TCGCGGAGGGCGCTAGGGGCCGG - Exonic
1155153004 18:23136650-23136672 GCGGGGAGGCTGGGAGCGCCGGG - Intronic
1155392753 18:25352396-25352418 GCGCGGGGTGTGCGAGCGGCCGG - Intergenic
1156083917 18:33376280-33376302 GCGGGGAGGGCGTGAGCAGGAGG + Intronic
1156452648 18:37275306-37275328 GGCCGGAGGGGGAGAGCGGCAGG + Intronic
1157384123 18:47247701-47247723 GCGCCGAGGGCGGCTGAGGCGGG + Intronic
1157483857 18:48073411-48073433 GCGGGGAGGGCGGGAGGTGGTGG + Intronic
1158435943 18:57435670-57435692 GCGGGGGCGGCGGGGGCGGCCGG - Exonic
1158976624 18:62716137-62716159 GCGGGGAGGCCGGCAGCGCCGGG - Exonic
1159670148 18:71212523-71212545 CGGCGGGGGGCGGGGGCGGCGGG + Intergenic
1160095236 18:75865890-75865912 GCGGGGAGGGAGGTAGCTGCAGG - Intergenic
1160500762 18:79400272-79400294 GCGGGGACGGGGGGAGGGGCGGG + Intronic
1160708888 19:541771-541793 GGGCCCAGGGTGGGAGCGGCCGG + Exonic
1160710443 19:548847-548869 GGGCGGGGGGCGGCAGCGGGGGG - Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160904747 19:1446832-1446854 GCGCTGGGGTCGGGAGCGGACGG - Intronic
1160937827 19:1605492-1605514 GCGGGGAGGGCGGGGGGGGGGGG + Intergenic
1161022188 19:2015680-2015702 TGGCGGCGGGTGGGAGCGGCGGG - Exonic
1161165152 19:2782969-2782991 GCGAGGACGGCGGGAGGGGAAGG - Intronic
1161664644 19:5568008-5568030 GGGCGGAGCGCGGGCGCGGCGGG - Intergenic
1161668976 19:5594036-5594058 GCGCATGGAGCGGGAGCGGCTGG - Exonic
1161677664 19:5661569-5661591 GCGCGAGGAGCGTGAGCGGCTGG + Exonic
1161702928 19:5804960-5804982 GCGGGGAGGGCGGGGAGGGCCGG + Intergenic
1162021161 19:7869237-7869259 GTGCCGCGGGCGGCAGCGGCGGG - Exonic
1162040077 19:7965587-7965609 GTGGGGAGGGCGGGAGAGTCTGG - Intronic
1162471189 19:10872512-10872534 GCGGGGACGGTGGGAGCCGCAGG + Intronic
1162499159 19:11041573-11041595 GCGGGGAGGGCGGGGGCTGTAGG + Intronic
1162776603 19:12983629-12983651 GCGCGCAGGGAGGGCGGGGCGGG - Intergenic
1163423306 19:17227025-17227047 GCACGGAGGGCGGGGGGCGCTGG - Exonic
1163551182 19:17967176-17967198 GCGCGGGGCCCGGGGGCGGCGGG - Intronic
1164755443 19:30685750-30685772 GGGAGGACGGCGGCAGCGGCTGG - Intronic
1165296131 19:34927251-34927273 CCGGCGAGTGCGGGAGCGGCAGG + Exonic
1165311350 19:35030867-35030889 GCGCGGGGGGCGCGCGCGGCCGG + Intronic
1165916820 19:39265629-39265651 GCACTGAGGCTGGGAGCGGCGGG + Intergenic
1165939864 19:39409707-39409729 CCGCGGGAGGCGGGAGGGGCCGG + Intergenic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166230336 19:41422774-41422796 GTGCTGACGGGGGGAGCGGCAGG - Intronic
1166316798 19:41993984-41994006 GCGCGGGGGGCGGGGGCACCGGG - Intronic
1166385026 19:42376004-42376026 CCGCGGCGTGCGGGACCGGCTGG + Exonic
1166734497 19:45076132-45076154 GCGAGGAGGGCGGCCCCGGCGGG + Exonic
1166807281 19:45494815-45494837 GCCCTGGGGGCGGGGGCGGCGGG + Exonic
1166809404 19:45506823-45506845 GCGAGGAGTGCGGGAGTGGGGGG - Intronic
1167258311 19:48443712-48443734 GCGAGGTGGGCGCGGGCGGCGGG - Exonic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167448962 19:49556131-49556153 GAGCGGAGGGGGGGAAGGGCGGG + Intronic
1167577890 19:50326479-50326501 GCGCCGGGGGAGGGAGCGGGGGG - Intronic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1167743430 19:51337867-51337889 GGTCTGAGGGCTGGAGCGGCTGG + Intronic
1167748413 19:51366386-51366408 GCGCGGGGGGCGGGGGTGGTGGG - Intronic
1168150480 19:54444823-54444845 GCGCAGAAGGTGGGAGGGGCTGG + Intergenic
1168343901 19:55641276-55641298 GGGTGGGGGTCGGGAGCGGCAGG + Intronic
1168344523 19:55643806-55643828 GGGCGGGCGGCGGGAGGGGCTGG + Intronic
1168408161 19:56121303-56121325 GCGGCGCGGGCGGAAGCGGCCGG - Intergenic
924958418 2:11380-11402 GCGCGGAGCGTGGGGGTGGCGGG + Intergenic
924962452 2:46573-46595 GCGATGAGGTCGGGAGGGGCGGG - Intronic
925609790 2:5693143-5693165 GCGCGGCCGGCGGCGGCGGCGGG + Exonic
926077212 2:9951321-9951343 GCGGGGACGGCGGGGGCGGCGGG + Intergenic
927896394 2:26785480-26785502 GCGGGGACGGCGGGATCGGCGGG - Intronic
927904593 2:26847877-26847899 GAGCGGACGGAGGGCGCGGCCGG - Intronic
927945782 2:27134413-27134435 GCGCGCCGGGCGGGATGGGCCGG - Exonic
928549520 2:32357291-32357313 GCGGCGGGGGCGGGGGCGGCCGG + Exonic
928904826 2:36357003-36357025 GCGGGGAGGGCGGTAGGGCCGGG - Intronic
928998744 2:37324847-37324869 GCGCGGGGGGCGGGGGCGCGCGG + Intergenic
929033682 2:37671732-37671754 GGGCGGAGGGCGCGGGCAGCGGG + Exonic
929756335 2:44768646-44768668 GCGGGCAGGGCTGGAGGGGCAGG - Intronic
930688116 2:54330734-54330756 GCGAGGAGGGCGGGGGTGCCTGG - Intronic
931671544 2:64653314-64653336 GAGCGGCGGGCGGGGGCGCCTGG - Intronic
932567725 2:72920131-72920153 GTGCGGAGGGCGTCAGGGGCTGG - Intronic
933909894 2:86930323-86930345 GCGCGGAGGCGGGGGGCGGGGGG + Intronic
934022832 2:87973065-87973087 GCGCGGAGGCGGGGGGCGGGGGG - Intergenic
934853167 2:97713818-97713840 GTGCGGAGAGTGTGAGCGGCAGG + Intronic
934856481 2:97733232-97733254 GGGCGGTGGGCGGGGGCGGCAGG + Intronic
935592764 2:104856353-104856375 GCGCGTGGTGCGGGTGCGGCGGG - Exonic
935971478 2:108534353-108534375 GGGGGAGGGGCGGGAGCGGCTGG - Intronic
936432988 2:112481046-112481068 GTGCGGAGGGCGAGAGGGCCAGG + Intergenic
937208609 2:120252947-120252969 GTGCGGACGGCGGAGGCGGCGGG + Exonic
937288411 2:120767355-120767377 GCGCTGGGGGCGGGGGCGGGTGG + Intronic
937439835 2:121906321-121906343 GCGGGGAGTGGGGGAGCGGGGGG - Intergenic
937991176 2:127663399-127663421 GAGTGGAGGGCGGGAACTGCAGG - Intronic
938311181 2:130288891-130288913 GCGAGGAGGCCGGGGGCGCCTGG + Intergenic
938451478 2:131425106-131425128 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451483 2:131425119-131425141 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451488 2:131425132-131425154 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451493 2:131425145-131425167 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451498 2:131425158-131425180 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451503 2:131425171-131425193 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451508 2:131425184-131425206 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451513 2:131425197-131425219 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938451518 2:131425210-131425232 GCGCGGGAGGCGGGCGCGGGAGG + Intergenic
938934638 2:136117448-136117470 AGGCAGAGGGCGGGAGAGGCGGG - Intronic
939990880 2:148875925-148875947 GAGAGGCGGCCGGGAGCGGCGGG + Intronic
942404263 2:175636289-175636311 GGGCGGAGGGCGGGGGTGGGGGG + Intergenic
942450907 2:176107603-176107625 GCGCGGGGGGCGGCAGCAGCGGG + Exonic
942456305 2:176140691-176140713 CCGGGGAGGGCGGGAGCGGAGGG + Intergenic
943646080 2:190408688-190408710 GGAGGGAGGGAGGGAGCGGCGGG - Intronic
944831191 2:203535232-203535254 GCGCGCGGCGCGGGAGCTGCTGG - Exonic
946248095 2:218398568-218398590 GCGCGGGGGCCGGGAGGGGAAGG - Intronic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
946865673 2:224039347-224039369 GGGCCGGGGGCGGGGGCGGCAGG - Intergenic
947641082 2:231708159-231708181 GCGGGGAGGGCGGGAGAGGGAGG + Intronic
947860486 2:233354458-233354480 GCGGGGCCGGCGGGAGGGGCGGG - Intergenic
948645321 2:239400691-239400713 CCGCGGCGGGCGGCGGCGGCCGG + Exonic
949004294 2:241636841-241636863 ACGCGGGGGGCGGGGGCGCCGGG - Intronic
949014622 2:241702278-241702300 GCGCGGGGGGCGGGCGCGGGGGG + Intronic
1169164111 20:3407678-3407700 GCGCGGCGCGCGGGCCCGGCGGG + Intergenic
1169557557 20:6767495-6767517 GGGCGGAGGGCGGGGGCGCGCGG - Intergenic
1170756801 20:19212478-19212500 GCGGGGGCGGCGGGGGCGGCCGG - Intergenic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1172520959 20:35565149-35565171 GAGCGCTGGCCGGGAGCGGCAGG - Intergenic
1173672912 20:44810413-44810435 GCGGGGCTGGCGGGCGCGGCGGG + Intergenic
1174287262 20:49482488-49482510 GCAGGGGGGGCGGGGGCGGCCGG - Exonic
1174330448 20:49813088-49813110 ACGAGGAGGGCGGGATGGGCGGG + Intronic
1174576736 20:51542530-51542552 GGGGCGAGGGCGGGCGCGGCTGG + Exonic
1175210453 20:57350879-57350901 GCGGGGGGGGCGGGGGGGGCGGG + Intergenic
1175429366 20:58891220-58891242 GCTGGGAGGGCGGGAGCCGGCGG - Intronic
1176046026 20:63093053-63093075 GCGAGGAGGGCGGGAGGCGGAGG - Intergenic
1176110856 20:63410104-63410126 GCCAGGAGGGCGGGAGGGGACGG + Intronic
1176162166 20:63653465-63653487 GGGCGGGAGGCGGGCGCGGCGGG + Intergenic
1176163180 20:63658869-63658891 GGGCAGAGGGCTGGAGAGGCAGG + Intronic
1176194566 20:63831285-63831307 GCGCGGGCGGCGGGGGCCGCGGG - Intergenic
1176549597 21:8215345-8215367 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1176550515 21:8219029-8219051 CCGCGGTCGGCGGGAGAGGCCGG - Intergenic
1176557488 21:8259574-8259596 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1176568522 21:8398379-8398401 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1176569445 21:8402068-8402090 CCGCGGTCGGCGGGAGAGGCCGG - Intergenic
1176576433 21:8442608-8442630 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1176577357 21:8446299-8446321 CCGCGGTCGGCGGGAGAGGCCGG - Intergenic
1176952536 21:15064538-15064560 TCGCGGGGGGCCGGGGCGGCGGG - Intronic
1177431696 21:20998284-20998306 GCGGGGAGGGCGGCGGGGGCGGG - Intergenic
1178992677 21:37367807-37367829 GAGCGGCGGGCGCGAGCGGAGGG + Intronic
1179626892 21:42653930-42653952 GCGCCGGGGCCGGGCGCGGCGGG + Intronic
1179951069 21:44709073-44709095 GCTGGGAGTGCGGGAGCTGCAGG - Intronic
1180014852 21:45075086-45075108 GCGGGGAGGGCAGGTGCGCCGGG + Intronic
1180059037 21:45375312-45375334 GTGGGGAGGGAGGGAGGGGCTGG + Intergenic
1180156246 21:45978469-45978491 GAGAGGAGGGGGGGAGCGGAGGG + Intergenic
1180170956 21:46057905-46057927 GCGCGGGGGACAGGAGCCGCGGG - Intergenic
1180201747 21:46228816-46228838 GCGGGAGGGGCGGGAGGGGCGGG - Exonic
1180201752 21:46228825-46228847 GCGGGAGGGGCGGGAGGGGCGGG - Intergenic
1180201757 21:46228834-46228856 GCGGGAGGGGCGGGAGGGGCGGG - Intergenic
1180910697 22:19447883-19447905 GCGCGGAGGGCCGGGGTCGCAGG + Exonic
1181052990 22:20246469-20246491 GCGAGGAGGGCAGGAGCAGAGGG + Intronic
1181366444 22:22380571-22380593 GCGCGGGGGGCGGGGGTGGGCGG + Intergenic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182087768 22:27573465-27573487 GGGCGGGGGGCGGCAGCGGGGGG - Intergenic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1182355262 22:29719945-29719967 GCGCGGAGGGGGCGGGCGGGCGG + Intergenic
1183545914 22:38454884-38454906 GCGGGCGGGGCCGGAGCGGCGGG + Intronic
1183598359 22:38825725-38825747 GCGGGGAGGGCCCGAGGGGCTGG + Intronic
1183788406 22:40045198-40045220 GCGCGCGGGGCTGGTGCGGCCGG + Intronic
1184276558 22:43412180-43412202 GCGCGGCGGGCGCGGGCGGGAGG + Intronic
1184697961 22:46150375-46150397 GCCCGGAGGGCGCGCGGGGCGGG + Intergenic
1184754241 22:46507462-46507484 CCGGGGAGGGAGGGAGCCGCTGG - Intronic
1185078246 22:48694787-48694809 GGGCGGAGGTCTGGAGCGGTGGG - Intronic
1203254483 22_KI270733v1_random:131666-131688 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1203255412 22_KI270733v1_random:135370-135392 CCGCGGTCGGCGGGAGAGGCCGG - Intergenic
1203262539 22_KI270733v1_random:176745-176767 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
949414241 3:3799301-3799323 GCGCCGAGGGCGGGGGCGGGAGG + Intronic
949938528 3:9136137-9136159 GCGAGGAGGGCGGGCGGGGAAGG - Intronic
949970000 3:9396754-9396776 GCGCGGGGCGCGGGGGTGGCGGG - Intergenic
950153867 3:10708122-10708144 GCAGGGAGGGCGGGAGGGGGAGG - Intergenic
950345411 3:12288090-12288112 GCGCGGAGGGCTGGGGCCGAGGG + Intronic
950400979 3:12768933-12768955 GCGGGGGGGGCGGGGGGGGCGGG + Intronic
952867073 3:37861676-37861698 GAGTGGAGGGCGGGAGGGGGCGG - Intergenic
953404652 3:42654464-42654486 GCGCGGCGGGCGGGGGGCGCGGG - Intronic
953562065 3:43999251-43999273 TCGCGGGGGGCGGGGGCGGGCGG - Intergenic
954031768 3:47824974-47824996 GCGAAGAGAACGGGAGCGGCCGG - Intronic
954632496 3:52055146-52055168 GCGGGGCGGGCGGGAGGGGAGGG - Intronic
954632880 3:52056520-52056542 GCGCGGAGGGCCGGGCGGGCGGG - Exonic
954687055 3:52376778-52376800 GAGGGGAGGGCGGGTGCAGCGGG - Intronic
954693967 3:52410450-52410472 GCGCGGATGGTGGGAGAGGAGGG + Intergenic
954795895 3:53161270-53161292 GCGCGGCGGGCGGGCGCCGGGGG - Exonic
955186056 3:56716596-56716618 GCGGGGGGGGCGGGGGGGGCTGG - Intergenic
955407651 3:58635634-58635656 GGCCGGTGGGCGGGGGCGGCCGG - Intronic
959849636 3:111071659-111071681 GCGGGGAGGGCGGGCGAGTCGGG + Intronic
960955175 3:123026668-123026690 GCGAGGAGGGAGGGAGCGGGGGG - Intronic
960960420 3:123067041-123067063 ACTCGGAGGCGGGGAGCGGCTGG + Intronic
961006589 3:123409819-123409841 GCTTGGAGGGTGGGAGGGGCCGG - Intronic
961077041 3:123992048-123992070 GCGGGGAGGGCAGCAGCGGCCGG + Intronic
961307535 3:125969252-125969274 GCGGGGAGGGCAGCAGCGGCCGG - Exonic
961827529 3:129606763-129606785 GCGCCGGGGTCGGGGGCGGCTGG - Exonic
961858203 3:129893496-129893518 GCGGGGAGGGGAGGAGCAGCCGG + Intronic
962277920 3:134029846-134029868 GCGCCTCGGGCTGGAGCGGCCGG + Exonic
962498476 3:135965934-135965956 GCGCGGAGGCCGGGGCGGGCGGG + Intronic
962970027 3:140391370-140391392 GGGGGGTGGGCGGGAGGGGCGGG + Intronic
964570564 3:158105026-158105048 GGGCGGGGGGGGGGGGCGGCGGG - Intronic
966355108 3:179071646-179071668 GCGCGCAGGGCGGGCGTCGCGGG - Exonic
966874660 3:184315135-184315157 GCCCGGAGGGCGGGCGGGGCCGG - Intronic
968063976 3:195748013-195748035 GGGCGGAGCGCGGGTGGGGCGGG - Intronic
968069814 3:195777952-195777974 GGGAGGAGGGCGGGAACAGCTGG - Intronic
968479244 4:826346-826368 GGGCGGGGGGCGGGGGCGGGGGG + Intergenic
968517950 4:1022717-1022739 GGGTGGAGGGCGGGAGCCGAAGG + Intronic
968534362 4:1113852-1113874 GCGCCGAGGGCGGGGGATGCGGG + Intergenic
968550943 4:1223139-1223161 GGGCAGAGGTCGGGAGGGGCCGG - Intronic
968571969 4:1346803-1346825 GCGCCGGGGGCGGGGCCGGCCGG - Intergenic
968653032 4:1767476-1767498 ACACCGAGGCCGGGAGCGGCCGG - Intergenic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968817237 4:2828429-2828451 GGAAGGAGGGAGGGAGCGGCAGG - Intronic
968940555 4:3635290-3635312 GGGCGAAGGGCGGGAGCAGCGGG + Intergenic
969239282 4:5888481-5888503 GCGAGGAGGGCGGGAGAAGGAGG + Intronic
969364816 4:6688193-6688215 GCGAGGAAGGAGGGAGCAGCAGG + Intergenic
969379420 4:6783692-6783714 GCGCGGGGGGCGGGCCTGGCGGG + Intronic
969597607 4:8158058-8158080 TCCCGGAGGGTGGGTGCGGCGGG + Intronic
970195074 4:13544417-13544439 GCGCCGCGGGCAGGAGCGGCCGG + Exonic
970332927 4:15003456-15003478 GCGGCGAGGGAGGGAGCTGCGGG - Exonic
972129643 4:35816154-35816176 GGGCTGGGGGAGGGAGCGGCGGG - Intergenic
972396622 4:38663991-38664013 GCGCGGGAGGCGGGGGTGGCGGG + Intergenic
973265694 4:48208114-48208136 GAGCAGAGGGTGGGAGTGGCAGG + Intronic
973820552 4:54658401-54658423 GCGCGGGGGGCGGAGGCGGGGGG + Intronic
976297345 4:83485222-83485244 GGGCTGAGGGCGGGCGCGGGCGG + Intronic
977941978 4:102869000-102869022 GCGCCGGGAGCGGAAGCGGCCGG - Exonic
981504293 4:145482401-145482423 GCGCGGAAGGGGAGCGCGGCCGG - Intronic
981550574 4:145937665-145937687 GCGGGCGAGGCGGGAGCGGCTGG - Intronic
981713563 4:147732026-147732048 GCGCGGGGGCCGGGCGGGGCGGG + Intergenic
984778812 4:183505724-183505746 GGTCGGAGGGAGTGAGCGGCCGG + Intronic
984999656 4:185471206-185471228 GCGGGGAGGGCGGGGAGGGCGGG + Intronic
985114726 4:186579180-186579202 GCCCGGAGGGCTGGAGCACCAGG - Intergenic
985129320 4:186724750-186724772 GCCCGGAGGGCCGGAGGCGCTGG + Intronic
985544473 5:502267-502289 GGGTGGGGGGCCGGAGCGGCTGG - Intronic
985660711 5:1155518-1155540 GCGCGGCGGGCGGCAGGGGCGGG + Intergenic
985660853 5:1155904-1155926 GCGGGGAGGGCGGGGCCGGCGGG + Intergenic
985727647 5:1524255-1524277 GCGGGGAGGGAGGAAGGGGCGGG + Intergenic
985743508 5:1633767-1633789 GCGCGGGAGGCGGGAGATGCCGG + Intergenic
985780386 5:1867899-1867921 GCGGGGACGGCGGGGACGGCGGG - Intergenic
985780390 5:1867908-1867930 GCGGGGACGGCGGGGACGGCGGG - Intergenic
985780394 5:1867917-1867939 GCGGGGACGGCGGGGACGGCGGG - Intergenic
985837014 5:2278930-2278952 GCGAGGGTGGTGGGAGCGGCGGG + Intergenic
985896385 5:2751865-2751887 GGGCGGCGGGAGGGACCGGCAGG + Intergenic
985995645 5:3595715-3595737 GCGGGAGGGGCGGGAGCGGCCGG + Intergenic
986152479 5:5140265-5140287 GCGGGGGCGGCGGGAGCGGTGGG - Intergenic
987258162 5:16179176-16179198 GGGCGGCGAGCGCGAGCGGCGGG - Exonic
990308605 5:54517797-54517819 GCGCGGAGGGCGCGACCGGCTGG + Exonic
990509964 5:56481136-56481158 GCGCGGCGGGCGCGCGGGGCTGG - Intronic
991298191 5:65103096-65103118 GCCCGGAGGCGGGGCGCGGCGGG - Intergenic
991351245 5:65722298-65722320 GCGAGGCGGGCGGCAGCGCCTGG - Exonic
991371679 5:65925968-65925990 GCGCAGGGGGCGGGAGCAGGAGG - Intergenic
992105611 5:73447504-73447526 GCGCGTAAGGCGGCAGCTGCAGG + Exonic
992320913 5:75612316-75612338 GGGCGGAGGGCGGGGGGGGGCGG - Intronic
995512307 5:112921748-112921770 GCGCGGTGGGCGCGGACGGCGGG - Intronic
996379022 5:122845461-122845483 GCCCAGGGCGCGGGAGCGGCCGG + Exonic
998200222 5:140113298-140113320 GTGCGGGGAGGGGGAGCGGCGGG + Intronic
998262082 5:140639402-140639424 GCGGGGAGGGCGCGAGGAGCGGG - Intronic
998262133 5:140639587-140639609 GCGCCGCCGGCGGGAGCGGGAGG + Exonic
1001586196 5:172834951-172834973 GGGCTGAGGGAGGGAGGGGCGGG - Intronic
1002103323 5:176868110-176868132 GCCCTGGGGGCGGGAGGGGCAGG - Exonic
1002160404 5:177311356-177311378 GTGAGGAGGCCGGGGGCGGCGGG - Intronic
1002788874 6:424289-424311 GCGGGGAGGGCGGGACAGTCCGG - Intergenic
1002788891 6:424327-424349 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002788909 6:424365-424387 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002788927 6:424403-424425 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002788945 6:424441-424463 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002788963 6:424479-424501 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002788999 6:424555-424577 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002789017 6:424593-424615 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002789035 6:424631-424653 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002789071 6:424707-424729 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002789089 6:424745-424767 GCGGGGAGGGCGGGAAGGCCCGG - Intergenic
1002844705 6:936274-936296 GTGCGGGGGCCGGGAGGGGCTGG - Intergenic
1002888170 6:1313418-1313440 GGGCGGCGGGCGCGGGCGGCGGG - Exonic
1003087127 6:3068933-3068955 GCGCGGCGGGCGGGCCCCGCCGG + Intronic
1003175605 6:3750960-3750982 CCGAGGAGGGCGGGGGCGCCCGG - Intronic
1004043951 6:12009163-12009185 GGGCGGAGGGCCGGGGCCGCGGG + Intronic
1004044402 6:12011644-12011666 GCGGGGAGGGGCGAAGCGGCGGG + Intronic
1004044749 6:12012616-12012638 GGGCGGAGGGGGGGGGGGGCAGG + Intronic
1004070430 6:12292362-12292384 GCGCGGTGGGTGAGAACGGCGGG + Exonic
1004123148 6:12845432-12845454 GCACGGAGGGCGGGGGGGGGGGG - Intronic
1004206500 6:13596432-13596454 GTGGGGAGGGCTGGAGTGGCTGG - Intronic
1004615039 6:17281419-17281441 GCGCGGCGGGGGCGAGCGGCCGG - Exonic
1004627929 6:17393942-17393964 GCGCGGGGCGCGGGCGCGGGCGG + Intronic
1004720622 6:18264779-18264801 GCGGGGCGGGCGGGAGCGGGAGG + Exonic
1006103744 6:31703322-31703344 GCAGGGAGGGCGGGGCCGGCAGG - Exonic
1006670819 6:35728743-35728765 CCTCGGAGGGAGGGAGAGGCAGG + Intergenic
1006860696 6:37170101-37170123 GCGCGCGGGGAGGGCGCGGCGGG - Intergenic
1007444514 6:41895023-41895045 GCGCCCGGGGCGGGGGCGGCGGG - Intronic
1008521090 6:52362625-52362647 GCCCGGAGGGCGGGAGATTCAGG + Intronic
1009431892 6:63573494-63573516 GCGCGGAGAGGGGGCGCAGCGGG + Intronic
1010980547 6:82364875-82364897 GCCCGGAGGGCGCGAGCCGGCGG - Exonic
1011470376 6:87701990-87702012 GAGCGGACGGCGGGGGCGGCCGG - Exonic
1011517064 6:88166318-88166340 GCGCGAGCGGAGGGAGCGGCAGG - Exonic
1012928285 6:105289952-105289974 GGGCGGAGGGGGAGAGTGGCAGG + Intronic
1014137743 6:117907923-117907945 GCGCGGGGGGCGGGGGCTGCGGG + Intronic
1015149107 6:130019310-130019332 GCGGGGGGCGCGGGGGCGGCCGG + Intronic
1015315014 6:131807934-131807956 CCGCGAGGGGCGGGCGCGGCGGG + Intergenic
1015440454 6:133241336-133241358 GCGCGGAAGCCGGGAACGGCCGG - Exonic
1015525859 6:134175149-134175171 GCGGGGAGGGCCGGAGAGCCCGG + Intronic
1016462011 6:144286977-144286999 GCGCGGAGCTCGGGGGAGGCCGG + Intronic
1017497680 6:154995689-154995711 CCCCGGAGGGCGGCAGCGTCCGG + Intronic
1019058739 6:169241068-169241090 GCAGGGAGGGCGGCAGGGGCAGG - Intronic
1019216799 6:170449002-170449024 GCGCAGAGGACGGGAAAGGCTGG + Intergenic
1019309615 7:353656-353678 GCCTGGAGGGTGGGAGCGGGGGG + Intergenic
1019343000 7:517345-517367 GCGGGGAGGGCGCGGGCGGGCGG - Intronic
1019473410 7:1232992-1233014 GCGCGGGGGGCCGGCGGGGCCGG - Exonic
1019473506 7:1233296-1233318 GCGCGGCGGGCGGGAGGGCGGGG + Intronic
1019473719 7:1234020-1234042 GCGAGGAGGGGAGGAGGGGCCGG + Intronic
1019485587 7:1287905-1287927 GCGTCGAGGGTGGGAGCCGCAGG - Intergenic
1019523945 7:1472407-1472429 TGCAGGAGGGCGGGAGCGGCAGG + Intronic
1019531302 7:1504699-1504721 TCCCGGAGAGCGGGGGCGGCCGG + Intergenic
1019536143 7:1530868-1530890 GCGCGGAGGGCGCGGGCGCGCGG - Exonic
1019620067 7:1987564-1987586 TCGGGGAGGGGGGGAGAGGCAGG + Intronic
1019828198 7:3301164-3301186 GCGCGGGCGGCGCGTGCGGCCGG + Intergenic
1019927383 7:4202338-4202360 ACTCGGAGGGCGGCAGCGGGAGG - Intronic
1021093347 7:16508522-16508544 GGGGGGAGGGAGGGAGAGGCGGG + Intronic
1021719244 7:23490427-23490449 GTGCAGAGGGCGGGGGCGGGCGG + Intergenic
1021845268 7:24757367-24757389 GCGCGGCGGGCGCGGGCTGCGGG - Intronic
1022310892 7:29194853-29194875 CCGCGGAGGCTGCGAGCGGCCGG + Exonic
1022715143 7:32891875-32891897 GCGGGGGCGGCGGGGGCGGCGGG - Exonic
1022715179 7:32891969-32891991 GTGGCGAGGGCGGGCGCGGCAGG - Intronic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023319285 7:38976009-38976031 GCGCGGATGGCGTGAGCCCCGGG - Intergenic
1023638778 7:42237871-42237893 GCGAGGCGGGCGGCGGCGGCTGG + Intergenic
1023875852 7:44285865-44285887 GCGCGGCGGGGGGGCGCGGCGGG + Intronic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1024472219 7:49775635-49775657 GGGACGAGGGCGGCAGCGGCCGG + Exonic
1024579992 7:50793489-50793511 GCGGGGAGGGCGGGCGGGGCCGG - Intergenic
1024639335 7:51316777-51316799 GCGCGGCGGACGGAAGGGGCTGG + Exonic
1025069760 7:55887791-55887813 GGGCGGAGGCGGGGGGCGGCGGG + Intronic
1026665508 7:72337054-72337076 GCGCGGCCAGCGGGAGCGGGAGG - Intronic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1026840541 7:73668100-73668122 GCGCGGGGGGCTCGAGCGGGGGG + Intronic
1026968278 7:74453887-74453909 GAGCGGAGAGCGGGAGCGCGGGG - Intronic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1027230216 7:76267944-76267966 GGGCTGAGGGAGGGAGGGGCTGG - Intronic
1027232613 7:76281565-76281587 GCGCGGCGGGCGGGGCGGGCAGG + Exonic
1027233035 7:76282905-76282927 GGGCGGCGGGGTGGAGCGGCCGG + Intronic
1027361513 7:77415578-77415600 GTGCGGAGCTCGGGGGCGGCTGG + Intronic
1027592579 7:80134820-80134842 GCGCGGAGGCCGAGCTCGGCTGG + Exonic
1028160063 7:87475562-87475584 GGGCGCGGGGCGGGAGTGGCCGG - Intronic
1028417463 7:90595938-90595960 GGGAGGAGCGCGGGGGCGGCCGG + Intronic
1029123163 7:98281644-98281666 GCGGGGCGGGCGCGAGCCGCGGG - Intronic
1029273797 7:99392646-99392668 GCGCGGAGGGCGGGGGCCATTGG - Intronic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029535270 7:101154327-101154349 GCGGGGAGCGCGGGCGGGGCTGG - Intergenic
1029537097 7:101163307-101163329 GGGCGGGGGGCGGGGGCTGCGGG + Exonic
1029539110 7:101172673-101172695 GCGGGGAGGGGGGGCGCAGCAGG + Intronic
1029625491 7:101718140-101718162 GCGCAGGGGGCTGGACCGGCTGG - Intergenic
1030055841 7:105583161-105583183 GCGCTGAGGGCGGGGGCGGCGGG + Intronic
1030348247 7:108456458-108456480 GCGGAGAGGGCGGGAGCGGCGGG - Intronic
1031025157 7:116672085-116672107 GCGCGGACGGCAGGAAGGGCGGG + Intergenic
1031586343 7:123535140-123535162 GCGTGGAGGAGGGAAGCGGCAGG + Intergenic
1032020736 7:128406048-128406070 GCGAGAAGGGCGGGAGGGGCGGG - Intronic
1032068831 7:128791624-128791646 CCGCGGAGGCCGGGAGCACCTGG - Intronic
1032128308 7:129210562-129210584 GCGGGCAGGGCAGGAGGGGCTGG - Intronic
1034200893 7:149282278-149282300 CCGTGGCGGGCGGGGGCGGCAGG - Exonic
1034466376 7:151232420-151232442 GCGCGGGCGGAGCGAGCGGCCGG + Intergenic
1034522742 7:151632632-151632654 GCGGGGAGGGGGAGAGGGGCTGG + Intronic
1034560436 7:151876447-151876469 GCGCCGGGGACGGGAGCGACAGG + Intronic
1034618083 7:152436050-152436072 GCGGGGCGGGCGGGGCCGGCGGG + Intergenic
1034967077 7:155398245-155398267 GGGCGGGGGGCGGGGGGGGCGGG + Intergenic
1035171038 7:157017720-157017742 GCGGGGAGGGTGGGAGCAGAGGG - Intergenic
1035289030 7:157825334-157825356 GGGCTGAGGGCTGGAGCGGCAGG + Intronic
1035533945 8:376970-376992 GTCCGGAGGGCGGGGGCTGCGGG + Intergenic
1036195290 8:6708535-6708557 GGGCGGAGGCTGGGAGCGGGTGG + Exonic
1036677970 8:10850799-10850821 AGGCGGTGGGCGGGGGCGGCGGG + Intergenic
1036811118 8:11868161-11868183 GCGCGGGCGGCGGGAGGGCCCGG - Exonic
1037807416 8:22066429-22066451 GCGGGGAGGGCAGGTGCGGCGGG + Intronic
1037820153 8:22131332-22131354 GAGCAAAGGGCGGGAGGGGCCGG + Exonic
1038176298 8:25184584-25184606 GCGGCGCGGGCGGGAGAGGCCGG + Intergenic
1038267134 8:26046098-26046120 GGGCTGAGTGCGCGAGCGGCCGG + Intergenic
1038540264 8:28385627-28385649 GCGCGGGGCGCGGGAGGGCCGGG + Intronic
1039064884 8:33599419-33599441 AGGCGGAGGGAGGGAGCGGCGGG - Intronic
1039554633 8:38467588-38467610 GGGAGGAGGGCGGGAGTGGGCGG - Intronic
1041068060 8:54101578-54101600 CCGCGGGGGGCGGGGGCAGCCGG - Intronic
1041690154 8:60679659-60679681 GAGCGGGGGGCGGGGGCGGGAGG - Intronic
1042785037 8:72537182-72537204 GCGCGGAGCGCGGGAGGAGGCGG + Intergenic
1043303337 8:78762445-78762467 GAGGGGAGGGCTGGACCGGCCGG - Intronic
1043502770 8:80873742-80873764 ACGAGGAGGGCGGGAGCAGGCGG - Intronic
1043847300 8:85177548-85177570 GCGCCGGGGGCGGCAGCAGCAGG + Exonic
1044675028 8:94719934-94719956 ACGCGGAGGGAGGGAGAGTCTGG + Exonic
1045489072 8:102655696-102655718 GCGCTGAGCGCGGCGGCGGCGGG - Exonic
1048234368 8:132675388-132675410 CAGCGCAGGGCGGGAGCGGGCGG + Intronic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049083212 8:140458172-140458194 GCGAGGAGGGAGGGAGGGACCGG + Intronic
1049218242 8:141417547-141417569 GTCCGGAGGGCAGGAGCCGCCGG - Intronic
1049292563 8:141812395-141812417 GCGGGGAGGGCGGGGAGGGCGGG + Intergenic
1049292567 8:141812404-141812426 GCGGGGAGGGCGGGGAGGGCTGG + Intergenic
1049398985 8:142416389-142416411 GCGCCGGGGGCGGGAGGCGCTGG + Intergenic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049558540 8:143296013-143296035 GCGCAGAGGGCGGGGGCAGCTGG + Exonic
1049614087 8:143568789-143568811 GCGCGGAGCGAGGAAGCGGCGGG + Intronic
1049625560 8:143618199-143618221 GAGCTGAGGGCAGGAGCAGCTGG - Intergenic
1049791035 8:144472833-144472855 GCACGGAAGGCAGGGGCGGCCGG + Exonic
1050151532 9:2622695-2622717 CCGGGGAGTGCGGGAGCGGACGG + Intronic
1051774791 9:20621980-20622002 GCGAGGAGGGAGGGAGGCGCGGG + Intronic
1052837790 9:33264623-33264645 GCGAGGCGACCGGGAGCGGCTGG - Exonic
1053181258 9:35972266-35972288 GGGCGGCGTGGGGGAGCGGCGGG + Intergenic
1053482224 9:38424191-38424213 GAGCCGAGGGCGCGAGCTGCGGG - Exonic
1054731435 9:68705625-68705647 GCGGGAGGGGCGGGAGGGGCGGG - Intronic
1054891702 9:70258871-70258893 CGGCGGAGCGCGGGAGGGGCGGG + Intergenic
1055030643 9:71768982-71769004 GCGGGGCCGGCGGGAGGGGCCGG - Intronic
1056163548 9:83921266-83921288 GCTGGGGGCGCGGGAGCGGCGGG + Intronic
1057259666 9:93576673-93576695 GCGGGGGCGGCGGGGGCGGCGGG - Exonic
1057489250 9:95508800-95508822 GCGCGGCCGGCGGGAGCAGCGGG - Intronic
1057773098 9:97984228-97984250 GCGCGGAGCGGGGGAGGGGCGGG + Intronic
1058058544 9:100473228-100473250 GCGCGGCGGGCGGGGGTCGCGGG - Exonic
1058110698 9:101028694-101028716 GGGCGGAGGAGGGGAGAGGCGGG - Exonic
1060106778 9:120877435-120877457 GCGGGGCGGGCGGGGGCGGGCGG - Intronic
1060358322 9:122931408-122931430 GCGGAGACGGCCGGAGCGGCGGG - Intronic
1060757201 9:126222689-126222711 GCGAGGAGGTGGGGAGCGGTAGG + Intergenic
1060825076 9:126683170-126683192 GCGAGGAGGCCGGGGGAGGCCGG + Intronic
1060832127 9:126723258-126723280 GCGGGGAGGGAGGGAGCGGTGGG - Intergenic
1060856035 9:126915268-126915290 GCGCGGGGGGCGGGGCCGGGGGG + Intronic
1060856056 9:126915319-126915341 GTGCGGGGGGCGGGGCCGGCGGG + Intronic
1060945825 9:127568984-127569006 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1060979746 9:127785481-127785503 GGGAGGAGGGCGGGGGCGGGCGG + Intergenic
1060979921 9:127785984-127786006 GGGCGGCGGGCGGAAGAGGCGGG + Intronic
1061042051 9:128145996-128146018 GAGGGGAGGTCGGGAGCAGCCGG + Intergenic
1061075777 9:128340649-128340671 GCGCGGCGGGCGGGGCCGGGCGG + Intronic
1061405713 9:130392062-130392084 GCTGGGAGAGCGGGAGGGGCAGG - Intronic
1061449326 9:130660064-130660086 GGGCGGAGGAGGGGAGCGGCCGG + Intergenic
1061497228 9:130981934-130981956 GAGTGGAGGGCGGGGGCCGCAGG - Intergenic
1061559478 9:131393829-131393851 CCGGGGACGGCGGGAGAGGCGGG - Intergenic
1061580282 9:131531767-131531789 GCACGGAGCGGGGGGGCGGCAGG - Intergenic
1061610026 9:131739984-131740006 GCGGGCGCGGCGGGAGCGGCTGG - Intronic
1062022279 9:134325357-134325379 GTGCGGAGGGAGGGCGCGGCGGG + Intronic
1062218657 9:135402840-135402862 GCACGGAGGGTGGGAGAGGGTGG - Intergenic
1062560393 9:137139097-137139119 GCGGGGGCGGCGGGAGGGGCAGG + Intronic
1062574624 9:137200431-137200453 GCGCGGAGGGCGCGCACGCCAGG + Exonic
1062584188 9:137241595-137241617 GCGCGGGGCGGGGGAGGGGCGGG + Intronic
1062587170 9:137254667-137254689 GGGCGGCGGGCTGGAGAGGCGGG + Intergenic
1203470884 Un_GL000220v1:114810-114832 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1203471810 Un_GL000220v1:118505-118527 CCGCGGTCGGCGGGAGAGGCCGG - Intergenic
1203478705 Un_GL000220v1:158782-158804 GCGCGGCGGGCGAGACGGGCCGG - Intergenic
1185457586 X:318613-318635 GGGCGGAGGGCGGGGCCTGCGGG - Exonic
1187053753 X:15720276-15720298 GGGCGGAGGGCGGCTGAGGCAGG - Intronic
1187281437 X:17860926-17860948 GCCCGGAGGCCGGGGCCGGCTGG - Intronic
1187419514 X:19122441-19122463 GCCCCGAGGACGCGAGCGGCAGG - Exonic
1187419580 X:19122634-19122656 GCGCGGAGGTGGGGAGCGGGCGG + Intronic
1187888065 X:23907630-23907652 GCGGGGAGGGCTCGGGCGGCCGG + Intronic
1189821321 X:44872775-44872797 CCGCGGCGGGCGCGAGCGGCGGG - Intergenic
1189821446 X:44873264-44873286 GCGGGGACGGCGGGAACGGCCGG - Intronic
1189853589 X:45200786-45200808 GGGCGGAGGGCGGCAGCCTCAGG + Exonic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1190385522 X:49879591-49879613 GCGGGGAAGGCGGAGGCGGCGGG + Intergenic
1192609606 X:72554500-72554522 GCGGGGAGGGCGGGGAGGGCGGG + Intronic
1192762240 X:74105467-74105489 CCGCGGAGGGCCGTAGCCGCAGG + Intergenic
1195252655 X:103063810-103063832 GAGCGGGGGGCGGGAGACGCGGG - Intronic
1197885505 X:131213605-131213627 GTGTGGAGGCGGGGAGCGGCGGG - Intergenic
1198100440 X:133417353-133417375 CTGGGGAGGGCGGGGGCGGCGGG - Intergenic
1198267347 X:135022021-135022043 GCGCGGAGGGAGGGCGCCGGTGG + Exonic
1198268542 X:135032800-135032822 GCGCGGAGGGAGGGCGCCGGTGG - Exonic
1198312324 X:135435047-135435069 GCGGGAAGAGCAGGAGCGGCTGG + Intergenic
1198312814 X:135437419-135437441 GCGCAGTGAGCGGGAGCGCCAGG + Intergenic
1198519879 X:137441872-137441894 GCGCTGAGACCGGAAGCGGCGGG + Intergenic
1199832980 X:151562862-151562884 GGGCGGGGGGCGGGGGGGGCGGG + Intergenic
1200128744 X:153830160-153830182 GTGGGGAGGCCCGGAGCGGCGGG - Intronic
1200213290 X:154356410-154356432 GTGCGCAGGGCGGGGGAGGCTGG - Intronic