ID: 1146716849

View in Genome Browser
Species Human (GRCh38)
Location 17:35093506-35093528
Sequence CCTCATGCCCTGGAGCTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146716849_1146716856 19 Left 1146716849 17:35093506-35093528 CCGTACAGCTCCAGGGCATGAGG 0: 1
1: 0
2: 4
3: 19
4: 185
Right 1146716856 17:35093548-35093570 ATCATTCATGGCAAATGTCATGG 0: 1
1: 0
2: 0
3: 19
4: 168
1146716849_1146716854 7 Left 1146716849 17:35093506-35093528 CCGTACAGCTCCAGGGCATGAGG 0: 1
1: 0
2: 4
3: 19
4: 185
Right 1146716854 17:35093536-35093558 AGAGAGAACTCCATCATTCATGG 0: 1
1: 0
2: 0
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146716849 Original CRISPR CCTCATGCCCTGGAGCTGTA CGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901006033 1:6171913-6171935 CCTCAGGCCCTGGAGGGTTAGGG - Intronic
902708559 1:18223127-18223149 CCTCAAGCCCTGAGGCAGTAGGG + Intronic
903542205 1:24102907-24102929 CCTCCAGCCCTGGGGCTGGACGG + Intronic
903544873 1:24117794-24117816 CCGCATACCCTGGAGCTGGCTGG - Intergenic
903682032 1:25103591-25103613 CCACATGCCCTGAGGCTGAAAGG + Intergenic
905131299 1:35760542-35760564 CCTCATGCCCTGGAGGGTGAAGG - Exonic
909100154 1:71340203-71340225 CCTGATGGCCTTGAGCTGAAAGG - Intergenic
910342784 1:86207388-86207410 CCTCATCCCCAGAAGCTGCAGGG + Intergenic
912691909 1:111810983-111811005 CCTGAGGCCCTGAAGCTGGAGGG - Intronic
913686184 1:121234290-121234312 CCACAGGCCCTAGAGGTGTATGG + Intronic
914038036 1:144021912-144021934 CCACAGGCCCTAGAGGTGTATGG + Intergenic
914151418 1:145046028-145046050 CCACAGGCCCTAGAGGTGTATGG - Intronic
915941792 1:160123124-160123146 TCCCATGCCCGGGAGCTGAAGGG + Intronic
916030153 1:160869647-160869669 CCTAGTGCCCTTGAGCTCTAAGG + Intergenic
916561834 1:165940412-165940434 GCTCAGGGCCTGGAGCAGTAGGG + Intergenic
918233923 1:182560540-182560562 CCTGCAGCCCTGGAGGTGTATGG - Exonic
920473507 1:206252849-206252871 CCACAGGCCCTAGAGGTGTATGG + Intronic
921080800 1:211737242-211737264 CCTCAAGGCCTGAAGCTGAAAGG - Intergenic
923115355 1:230931781-230931803 CATCATTCCCCGGAGCTGGAGGG + Exonic
923674011 1:236064898-236064920 TCTCCTGCCCTGGAGCTGAGTGG - Exonic
1062848541 10:726201-726223 CCTCATGGCCAGCAGCTGTGGGG + Intergenic
1063845063 10:10118587-10118609 CCTCCTGCCCTGGAGCGGAAAGG - Intergenic
1068537341 10:58255116-58255138 GCTGATGCCATAGAGCTGTAGGG - Intronic
1069844778 10:71363273-71363295 CCTCATGACCTGGTGGTCTATGG + Exonic
1070664881 10:78336017-78336039 CCTGGTGCCCTGGAGCTCTGGGG + Intergenic
1070683351 10:78464689-78464711 TCTCATGCCCTTGAGCTTCAAGG - Intergenic
1076384774 10:130048232-130048254 CCTGCTGTCCTGCAGCTGTAGGG - Intergenic
1077270779 11:1678670-1678692 CCTGCTGCAATGGAGCTGTAGGG - Intergenic
1079699567 11:23527000-23527022 CCTTATATCCTGTAGCTGTAGGG + Intergenic
1080440332 11:32288432-32288454 CCTCTTGCAAAGGAGCTGTAAGG + Intergenic
1081811260 11:45915434-45915456 CCCCAAGCCCTGGAGCGGAATGG - Intronic
1083267162 11:61551984-61552006 CCTTGTGCCCTGGGGCTGTAAGG + Intronic
1084203492 11:67577399-67577421 CCTGATCCCCTGGGGCTGCATGG - Intergenic
1085094972 11:73753132-73753154 CCTCAGCCTCTGGAGCTGTTGGG - Intronic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1087007288 11:93482538-93482560 CTTCCTGCCCTGTAGCTGTCAGG - Intronic
1087032713 11:93722037-93722059 CCTTATTACCTGGATCTGTAAGG - Exonic
1088100006 11:106144406-106144428 CCTGATGGCCTTGAGCTGAAGGG + Intergenic
1090684403 11:129099962-129099984 CCTCTTCCCCGGGAGCTGTTGGG - Intronic
1090844087 11:130516582-130516604 CCTCATTCCCTGCAGCTCCAGGG - Intergenic
1090951662 11:131478946-131478968 CCTCAAGTCCTGGAGCTGCGTGG - Intronic
1092041948 12:5393074-5393096 CCTCCTGCCCTGTGGCTGTACGG + Intergenic
1092242733 12:6845488-6845510 CGGCTTGCCCTGGAGCTGTCAGG + Intronic
1094352052 12:29537766-29537788 CCTCAGAAACTGGAGCTGTAGGG - Intronic
1095600532 12:44008023-44008045 CCTTAGGCCCTGCAGCAGTATGG + Intronic
1096386915 12:51200158-51200180 CCTCATTTCCTGGCCCTGTAAGG + Intronic
1097691497 12:62738683-62738705 CCTGATGCCTGGGAGCTGTTGGG - Intronic
1100189928 12:92179647-92179669 CCCCATGACCTGGCTCTGTATGG + Intergenic
1103763392 12:123266535-123266557 GCTCATCCCTTGGAGATGTAGGG + Intronic
1104993510 12:132640250-132640272 CTCCCTGCCCAGGAGCTGTAAGG + Intronic
1104998331 12:132673088-132673110 CCAAATGCACTGGAGCTGAATGG - Intronic
1105456324 13:20544490-20544512 CCTGATGTCCTGGAGCTGCGGGG - Intergenic
1105923048 13:24982972-24982994 CCTCATGCCTTGGGGCTGACTGG + Intergenic
1111463481 13:88576597-88576619 CTTCATGCCCTAGGGATGTATGG - Intergenic
1113537773 13:111081888-111081910 CCTCATGCCCAGATGCTGTGGGG - Intergenic
1113666186 13:112143375-112143397 CCAGATGCCCTGGACCTGGAGGG - Intergenic
1113767618 13:112890873-112890895 CCTCATGGGCTCCAGCTGTATGG - Intergenic
1115834242 14:37379967-37379989 CCTAATGACCTTGAGCTATATGG + Intronic
1117209708 14:53482797-53482819 GCTCATGCCCTAGAGCTCTGTGG - Intergenic
1119544199 14:75459860-75459882 CCTGATGGACTGGGGCTGTAAGG + Intronic
1123833606 15:24166363-24166385 CCCCATTCTCTGGAGCTTTATGG + Intergenic
1124319554 15:28702899-28702921 CCCCAGGCCCTGGGGCTGCAGGG + Intronic
1126270823 15:46815060-46815082 CCTTATGTCCTGTAGCTGCAAGG - Intergenic
1129111602 15:73340292-73340314 CCTCAGGCCCTGGAGGAGTAAGG + Intronic
1131144381 15:90001817-90001839 CCTCATGCCGGAGAGCTGGAGGG + Intronic
1131346317 15:91652038-91652060 CCTCATGCCCTTGACCTTAAGGG - Intergenic
1132977252 16:2716899-2716921 CCTCCAGCCCTGGCACTGTAAGG + Intronic
1133297551 16:4762312-4762334 CCTGATGCCGGGGAGCTGGAGGG + Exonic
1137528966 16:49264352-49264374 CCTCACGCCCTGGCTCTGTGGGG - Intergenic
1137719314 16:50618682-50618704 CATCCTGCCCTGGGGCTGTGGGG - Intronic
1141263663 16:82476147-82476169 CCTCATGCCCTGCAGGTGAAAGG - Intergenic
1141677319 16:85524592-85524614 CCTCATGCCCTGGGCCGGGAGGG + Intergenic
1141811855 16:86381262-86381284 CCTCTTTCCCTAGAGCTGCAAGG + Intergenic
1142780637 17:2178796-2178818 ACTCATGCCGTGGAGATGTCAGG - Intronic
1144022927 17:11252766-11252788 CCACATGCCCTGTCGCTGCAGGG - Intronic
1144824879 17:18100197-18100219 CCCAATGCCCTAGAGCTGCAGGG - Intronic
1145970842 17:28955644-28955666 CCTCATGCCCTGGACCAGCCTGG - Exonic
1146316321 17:31809930-31809952 CCTCATTCCTTGCAGCTGAATGG + Intergenic
1146716849 17:35093506-35093528 CCTCATGCCCTGGAGCTGTACGG - Intronic
1146949241 17:36894338-36894360 CCTCATGCCCTGAAGCATGAGGG + Intergenic
1147935143 17:44006797-44006819 CCTCCTGTCCAGGAGCCGTAGGG + Intronic
1150314068 17:64154060-64154082 CCTCATGTTCTGGAACTGTGGGG - Intronic
1152535654 17:80949112-80949134 CCCGATGCCCTGGAGCTGGAGGG + Intronic
1154162544 18:11990832-11990854 CCCAAGGCCCTGCAGCTGTAAGG - Intronic
1157769923 18:50337086-50337108 CCTGATGGCCTTGAGCTGAAGGG - Intergenic
1159444273 18:68521531-68521553 CTTTATGCCCTTGAGATGTAGGG + Intergenic
1160130166 18:76218354-76218376 CCTCATGCACTGGAACTGGAAGG - Intergenic
1162463842 19:10829456-10829478 GGTCCTGCCCTAGAGCTGTAGGG - Intronic
1163722696 19:18905804-18905826 CCTCAGGCCCAGGAGCTCTGGGG + Intronic
1164590667 19:29505155-29505177 GCTCAGGCCCAGGAGCTGCAGGG - Intergenic
1164648767 19:29877097-29877119 CCTCAGGCTCTGGAGTAGTAGGG + Intergenic
1165328245 19:35126448-35126470 GCTGAGGCCCTGGAGCTGGACGG - Exonic
1166204440 19:41259871-41259893 CCTCCTGCCCTGGGGCTGCTGGG - Exonic
1166837053 19:45673899-45673921 CCTCGTGCCCTGGAGCTGAAGGG + Intronic
1167341335 19:48918310-48918332 CCTGAAGCCCTGCAGCTGTGGGG + Intronic
925152240 2:1622917-1622939 CCTCTTCCCCTGCAGCTCTAGGG + Intergenic
926365727 2:12131378-12131400 GCTCATGCTCTGCACCTGTATGG - Intergenic
926759816 2:16268502-16268524 CCTCTTGCCCTGGTGCTAAATGG + Intergenic
933068920 2:77833804-77833826 CCTGATGGCCTTGAGCTGAAGGG + Intergenic
934970257 2:98757761-98757783 CCACAAGCCCTGGAGATGCAGGG - Intergenic
939911594 2:147989954-147989976 CCCCATCTGCTGGAGCTGTAAGG - Intronic
941077548 2:161022980-161023002 CCTCCTTCCCTGGATATGTAGGG + Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943689311 2:190852891-190852913 CCTCATGCCCTGGAGCAGGAGGG + Intergenic
946330642 2:219007042-219007064 CCTCGTGCCCTGGAGCTTTGTGG + Intronic
946490531 2:220145000-220145022 CTTCATTCCCAGGGGCTGTAGGG - Intergenic
947306439 2:228753550-228753572 CCTCATGCCCTGGAGTTGAAAGG + Intergenic
947533286 2:230926030-230926052 TCTCATGCCCTGGAGGTGCTGGG + Intronic
948387530 2:237590939-237590961 GCTCCTTCCTTGGAGCTGTATGG + Exonic
948480614 2:238247950-238247972 CCTCATGGCTTGGACCTGTGTGG + Intronic
948677836 2:239609492-239609514 CCTGGTGGCCTGGAGCTGTGGGG + Intergenic
1170451152 20:16485225-16485247 ACTCATGCCCTGGAGTTGAATGG - Intronic
1170783745 20:19449706-19449728 CCACATGCCTTGGAGCTTTAGGG + Intronic
1171311635 20:24149744-24149766 GCTCATCCCCTGAAGCTGCAAGG + Intergenic
1174415494 20:50363619-50363641 GCTCATGCTCTGAAGCTGCAGGG + Intergenic
1175931724 20:62496691-62496713 CCTAAAGCCCTGGCGCTGTCTGG - Intergenic
1176073129 20:63236998-63237020 CCACATGGTCTGCAGCTGTAGGG - Intronic
1178522050 21:33294640-33294662 CCTCCTGGCATGGACCTGTAGGG - Intronic
1179403946 21:41110199-41110221 CCTCGTTCTCTGGAGCTATATGG + Intergenic
1179975725 21:44864823-44864845 CCTCATGCCGTGGAGGCTTAGGG + Intronic
1181489937 22:23255393-23255415 CTTCAAACCCTGGAGCTGTGTGG - Intronic
1182345190 22:29658220-29658242 GCTCAGGACCTGGAGATGTACGG + Exonic
1183187033 22:36298110-36298132 CCTCATCCCCTGCAGATGTGAGG + Intronic
1183312732 22:37119826-37119848 CCACATGCCCTTGAGCTACAAGG + Intergenic
1183683476 22:39349013-39349035 CCTGCTGCCCTGTAGCTCTATGG - Intergenic
1184004836 22:41700153-41700175 CCTCATTCCCTTCAGCTGTCGGG + Intronic
1184017298 22:41795727-41795749 TCCCATGCTCTGGAGCTGCAGGG - Exonic
1184206246 22:43005525-43005547 CCTCCTGCCCTGGCCCTGCATGG - Intronic
1184479737 22:44739303-44739325 CCTCCTGCCCTGGGGCAGGAGGG + Intronic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
950397173 3:12742493-12742515 CCCCATGCCCAGGACCTGGATGG + Exonic
953407667 3:42667503-42667525 CCCCATGCTCTGGGGCTGTGGGG - Intergenic
959480372 3:106865173-106865195 CCTCAAGGCCTGCAGCTGCAGGG + Intergenic
959800692 3:110491664-110491686 CCTTATGACCCAGAGCTGTATGG - Intergenic
959803033 3:110518079-110518101 CAACATGCACTGGAACTGTATGG + Intergenic
961487528 3:127227301-127227323 CTTCCTGCCCTGGAGCTGCGAGG - Intergenic
961662545 3:128477363-128477385 CCTCCTGCTCTGGGGTTGTAGGG + Intergenic
963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG + Intergenic
966420847 3:179732863-179732885 CCTCAGACCCTGGAGATGTAAGG - Intronic
970855658 4:20647665-20647687 CCTGATGGCCTTGAGCTGAAGGG - Intergenic
972017168 4:34261974-34261996 CCTCATGCCCTCCAGTGGTAGGG + Intergenic
972415167 4:38832490-38832512 TCACATGCCCTGGGGCTGTCTGG + Intronic
973530388 4:51831870-51831892 CTTCAGGCCCTGGAGTTGCAGGG + Intergenic
975013352 4:69381176-69381198 CCTCATCCCCTGAAACTGAAAGG + Intronic
976444593 4:85116213-85116235 CCTCAAGGCCTGGAGGTGAATGG + Intergenic
980419599 4:132542583-132542605 CCTGATGACCTTGAGCTGAAGGG + Intergenic
981526042 4:145707916-145707938 CCTGATGGCCTTGAGCTGAAGGG - Intronic
982726818 4:158915327-158915349 CCTCATGTCCTGGATATGCAAGG - Exonic
983262625 4:165473903-165473925 CCTAATGGCCTTGAGCTGAAGGG - Intronic
984864499 4:184270190-184270212 CCACATACCCTGCAGCTGAATGG + Intergenic
984896832 4:184548727-184548749 CATCATTCCCTGGAGCTGGAGGG - Intergenic
985631762 5:1017685-1017707 GCTCAGGCCCTGGGGCTGCAGGG - Intronic
988171425 5:27661901-27661923 GCTCATGCCGTTGAACTGTAGGG + Intergenic
991523078 5:67522717-67522739 GTTCATGTCCTGGAGTTGTAAGG + Intergenic
992101298 5:73410163-73410185 CATCATGCCCAAGAGCTGAAGGG + Intergenic
992305159 5:75429526-75429548 CCTCCTGCCCTGGACCAGTGTGG + Intronic
995482638 5:112608263-112608285 CCTGATGGCCTTGAGCTGAAGGG + Intergenic
997613142 5:135229221-135229243 CCTCCTGCCCTGATCCTGTATGG + Intronic
998498170 5:142609106-142609128 CCTCCTGCCCTGTTGCTTTAGGG - Intronic
998767017 5:145499623-145499645 CCTCAGGCCCTGCAGATGTCAGG - Intronic
999293665 5:150444374-150444396 CGTCATTGCCTGGAGCTGGATGG + Intronic
999640965 5:153672833-153672855 CCCCAAGCCATGGAGCTGAAAGG + Intronic
1002128630 5:177065435-177065457 CCTCATGCCCGCTAGCTGTGAGG + Exonic
1002314453 5:178334065-178334087 CCCCATGCCCTGGGGATGTCCGG + Intronic
1002605381 5:180379989-180380011 CCTCAAACCCTGGACCTGTGGGG + Intergenic
1004903794 6:20217749-20217771 CCTAATGCCCTGGAGCCGCTGGG + Intergenic
1007625679 6:43244964-43244986 CCTGATGCTCTGAAGTTGTAAGG + Intronic
1010952596 6:82054956-82054978 CCTCATCCCCAGGAACTGTGTGG + Intergenic
1011176990 6:84574640-84574662 CCTTATTTCCTGGAGCTGTATGG + Intergenic
1012985805 6:105875230-105875252 CTTCTAGCCCTGGAGCTGTATGG - Intergenic
1016547146 6:145237125-145237147 CTCATTGCCCTGGAGCTGTATGG - Intergenic
1016675921 6:146767848-146767870 CCTCATGAGCTAGAGCTGTCTGG - Intronic
1016774240 6:147886864-147886886 CCTCATAGCTTGTAGCTGTAGGG - Intergenic
1017186420 6:151605380-151605402 GTTCATGCCCAGGAGATGTATGG + Intronic
1017955404 6:159173566-159173588 CATCATGCTCTGGAACTGTCTGG - Intronic
1018746352 6:166765059-166765081 CCACCTGCCCTGGAGCTGGCAGG - Intronic
1019033207 6:169031398-169031420 CCTCCTGCCCTGTGGCTGAAGGG + Intergenic
1019645139 7:2124926-2124948 TCTCCTGCCCTGGGGCTGGAAGG - Intronic
1023551493 7:41374578-41374600 CCTCATTCCTTGGAGGTGCAGGG - Intergenic
1024715015 7:52069135-52069157 CCTCATGACCTGGAGGTATGTGG - Intergenic
1028833005 7:95346140-95346162 CCTGATGACCTTGAGCTGAAGGG + Intergenic
1030164657 7:106541762-106541784 CCTCTTGCCATGGAGCTTTTGGG - Intergenic
1039475150 8:37835699-37835721 CCTCCCGCCCTGGAGCTGCTGGG + Exonic
1043931989 8:86101768-86101790 TCTCATCCCCTGACGCTGTATGG - Intronic
1044659137 8:94578530-94578552 CCTGATGACCTTGAGCTGAAGGG - Intergenic
1047537073 8:125729696-125729718 CCTCATGCCCTGGAATTGTCTGG - Intergenic
1048707097 8:137165983-137166005 TCTCATCTCCTGCAGCTGTATGG + Intergenic
1049203720 8:141353765-141353787 CCCCCTGCCCTCCAGCTGTAAGG + Intergenic
1049261047 8:141639393-141639415 CCTCCTGCCCAAGAGCTGCAGGG - Intergenic
1049371880 8:142271785-142271807 CCTCTGCACCTGGAGCTGTATGG + Intronic
1049555613 8:143279938-143279960 CCTAAAGCACTGGAGCTGCAGGG + Intergenic
1051618280 9:19027535-19027557 CCTCCTGGCCTGGGCCTGTAGGG + Intronic
1054095998 9:60903275-60903297 GCTCCTGCCCTGGAGATGTGTGG + Intergenic
1056488643 9:87084089-87084111 GTTCATGACCTGGGGCTGTACGG + Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1060726230 9:126007643-126007665 GCTCATGCCCTAGAGCTGGAGGG - Intergenic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1062149439 9:135009960-135009982 CCTCCTGCCCTGAAGGTGTGGGG + Intergenic
1186107311 X:6221558-6221580 CCTCATGCCCTGAAGCTACATGG - Intronic
1188482897 X:30653116-30653138 CCCCATGCCATGCAGCTGGATGG + Intergenic
1194147260 X:90279766-90279788 CCTCATGGCTTTGAGCTGAAGGG - Intergenic
1194649923 X:96502197-96502219 TCTCATACCCAGGATCTGTAAGG - Intergenic
1199591248 X:149470081-149470103 CATCATGCCCTGGTTCTGGAAGG - Intergenic
1200493664 Y:3856534-3856556 CCTCATGGCTTTGAGCTGAAGGG - Intergenic
1202174560 Y:22085507-22085529 GCTCATGGCCTGGAGCTCTCAGG - Intronic
1202216800 Y:22500875-22500897 GCTCATGGCCTGGAGCTCTCAGG + Intronic
1202326387 Y:23695195-23695217 GCTCATGGCCTGGAGCTCTCAGG - Intergenic
1202544385 Y:25974859-25974881 GCTCATGGCCTGGAGCTCTCAGG + Intergenic