ID: 1146719483

View in Genome Browser
Species Human (GRCh38)
Location 17:35113704-35113726
Sequence GAATCAGGAGTGGTAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 464}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146719483_1146719488 1 Left 1146719483 17:35113704-35113726 CCAGCCTCTACCACTCCTGATTC 0: 1
1: 0
2: 3
3: 28
4: 464
Right 1146719488 17:35113728-35113750 ATTCTTCCCATTGAGATCAGAGG 0: 1
1: 0
2: 0
3: 23
4: 185
1146719483_1146719491 14 Left 1146719483 17:35113704-35113726 CCAGCCTCTACCACTCCTGATTC 0: 1
1: 0
2: 3
3: 28
4: 464
Right 1146719491 17:35113741-35113763 AGATCAGAGGAACCCCAGTGTGG 0: 1
1: 0
2: 0
3: 13
4: 188
1146719483_1146719494 27 Left 1146719483 17:35113704-35113726 CCAGCCTCTACCACTCCTGATTC 0: 1
1: 0
2: 3
3: 28
4: 464
Right 1146719494 17:35113754-35113776 CCCAGTGTGGTCCCCAGACCAGG 0: 1
1: 0
2: 6
3: 30
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146719483 Original CRISPR GAATCAGGAGTGGTAGAGGC TGG (reversed) Intronic
900792993 1:4691856-4691878 GGCTCAGGAGGGGAAGAGGCAGG - Intronic
902668519 1:17955822-17955844 GAAGCAGGAGAGGGACAGGCCGG - Intergenic
903622536 1:24708246-24708268 GAAGGAAGAGAGGTAGAGGCTGG + Intergenic
903678372 1:25080950-25080972 GAATGAGGAGTGCAGGAGGCAGG - Intergenic
903728387 1:25470297-25470319 GGGTTAGGAGTGGTTGAGGCTGG + Intronic
903969607 1:27110050-27110072 AACTCAGGAGTGGCAGAGCCAGG - Intronic
904307788 1:29601390-29601412 GAAGTAGGAGTGGCAGAGGTTGG - Intergenic
904812001 1:33169444-33169466 GCAGCAGGAGAGCTAGAGGCAGG - Intronic
904813292 1:33178150-33178172 GAAACAGGAGAGGGAGAGGGAGG - Intronic
904818918 1:33227743-33227765 GAAACAGGAATGGTAGAGCCAGG - Intergenic
905646194 1:39626537-39626559 GACCCAGGAGTGGTAGAGCATGG + Exonic
905735873 1:40325435-40325457 GAAGAAGAAGTGGTTGAGGCCGG - Intergenic
906081079 1:43088719-43088741 GAATAAGGGGTTGTAGAGGGAGG - Intergenic
907110633 1:51923343-51923365 GATGCAGGAGAGGGAGAGGCTGG + Intronic
907362367 1:53929022-53929044 GGATCTGGAGTGGTAGAGACTGG - Intronic
907518042 1:55005864-55005886 CACTCAGCAGTGGTGGAGGCGGG + Intronic
908281469 1:62541446-62541468 GTCTCAGGAGTGGCAGAGGTGGG - Intronic
908461543 1:64352461-64352483 GAATAATGGGTTGTAGAGGCAGG + Intergenic
908684406 1:66699318-66699340 CAATAAGGAGTGGAAGAGGGTGG - Intronic
908852578 1:68389480-68389502 GAATAATGGGTTGTAGAGGCAGG - Intergenic
908885471 1:68783096-68783118 GAATAATGAGTGGTATAGTCTGG - Intergenic
909035636 1:70591512-70591534 GAATAATGGGTTGTAGAGGCAGG - Intergenic
909223490 1:72990309-72990331 GAATAATGGGTTGTAGAGGCAGG + Intergenic
909750643 1:79156458-79156480 GAATAAAGAGTGGTAGGGGCAGG - Intergenic
910861304 1:91744691-91744713 GAATCATGAGTGGTAGAGGGAGG - Intronic
911570555 1:99512836-99512858 GAATAATGGGTTGTAGAGGCAGG - Intergenic
912490203 1:110058516-110058538 GAAGCAAGAGTGGGAGAGGCTGG - Intronic
912498001 1:110103631-110103653 GAATTGGGGGTGGTAGGGGCTGG - Intergenic
913294893 1:117309869-117309891 AAACCAGGAGTAGTAGAGGATGG - Intergenic
913352944 1:117882459-117882481 GAATCTGGAGTGGTATTGCCTGG - Intronic
913528170 1:119713154-119713176 GGATCAGGTGAGGTAGAGACTGG - Intronic
916149375 1:161771564-161771586 GAATCAGGAGAGGTAGAGGATGG - Intronic
916310953 1:163398411-163398433 GAATCAAGAGGGGAAGAGGAGGG - Intergenic
916449852 1:164910099-164910121 GAACCAGGAGTCCTAAAGGCAGG + Intergenic
916665242 1:166960964-166960986 CAATTAGCAGTGGTTGAGGCTGG + Intronic
917600265 1:176566626-176566648 TATTCAGGAGTGACAGAGGCAGG + Intronic
917868463 1:179220896-179220918 GAGTCAGGAGTGGCAGCAGCAGG - Intronic
918191596 1:182180640-182180662 GATACAGGAGTGGTAGAAACAGG + Intergenic
918303787 1:183227723-183227745 GCATCAGGACAGGAAGAGGCAGG - Intronic
918347286 1:183616864-183616886 GAATAATGGGTTGTAGAGGCAGG - Intergenic
918567500 1:185950793-185950815 GAATAATGGGTTGTAGAGGCAGG + Intronic
919744923 1:201002712-201002734 CAATAGGGAGTGGTAGAGACTGG + Intronic
920516042 1:206585278-206585300 GAAACTGGAGAGGTAGAGGTAGG + Exonic
920644502 1:207789896-207789918 AAATCAAGAGTGCTAGAGACCGG + Intronic
921212585 1:212912717-212912739 GAATAATGGGTTGTAGAGGCAGG - Intergenic
922027712 1:221767141-221767163 GAAACAGGAGTAGGAGAGGCAGG - Intergenic
922274519 1:224064867-224064889 GAATGAGGAATGGCAAAGGCTGG + Intergenic
923244920 1:232121395-232121417 GAATAATGGGTTGTAGAGGCAGG - Intergenic
923390177 1:233507281-233507303 GCATCAGGAGTGGTACAGTGGGG - Intergenic
923510250 1:234645310-234645332 GAATTAGAAGTAGGAGAGGCAGG - Intergenic
923962946 1:239104578-239104600 GAATAACGGGTGGTAGAGGGAGG - Intergenic
924143568 1:241050636-241050658 GTCTCAGGAGTGGCAGAGGTGGG - Intronic
924607174 1:245544777-245544799 GAGTCAGGATTGGGAGAGGAAGG + Intronic
924896012 1:248338724-248338746 GAATAATGGGTAGTAGAGGCAGG + Intergenic
1063457943 10:6197758-6197780 GTCTCAGGGGTGGCAGAGGCAGG + Intronic
1063509426 10:6632093-6632115 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1063527512 10:6799593-6799615 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1065442955 10:25771248-25771270 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1065566889 10:27020476-27020498 GAATCATGGGTATTAGAGGCTGG - Intronic
1066317163 10:34259484-34259506 GAATCAGAAGGGGCAGAGTCAGG - Intronic
1066434047 10:35380344-35380366 AAATCAGGAGTGGGAGAGAAAGG - Intronic
1066574279 10:36808666-36808688 GAAGCATGAGAGGAAGAGGCTGG + Intergenic
1067031359 10:42880266-42880288 GAGTCATGAGTGCTAGAGACGGG + Intergenic
1067466584 10:46503579-46503601 GAAGCAGGATGGGCAGAGGCTGG - Intergenic
1067620604 10:47881026-47881048 GAAGCAGGATGGGCAGAGGCTGG + Intergenic
1068038852 10:51797070-51797092 TTATCTGGAGGGGTAGAGGCAGG + Intronic
1068072530 10:52213700-52213722 GACTCAGCAGTGGGAGAGACTGG + Intronic
1068090665 10:52429020-52429042 GAATAGTGATTGGTAGAGGCTGG - Intergenic
1068179489 10:53501530-53501552 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1068547540 10:58366252-58366274 GAATCAGTAGTGTTAGATTCTGG + Intronic
1068866971 10:61904092-61904114 AAATCAGGAGGGGGAGAGGGAGG - Intronic
1069278700 10:66625927-66625949 GAGTCACCAGTGGTAGAGCCAGG + Intronic
1069897487 10:71688578-71688600 GAGTCAGGGGTGGTGGAGTCAGG + Intronic
1069897492 10:71688593-71688615 GAGTCAGGGGTGGTGGAGCCAGG + Intronic
1069897574 10:71688833-71688855 GAGTCAGGGGTGGTGGAGTCAGG + Intronic
1069897579 10:71688848-71688870 GAGTCAGGGGTGGTGGAGTCAGG + Intronic
1069897635 10:71689014-71689036 GAGTCAGGGGTGGTGGAGTCAGG + Intronic
1069897640 10:71689029-71689051 GAGTCAGGGGTGGTGGAGCCAGG + Intronic
1069897668 10:71689104-71689126 GAGTCAGGGGTGGTGGAGCCAGG + Intronic
1069897688 10:71689164-71689186 GAGTCAGGGGTGGTAGAGTCAGG + Intronic
1069897693 10:71689179-71689201 GAGTCAGGGGTGGTGGAGCCAGG + Intronic
1070109333 10:73467800-73467822 GAATCAGGGCTGGTAGAGGGAGG + Intronic
1070475092 10:76821790-76821812 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1071514237 10:86286635-86286657 GAATCAGGTCAGATAGAGGCAGG + Intronic
1077206105 11:1345300-1345322 GTCTCAGGGGTGGCAGAGGCGGG - Intergenic
1077373859 11:2196008-2196030 GAATCTGGCCTGGTAGAGGGTGG + Intergenic
1077597825 11:3549249-3549271 GAATCACCAGAGGTAGAGCCTGG + Intergenic
1078010681 11:7570785-7570807 GGCTCATGAGTGGTAGAGCCAGG - Intronic
1078045966 11:7914660-7914682 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1078903573 11:15663917-15663939 GGAACAGGAGTGGCAGAGTCAGG - Intergenic
1079408707 11:20166607-20166629 GAAGGAGAAGTGGGAGAGGCAGG + Intergenic
1079683632 11:23328853-23328875 GAATGATGAGTAATAGAGGCTGG - Intergenic
1079800038 11:24857764-24857786 GAATCAGGGGTGGAGGTGGCTGG - Intronic
1080350162 11:31375279-31375301 GAATCAGGTGAGGTAGTGGATGG - Intronic
1080428790 11:32179600-32179622 GAGTCAGGAGGAGGAGAGGCAGG - Intergenic
1080481640 11:32657503-32657525 GAATCAGGAGTGATAAATGGAGG - Intronic
1081301303 11:41455912-41455934 AAATGGGGAGTGGTGGAGGCTGG - Intronic
1081462308 11:43283247-43283269 GATACAGGAGTAGAAGAGGCCGG + Intergenic
1081628282 11:44668972-44668994 TAATCAGCAGTGAGAGAGGCAGG - Intergenic
1082934470 11:58641908-58641930 GAAGAAGGAGGGGTTGAGGCAGG + Intronic
1086944203 11:92828995-92829017 GAGTGAGGAGAGGTAGGGGCTGG - Intronic
1089917786 11:122175738-122175760 TACTCAGGAAAGGTAGAGGCAGG + Intergenic
1090283777 11:125481185-125481207 GAAGGAGGAGTTGTAGAGGAGGG - Intronic
1090871794 11:130756013-130756035 GAATAATGGGTAGTAGAGGCAGG + Intergenic
1091180123 11:133596699-133596721 GCATCAGGAGAAGGAGAGGCTGG + Intergenic
1091183846 11:133630005-133630027 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1091886689 12:4021759-4021781 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1092423981 12:8358544-8358566 GAATCACCAGAGGTAGAGCCTGG + Intergenic
1093883103 12:24428326-24428348 GAAACAGAAGAGGTAGAGTCTGG - Intergenic
1094486118 12:30926950-30926972 GGATGAGGAGTGGAGGAGGCAGG + Exonic
1095254563 12:40019443-40019465 GAAGCTGGAGTGGTAGCAGCTGG + Intronic
1095535279 12:43238650-43238672 GAATCAGCAGAGGTACAGGAAGG + Intergenic
1096980798 12:55727508-55727530 GGATCAGGGGAGGTAGGGGCAGG - Intronic
1097416887 12:59325716-59325738 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1097542023 12:60954484-60954506 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1098173470 12:67769144-67769166 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1098525037 12:71477338-71477360 GAATCAGGAGTGGAAAGGGTGGG + Intronic
1098629227 12:72706566-72706588 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1099389296 12:82059395-82059417 GAAGAAGGAGAGGAAGAGGCTGG + Intergenic
1099762754 12:86942015-86942037 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1100042386 12:90336108-90336130 AAAACAGGAGGGGTAGAGGGGGG + Intergenic
1100561526 12:95752376-95752398 GAATAATGGGTTGTAGAGGCAGG - Intronic
1101510595 12:105389331-105389353 GAATCATGAGTGGGAAAAGCAGG - Intronic
1101810579 12:108104194-108104216 GAATCAGGGATGGGAGATGCTGG + Intergenic
1101848231 12:108381020-108381042 AACTGGGGAGTGGTAGAGGCAGG - Intergenic
1102151151 12:110689550-110689572 GAATCAGGAGACCCAGAGGCAGG - Intronic
1105842327 13:24265569-24265591 GAATCAGGAGTGACACAGCCAGG - Intronic
1105910697 13:24863436-24863458 CATTCAGGAGAGGTAGGGGCCGG + Intronic
1107075752 13:36319657-36319679 GAATAATGGGTTGTAGAGGCAGG - Intronic
1107220128 13:37971672-37971694 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1107343632 13:39436993-39437015 GAATGAGGAGAGGTCTAGGCAGG - Intronic
1107682971 13:42869914-42869936 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1107817168 13:44254553-44254575 GAAGCGGGAGTGGTAGAGTCAGG - Intergenic
1108286683 13:48915816-48915838 GAAGCAGGAGCGGAAGAGGATGG - Intergenic
1108513163 13:51173080-51173102 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1108718011 13:53100909-53100931 TAAACAGGAGTGGAGGAGGCTGG + Intergenic
1108814294 13:54270073-54270095 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1109709496 13:66143829-66143851 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1110150475 13:72246467-72246489 AATCCAGGAGTGGTAGAGGGAGG - Intergenic
1111125871 13:83910779-83910801 GAATAATGAGTAGTAGAGGGAGG + Intergenic
1111302212 13:86361625-86361647 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1111458675 13:88515328-88515350 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1111741189 13:92207532-92207554 GGATCAGGAGAAGTAGAGGTGGG - Intronic
1112204526 13:97310723-97310745 GAAACAGGAGGGCTATAGGCCGG - Intronic
1115904976 14:38194008-38194030 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1116179844 14:41519160-41519182 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1116613680 14:47107398-47107420 GAATAATGGGTTGTAGAGGCAGG - Intronic
1116872811 14:50084006-50084028 GAGTCTGGAGTGGGAGGGGCAGG + Exonic
1118241986 14:64069001-64069023 GGAACAGGAGTGGTAGATGAGGG + Intronic
1118716089 14:68561099-68561121 AAGTCAGGAGTGGCAGAGGAAGG - Intronic
1118888901 14:69890572-69890594 GAATCAGGATGGGCTGAGGCAGG - Intronic
1119684968 14:76624265-76624287 TCAGCAGGAGTGGTAAAGGCAGG + Intergenic
1120078468 14:80187205-80187227 GAAGCAGGAATGGAAGAGGATGG + Intergenic
1121573627 14:94965836-94965858 GAATCAGGGCTGGAAGATGCAGG - Intergenic
1121713251 14:96054453-96054475 AAATCATGAGTGGTGGAGGCAGG - Intronic
1122041163 14:98988412-98988434 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1122875266 14:104660943-104660965 AAAGCAGCAGTGGAAGAGGCTGG - Intergenic
1124033427 15:26031818-26031840 GCTTCAGGGGTGGTGGAGGCAGG + Intergenic
1126543662 15:49848622-49848644 GCATAAGGAGTTGTAGAAGCAGG + Intergenic
1127991583 15:64122666-64122688 GAATCAAGGGTGGGGGAGGCAGG + Intronic
1128340158 15:66816948-66816970 GAATCAGGACTGGAAAGGGCAGG + Intergenic
1128519412 15:68365586-68365608 GAAGAGGGAGTGGGAGAGGCTGG + Intronic
1128695170 15:69756339-69756361 GAAACAGAAGTGATAGAGCCAGG - Intergenic
1128755455 15:70180726-70180748 GCGTCAGGACGGGTAGAGGCGGG - Intergenic
1128941591 15:71792028-71792050 GGATAAGGAGTGGTAGAGACAGG + Intergenic
1130285411 15:82550521-82550543 GAATCAGGCCTGGTAGGTGCTGG + Intronic
1130408269 15:83622798-83622820 GAATTAGGAGTACTAGAGCCAGG - Intergenic
1130855272 15:87834482-87834504 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1130945781 15:88549997-88550019 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1132650118 16:1017193-1017215 GAATCAGGAGTGGGAGGATCCGG - Intergenic
1133783768 16:8959454-8959476 GAATCAGGAGAGCTGGAGCCTGG + Intronic
1133869382 16:9673587-9673609 GAATAATGGGTTGTAGAGGCAGG + Intronic
1133998192 16:10763127-10763149 GAAGCAGGGGTGGTAGAGGGAGG + Intronic
1134342011 16:13355063-13355085 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1135026343 16:19002179-19002201 GAATGAGCAGTGGCAGAGGCAGG - Intronic
1135042942 16:19131933-19131955 CAATCAGGAGTGGGAGAGAGGGG + Intronic
1135171737 16:20190116-20190138 GAATGAGGAGGGAGAGAGGCTGG + Intergenic
1135465299 16:22679773-22679795 GAATCAGGAATGGAAAAGACAGG - Intergenic
1136774315 16:32863525-32863547 GAGACAGTAGTGGCAGAGGCAGG - Intergenic
1136896296 16:33997989-33998011 GAGACAGTAGTGGCAGAGGCAGG + Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138805118 16:60082045-60082067 GAATAATGGGTAGTAGAGGCAGG - Intergenic
1139153337 16:64411260-64411282 GAATCAGGGAGGGTAGAGGAGGG - Intergenic
1140900260 16:79360421-79360443 GACTCATGAGTGGTAGAGCTGGG - Intergenic
1141796706 16:86279751-86279773 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1141865035 16:86744529-86744551 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1142410431 16:89913213-89913235 GCATCTGGAATGGAAGAGGCAGG - Intronic
1203076738 16_KI270728v1_random:1125644-1125666 GAGACAGTAGTGGCAGAGGCAGG - Intergenic
1144612050 17:16728738-16728760 GAATCAGAAGTGGGAGAGTGTGG - Intronic
1144900685 17:18586646-18586668 GAATCAGAAGTGGGAGAGTGTGG + Intergenic
1145131768 17:20359093-20359115 GAATCAGAAGTGGGAGAGTGTGG - Intergenic
1146719483 17:35113704-35113726 GAATCAGGAGTGGTAGAGGCTGG - Intronic
1147988388 17:44319394-44319416 GAATTGGGGGTGGTAGGGGCTGG - Intergenic
1148511994 17:48178852-48178874 AAGTCGGGACTGGTAGAGGCTGG + Intronic
1149754322 17:59174900-59174922 GAATCAGGTGGGCTGGAGGCTGG - Intronic
1150223750 17:63511534-63511556 GAAGGAGGATTGGTTGAGGCTGG - Intronic
1150258901 17:63772848-63772870 GCTTCAGGAGTCATAGAGGCTGG - Intronic
1151144811 17:72030771-72030793 GAGGCTGGAGGGGTAGAGGCTGG - Intergenic
1151517733 17:74607039-74607061 GAATCAGGAGTGGTTGGTGGTGG - Intergenic
1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG + Intronic
1153367435 18:4273283-4273305 GAAGCAAGAGCGGGAGAGGCAGG - Intronic
1153693626 18:7617964-7617986 GAATGAGGAGCGGCAGAGACTGG + Intronic
1157638329 18:49184945-49184967 GAATGAGGAGTGCTAGAAGGAGG + Intronic
1160776991 19:861092-861114 GCAGCAGGAGAGGTCGAGGCTGG - Intronic
1160777076 19:861346-861368 GCAGCAGGAGAGGTCGAGGCTGG - Intronic
1162021763 19:7871286-7871308 GAATCAGGGGGAGTAGAGGCCGG + Exonic
1163907348 19:20158751-20158773 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1164305358 19:24001143-24001165 GAATCCGGAGTGGCAGAGATGGG - Intergenic
1164650644 19:29888674-29888696 GAATGAGGAGTGGGAGAGAAGGG + Intergenic
1164744090 19:30598901-30598923 GAAGAAGGAGTGAGAGAGGCAGG - Intronic
1165570252 19:36769935-36769957 CAGTCAGAAGTTGTAGAGGCTGG - Intronic
1167136529 19:47619553-47619575 GAAAAAGGATTGGGAGAGGCTGG - Intronic
1167375889 19:49111551-49111573 GAGTTAGGAGAGGTAGAGGCTGG + Intergenic
1167620584 19:50557823-50557845 GTCTCAGGAGTGGCAGAGGCAGG - Intronic
1167902315 19:52630986-52631008 GAATAATGGGTAGTAGAGGCAGG - Intronic
1168051802 19:53834816-53834838 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1168211961 19:54897394-54897416 GAATAATGGGTTGTAGAGGCAGG + Intergenic
925720193 2:6820178-6820200 GAGGCAGGAGTGGGAGAAGCTGG + Intergenic
926407930 2:12572970-12572992 GAATAATGGGTTGTAGAGGCAGG - Intergenic
926826452 2:16910318-16910340 GTCTCAGGGGTTGTAGAGGCAGG + Intergenic
930711301 2:54553300-54553322 GATTCAAGAGTGGGAGAGGTGGG + Intronic
931251054 2:60530821-60530843 GACTCAGGAGGGGTAGTGGGAGG - Intronic
931395029 2:61880022-61880044 CAAAAATGAGTGGTAGAGGCCGG - Intronic
931625947 2:64255747-64255769 GAATAATGGGTTGTAGAGGCAGG - Intergenic
931836788 2:66107689-66107711 GGGTCAGGATTGGTATAGGCAGG - Intergenic
932110697 2:68996741-68996763 GAATAAGGAAATGTAGAGGCTGG - Intergenic
932296010 2:70623845-70623867 GAATAATGGGTTGTAGAGGCAGG - Intronic
932593725 2:73081568-73081590 GGAGCAGGAGTGGGAGGGGCCGG + Intronic
932854043 2:75216269-75216291 GAATAATGGGTTGTAGAGGCAGG + Intergenic
932973787 2:76576346-76576368 GAATAATGGGTTGTAGAGGCAGG + Intergenic
933013254 2:77091585-77091607 GAATAATGGGTTGTAGAGGCAGG - Intronic
933079433 2:77968318-77968340 GAATAATGGGTTGTAGAGGCAGG - Intergenic
933234470 2:79850083-79850105 CAATAAGGAGTGGTGGAGGCTGG + Intronic
933329350 2:80876963-80876985 GAATAATGGGTTGTAGAGGCAGG + Intergenic
933532728 2:83530928-83530950 GAATTAGGAGTTATTGAGGCAGG + Intergenic
933874797 2:86608855-86608877 GAATGAGAAGAGGTAGAGCCAGG + Intronic
934144492 2:89078161-89078183 CAATCAGGAGCCGTGGAGGCTGG + Intergenic
934224760 2:90122388-90122410 CAATCAGGAGCCGTGGAGGCTGG - Intergenic
934545913 2:95216025-95216047 GAGTCAGGAGTGGTGGTGGAAGG + Intronic
935130613 2:100258380-100258402 GAGCCAGGAGTGGGAGGGGCAGG - Intergenic
935682055 2:105646816-105646838 GAAGGAGGAGAGGCAGAGGCTGG - Intergenic
935825542 2:106945279-106945301 GAATCAGTAGTGGACGAGCCAGG - Intergenic
936580815 2:113698943-113698965 GAACCAGGAGTGGTGAGGGCTGG + Intergenic
936883500 2:117281950-117281972 GAATAATGAGTTGTAGAGGCAGG - Intergenic
937229172 2:120387359-120387381 GGATCAGGAGTGGCAGAGGTGGG + Intergenic
938106092 2:128530715-128530737 AAATCCGGAGTGGTAGAGCTAGG + Intergenic
938871095 2:135477426-135477448 GAAGAAGGAATGGTAGAGGAAGG + Intronic
941805356 2:169706881-169706903 ATATCAGAAGTGGCAGAGGCCGG + Intronic
943807724 2:192143159-192143181 AATTCAGGAGTAGTAGGGGCTGG - Intronic
944460335 2:199942365-199942387 GAATTAGGAGTGCAAAAGGCTGG - Intronic
945376269 2:209081286-209081308 GAATAATGGGTTGTAGAGGCAGG - Intergenic
946309777 2:218877007-218877029 GACCCAGCAGTGGTAGAGTCTGG - Intergenic
946717083 2:222563956-222563978 GTGTCAGGGGTGGCAGAGGCAGG + Intergenic
946994972 2:225381162-225381184 GAAGCATGAGTGGGAGAGGTGGG - Intergenic
947371590 2:229452170-229452192 GAATCAGAAGAGGTTGAGACCGG + Intronic
947702859 2:232249651-232249673 GAATGAGGATTGGCAAAGGCAGG + Intronic
948026540 2:234782511-234782533 CACTCAGGTGTGGCAGAGGCTGG - Intergenic
1169668427 20:8066514-8066536 AAATCAGGAGAAGTAAAGGCAGG + Intergenic
1170165908 20:13360162-13360184 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1171119226 20:22553856-22553878 GAATCAGGATTGGCATGGGCTGG - Intergenic
1172152247 20:32798658-32798680 GGATCTGTGGTGGTAGAGGCGGG - Intronic
1173018043 20:39244594-39244616 GAGGCAGTAGTGGTTGAGGCAGG - Intergenic
1173758872 20:45542441-45542463 GAATTAGGAGGGGTGGAGGAAGG - Intronic
1173937080 20:46876048-46876070 CAATAAGGAGTGGTGGAGACTGG + Intergenic
1173957592 20:47046395-47046417 TAGCCATGAGTGGTAGAGGCTGG - Intronic
1174641635 20:52049658-52049680 GAAAAAGGAGTGGTAGTGGGAGG - Intergenic
1174744210 20:53045546-53045568 GAATCAGGATAGGTAGAGCCTGG - Intronic
1175400854 20:58699122-58699144 GAAACAGGAGAGGCCGAGGCTGG - Intronic
1177015312 21:15780828-15780850 GAAACAGGAGTGGATGAGGGAGG + Intronic
1178026574 21:28474978-28475000 GTAGCAGGAGTGGTTGAGGAGGG + Intergenic
1178775930 21:35550719-35550741 GATGCAGGAGTGATAGAGCCTGG - Intronic
1181283230 22:21734826-21734848 GAATTAGGAGTGTCAGGGGCTGG + Intronic
1182664583 22:31948204-31948226 GAAACAGGAGTCGGAGAGGAGGG + Intronic
1183097922 22:35565038-35565060 AGTTCAGGAGTGGTAGAGACTGG - Intergenic
1183419638 22:37703799-37703821 GTATCAAGACTGGTAGAAGCTGG - Intronic
1183603215 22:38852038-38852060 AATTCTGGAGTGGTAGAGCCAGG - Intergenic
1183632046 22:39039553-39039575 GAAGCAGGAGGGGTTGGGGCAGG - Intergenic
1183637927 22:39076381-39076403 GAAGCAGGAGGGGTTGGGGCAGG - Intronic
1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG + Intergenic
1185179991 22:49353888-49353910 CATTCAGGATTGGTAGGGGCTGG - Intergenic
1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG + Intronic
949107053 3:212122-212144 AAATGCAGAGTGGTAGAGGCTGG + Intronic
949431849 3:3985330-3985352 CAGTCAGTAGTGGAAGAGGCTGG - Intronic
950273160 3:11635329-11635351 GAAGCAGGAGAGGAAGAGGAGGG + Intronic
950766672 3:15278041-15278063 GAAGCACGAGGGGTAGAAGCTGG - Intronic
950969826 3:17175059-17175081 GATTGAGAAGTGGTAGGGGCAGG + Intronic
952564854 3:34642381-34642403 GAATAATGGGTTGTAGAGGCAGG + Intergenic
952812611 3:37418066-37418088 GGATCAGGAGTGGGAGGGACAGG - Intronic
953856825 3:46505695-46505717 GAACCAGGAGTGTCTGAGGCAGG + Intergenic
953899082 3:46828918-46828940 GAATAAAGATTGGTAGAGGCTGG - Intergenic
953983857 3:47426730-47426752 CAATCAAGAGTGTTGGAGGCCGG - Intronic
955285370 3:57635842-57635864 AACTCAGGGGTGGCAGAGGCAGG - Intronic
955762345 3:62300599-62300621 GAAACAAGAGTGGCAGAAGCAGG + Intergenic
956400494 3:68874406-68874428 GAAACAGCAGGGGTAGAGACGGG - Intronic
956407409 3:68942373-68942395 GAACCAGGAGTGCTGAAGGCAGG - Intergenic
957067985 3:75541630-75541652 GAATCACCAGAGGTAGAGCCTGG + Intergenic
957279268 3:78128597-78128619 GAATGAGGAGTGGTGGATGGTGG - Intergenic
957279807 3:78136050-78136072 GAATGATGATTGCTAGAGGCTGG - Intergenic
957317142 3:78585640-78585662 GAATAATGGGTTGTAGAGGCAGG + Intergenic
957802798 3:85106763-85106785 GAATAGGGAGGGGTAGAGGGAGG + Intronic
958411861 3:93826945-93826967 GAATCACCAGTGGTAGGGGAAGG - Intergenic
959016678 3:101142597-101142619 GAATCAGGACTGATAGAGACGGG + Intergenic
959845430 3:111027391-111027413 GAATCAGGAGTTGGGGAGTCAGG - Intergenic
959972096 3:112420057-112420079 GAATAATGGGTTGTAGAGGCAGG + Intergenic
960282707 3:115795996-115796018 GAATAATGGGTTGTAGAGGCAGG + Intergenic
961285174 3:125796351-125796373 GAATCACCAGAGGTAGAGCCTGG - Intergenic
961565717 3:127762008-127762030 AAGCCAGGAGTGGTAGAGCCAGG - Intronic
961616516 3:128187002-128187024 GCCACAGGAGTGGTAGAAGCAGG + Intronic
961636110 3:128334143-128334165 GACTCAGATGTGGCAGAGGCAGG - Intronic
961826964 3:129604174-129604196 GAATGAGGAGGAGTACAGGCAGG - Intronic
962317791 3:134369558-134369580 GAGTCTGGAGGGGTGGAGGCTGG + Intronic
963384706 3:144576635-144576657 AGATACGGAGTGGTAGAGGCAGG + Intergenic
963663513 3:148154865-148154887 GAATAATGAGTAGTAGAGGGAGG - Intergenic
963684494 3:148417562-148417584 GAATAATGGGTTGTAGAGGCAGG - Intergenic
963906933 3:150780368-150780390 GAACCAGGATGGGGAGAGGCTGG - Intergenic
964629152 3:158790789-158790811 GAATCAGGAATGGTAGAGGTGGG + Intronic
965425464 3:168517470-168517492 AAATCAGGAATGGTAGAGGTTGG - Intergenic
966066996 3:175830919-175830941 GAATAATGGGTTGTAGAGGCAGG - Intergenic
966104933 3:176324125-176324147 GAATAATGGGTTGTAGAGGCAGG + Intergenic
966910274 3:184555694-184555716 GCATCAGTAGTGGGAGAGGGAGG + Intronic
966930435 3:184672248-184672270 GAAAGTGGAGTAGTAGAGGCAGG - Intronic
967124964 3:186415099-186415121 CACTGAGGTGTGGTAGAGGCAGG - Intergenic
967211997 3:187178025-187178047 GAATAATGGGTTGTAGAGGCAGG + Intronic
967561548 3:190923323-190923345 GAATAATGGGTTGTAGAGGCAGG - Intergenic
967624484 3:191668980-191669002 GAATAATGGGTTGTAGAGGCAGG + Intergenic
969741527 4:9031530-9031552 GAATCACCAGAGGTAGAGCCCGG - Intergenic
969800894 4:9564432-9564454 GAATCACCAGAGGTAGAGCCTGG - Intergenic
970266509 4:14293902-14293924 AAACCAGGAGAGGAAGAGGCAGG - Intergenic
971123019 4:23724520-23724542 GAATAATGGGTTGTAGAGGCTGG + Intergenic
971200301 4:24504225-24504247 GAATAATGGGTTGTAGAGGCAGG - Intergenic
971361471 4:25942115-25942137 GAATCAGGAGTGGCAGTTTCCGG - Intergenic
972029733 4:34439443-34439465 GTCTCAGGAGTGTCAGAGGCAGG + Intergenic
974428236 4:61766796-61766818 GAATAATGGGTTGTAGAGGCAGG + Intronic
975864926 4:78716356-78716378 GAATAATGGGTTGTAGAGGCAGG + Intergenic
975933724 4:79556473-79556495 GAATAATGGGTTGTAGAGGCAGG + Intergenic
976321194 4:83717930-83717952 GTCTCAGGGGTGGTAGAAGCAGG - Intergenic
976479266 4:85520682-85520704 GAATCAGCAGTGGTACAACCAGG - Intronic
977101254 4:92817929-92817951 GAATTATAAGTGGTAGAGTCAGG + Intronic
978000957 4:103556259-103556281 GAATAATGGGTTGTAGAGGCAGG + Intergenic
979295892 4:119031857-119031879 GAAGGAGGAGAGGTATAGGCTGG - Exonic
980003192 4:127513947-127513969 GAATAATGGGTTGTAGAGGCAGG + Intergenic
982301433 4:153882754-153882776 GAATAAGCAGTGGTTGAGGGAGG + Intergenic
982535607 4:156603495-156603517 GAATAATGGGTTGTAGAGGCAGG - Intergenic
983055648 4:163096286-163096308 GAATAATGGGTTGTAGAGGCAGG - Intergenic
983360575 4:166719518-166719540 GAATAATGGGTTGTAGAGGCAGG - Intergenic
983414551 4:167438306-167438328 GAATAATGGGTTGTAGAGGCTGG + Intergenic
983859593 4:172688658-172688680 GGAGCAGGAGTGCCAGAGGCTGG - Intronic
984504773 4:180603092-180603114 GAATCAGGAGTGTTTTAGACTGG + Intergenic
986389042 5:7266799-7266821 GAATAATGGGTTGTAGAGGCAGG - Intergenic
986919421 5:12665036-12665058 GAATAATGGGTTGTAGAGGCAGG + Intergenic
987497962 5:18671354-18671376 GAATAATGGGTTGTAGAGGCAGG + Intergenic
987540431 5:19247860-19247882 GAATAAGATGTGGCAGAGGCAGG - Intergenic
988029041 5:25739081-25739103 GAAACAGCAGTGGCAGTGGCAGG - Intergenic
988085017 5:26463996-26464018 GTATCAGTAGTGGCAGAGGCAGG - Intergenic
990172041 5:53062366-53062388 AAGGCAGGAGGGGTAGAGGCAGG - Intronic
991290037 5:65024750-65024772 GAAGCAGGTTTGGTGGAGGCAGG - Intergenic
991417620 5:66408242-66408264 TCCTCAGGAGTGGTGGAGGCTGG - Intergenic
992394830 5:76360569-76360591 GAATAATGGGTTGTAGAGGCAGG - Intergenic
992895053 5:81238671-81238693 GAGCCATGAGTGGCAGAGGCAGG - Intronic
993192881 5:84701690-84701712 GAATAATGGGTTGTAGAGGCAGG - Intergenic
993886720 5:93423421-93423443 GAACCATGGGTGGCAGAGGCAGG + Intergenic
994989713 5:106981577-106981599 GAATAATGGGTTGTAGAGGCAGG - Intergenic
995438112 5:112160407-112160429 GAATCAGGTGTGGGTGAGCCAGG - Intronic
996203093 5:120700085-120700107 GAATAATGGGTTGTAGAGGCAGG + Intergenic
996344656 5:122476100-122476122 GAATAATGGGTTGTAGAGGCAGG + Intergenic
996745274 5:126842051-126842073 GAATAATGGGTTGTAGAGGCAGG + Intergenic
997416174 5:133730516-133730538 GAATCAGGAGTGATTTGGGCTGG - Intergenic
997693454 5:135843433-135843455 GACTCAGGAGTGAGGGAGGCAGG + Intronic
998053216 5:139053607-139053629 GAATGAGGAGTGGACAAGGCTGG - Intronic
998995552 5:147866501-147866523 GAATAATGGGTTGTAGAGGCAGG - Intergenic
998996237 5:147871483-147871505 GAATAATGGGTTGTAGAGGCAGG + Intronic
1000574521 5:162960962-162960984 GAATCCGGGGTGGTGGAGGTCGG - Intergenic
1002167844 5:177359191-177359213 GAAGAAGAAGAGGTAGAGGCAGG - Intronic
1003460352 6:6322844-6322866 GAAAGAGCAGTGCTAGAGGCAGG - Intergenic
1003497888 6:6679838-6679860 GCATAGGGAGTGGGAGAGGCCGG + Intergenic
1004283357 6:14299454-14299476 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1004454852 6:15782918-15782940 GTCTCAGGGGTGGCAGAGGCAGG + Intergenic
1004818370 6:19337339-19337361 GAAGGAGGAGTGGTAGAAGCTGG + Intergenic
1006498244 6:34439814-34439836 GAAGCAGGGCTGGCAGAGGCTGG - Intergenic
1007102537 6:39259627-39259649 AAATCAGGATTGGGAGAGGGAGG - Intergenic
1007748850 6:44059654-44059676 GAACCAGGATTGCTTGAGGCAGG + Intergenic
1008635961 6:53411467-53411489 GATACAGGAATGTTAGAGGCAGG - Intergenic
1009056778 6:58345873-58345895 GTCTCAGGAGTGGCAGAGGCAGG - Intergenic
1009234463 6:61105699-61105721 GTCTCAGGAGTGGCAGAGGCAGG + Intergenic
1009901241 6:69810221-69810243 GTCTCAGGGTTGGTAGAGGCAGG - Intergenic
1010751018 6:79616110-79616132 AAAGCAGGAGTGGTTTAGGCCGG - Intergenic
1011570779 6:88732078-88732100 GTCTCAGGGGTGGCAGAGGCAGG + Intronic
1011770778 6:90672711-90672733 GAATAATGAGTTATAGAGGCAGG + Intergenic
1012014226 6:93832574-93832596 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1012066377 6:94556440-94556462 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1012315983 6:97782795-97782817 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1012473828 6:99600206-99600228 GAATGGGGAGTGGTAGCTGCTGG + Intergenic
1012675257 6:102105165-102105187 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1012712867 6:102630334-102630356 GAAGCAGGAGCAGGAGAGGCAGG + Intergenic
1012867497 6:104635363-104635385 AAGTCAGGAATGGAAGAGGCTGG - Intergenic
1013891874 6:115035094-115035116 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1014274173 6:119368112-119368134 GAAGCAGGAGGGATGGAGGCTGG + Intergenic
1014556011 6:122843039-122843061 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1015266909 6:131298662-131298684 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1015278319 6:131406027-131406049 GAATAATGGGTAGTAGAGGCAGG - Intergenic
1015323993 6:131904897-131904919 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1015851130 6:137573905-137573927 GAATCAGGAGGCACAGAGGCAGG + Intergenic
1016249028 6:142019020-142019042 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1016259316 6:142148704-142148726 GTATCAGGAGTAGTGGTGGCAGG + Intronic
1016535595 6:145105650-145105672 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1018638224 6:165883668-165883690 ACAACAGGAGTGGCAGAGGCGGG + Intronic
1018733396 6:166669785-166669807 GAATGAGGAGGGGGTGAGGCAGG - Intronic
1019767206 7:2860422-2860444 TAGCCAGGAGTGGTAGAGGGGGG - Intergenic
1019940139 7:4283035-4283057 GACTCAGGGGTGGGACAGGCAGG - Intergenic
1020033798 7:4951577-4951599 GAATGAGTAGTGCTAGATGCTGG - Intronic
1020532554 7:9355921-9355943 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1020863862 7:13531345-13531367 GAAGGAGAGGTGGTAGAGGCTGG - Intergenic
1021800378 7:24299468-24299490 GAAGCAGCAGTGGCTGAGGCAGG + Intergenic
1021810816 7:24399490-24399512 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1022160421 7:27704970-27704992 GAAGCAGGAGTGGGAGTTGCAGG + Intergenic
1022425344 7:30263462-30263484 GACCCAGGAGTGGTAGGGGAGGG - Intergenic
1022532645 7:31076614-31076636 GAACCAGAAGAGGTGGAGGCCGG - Intronic
1022648753 7:32255818-32255840 TGGTCAGGAGTGGCAGAGGCTGG + Intronic
1022704112 7:32787193-32787215 GAATCAGGCCTGGGAGAGTCAGG + Intergenic
1023106715 7:36770134-36770156 GAATGAGGAGAGGAAGAGGGAGG - Intergenic
1023489759 7:40726462-40726484 GTCTCAGGGGTGGCAGAGGCGGG + Intronic
1023497909 7:40817386-40817408 GAATAAGCAGTGATAGAGGCCGG + Intronic
1024093742 7:45968234-45968256 GCACCAGGGGTGGGAGAGGCAGG - Intergenic
1024615456 7:51108110-51108132 GAGTTAGGAGTGCTGGAGGCTGG - Intronic
1025271213 7:57519175-57519197 GTCTCAGGAGTGTCAGAGGCAGG - Intergenic
1027958663 7:84916034-84916056 GAAACAGGAGTGGGAGTGGAAGG + Intergenic
1029351092 7:100013461-100013483 GTCTCAGGGGTGGCAGAGGCAGG - Intergenic
1030877750 7:114836380-114836402 GAATCAGGAGGGAGAGAGGGAGG - Intergenic
1031400145 7:121318766-121318788 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1031525754 7:122820135-122820157 GAATAATGGGTTGTAGAGGCAGG - Intronic
1031998525 7:128248791-128248813 GAATCAGGAGTGGGAAGGGATGG - Intronic
1032668973 7:134066141-134066163 GAAGCAGGAGTGGAAGAAGGGGG + Intronic
1034984103 7:155496859-155496881 GATACAGGAGTGGTGCAGGCGGG - Intronic
1036483345 8:9156812-9156834 GTCTCACGAGTGGCAGAGGCAGG + Intronic
1037049334 8:14350462-14350484 CTATCAGGAGTGTTAGGGGCTGG + Intronic
1037440784 8:18913797-18913819 GAGTCTGTAGTGGTAGAGGTAGG - Intronic
1038660571 8:29493160-29493182 GAGCCAGGAGTGGAGGAGGCAGG - Intergenic
1039221106 8:35331775-35331797 TAGTCAGTAGTGATAGAGGCAGG - Intronic
1039922338 8:41902368-41902390 GAGTCAGGACTGGTAGACACTGG - Intergenic
1042512844 8:69629332-69629354 GAATCAGGAATAGTGAAGGCAGG - Intronic
1042707538 8:71678124-71678146 GAATAATGGGTAGTAGAGGCAGG - Intergenic
1043615742 8:82122909-82122931 CCATCAAGAGTGGTTGAGGCAGG + Intergenic
1044164353 8:88962875-88962897 GAATTAGGAGTGCTCAAGGCTGG + Intergenic
1044925323 8:97204129-97204151 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1045197692 8:99947084-99947106 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1045644946 8:104289146-104289168 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1045680730 8:104657089-104657111 GAATTTGGAGTGGTAGAGCCAGG + Intronic
1046097786 8:109580815-109580837 GAGTGAGGAGTGGTGGAGGATGG - Intronic
1046440178 8:114244551-114244573 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1046959470 8:120095293-120095315 GAAAATGGACTGGTAGAGGCCGG + Intronic
1047829384 8:128614414-128614436 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1048097761 8:131313407-131313429 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1049256153 8:141615036-141615058 GAATCAGGCGTGGTCCAGCCTGG + Intergenic
1049569997 8:143365131-143365153 GAATGTGGAGTGGAAGAGGTGGG - Intergenic
1050170702 9:2813346-2813368 GAAATAGGAGTGTTAGAGGTGGG - Intronic
1050318262 9:4425348-4425370 GAAATAGCTGTGGTAGAGGCTGG - Intergenic
1051052792 9:12951557-12951579 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1051182867 9:14429359-14429381 GAGTCAAGAGTGGCAAAGGCAGG + Intergenic
1051778817 9:20666100-20666122 GAATCAGGTGTGGGAAAGGATGG + Intronic
1052535235 9:29737841-29737863 TACTCAGGAGAGGTTGAGGCAGG + Intergenic
1055480179 9:76701948-76701970 TAATCAGTCATGGTAGAGGCAGG + Intronic
1055810218 9:80140625-80140647 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1056061320 9:82886960-82886982 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1056522613 9:87414136-87414158 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1056802052 9:89699068-89699090 GACTCAGGAGGGGTATAGACCGG + Intergenic
1056883142 9:90415787-90415809 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1057235012 9:93350820-93350842 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1057267927 9:93631083-93631105 GAATCAGTAGGGGCAGAGGGAGG + Intronic
1057276091 9:93676708-93676730 GAGGCCGGGGTGGTAGAGGCTGG - Exonic
1057950319 9:99364563-99364585 GAAGCAGGAGTCTAAGAGGCAGG + Intergenic
1058172791 9:101703055-101703077 GAATAGGCAGTGGTGGAGGCAGG - Intronic
1059292141 9:113235654-113235676 GAAGCATGACTGGGAGAGGCAGG + Intronic
1059863326 9:118488169-118488191 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1060128612 9:121074563-121074585 GCATCAGAAGTGGGGGAGGCCGG + Intergenic
1060226376 9:121793539-121793561 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1060667456 9:125440490-125440512 GAATCAGCAGAGGCAGTGGCTGG - Intronic
1062298954 9:135853248-135853270 GAGTCAAGAGAGGTAAAGGCTGG + Intronic
1186529920 X:10285152-10285174 GAAGCAGGAGTGAGAGAGGAGGG + Intergenic
1189160294 X:38803787-38803809 GAATCTGGAGTGGCCGCGGCCGG - Exonic
1190458623 X:50648496-50648518 GAATTAAGTGTGGTAGAGGGTGG + Intronic
1190502437 X:51092921-51092943 CAACCAGGAGTAGTAGAGGGTGG + Intergenic
1191942897 X:66499444-66499466 GAACCAGGAGGGACAGAGGCTGG - Intergenic
1192078680 X:68025819-68025841 GAACCAGGAGTGCAACAGGCAGG - Intergenic
1192452400 X:71252544-71252566 GAATCAGGGCTGGGAGAGGGTGG - Intronic
1194059298 X:89177660-89177682 GAAGCGGGAATGATAGAGGCAGG - Intergenic
1194502816 X:94701320-94701342 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1195401984 X:104470652-104470674 GAATGAGAAGTGGCAGAGACAGG - Intergenic
1196073249 X:111547134-111547156 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1196165709 X:112533827-112533849 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1196341552 X:114603797-114603819 GAATAATGGGTTGTAGAGGCAGG + Intronic
1196533385 X:116814983-116815005 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1197065077 X:122225247-122225269 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1199726249 X:150585311-150585333 GAATCAGTAGTGGAGGAGGGAGG - Intronic
1200097502 X:153671062-153671084 GAATCAGGTGAGCTTGAGGCTGG - Exonic
1200105644 X:153710548-153710570 GAGACAGTAGTGGCAGAGGCAGG + Intronic
1200408631 Y:2840161-2840183 GTAACAGGAAAGGTAGAGGCCGG - Intergenic