ID: 1146720096

View in Genome Browser
Species Human (GRCh38)
Location 17:35118157-35118179
Sequence ATCAAAAATGTCTCCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 10, 2: 41, 3: 88, 4: 285}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146720096_1146720101 0 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720101 17:35118180-35118202 GGTTACAACTGGAGCAGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 167
1146720096_1146720102 9 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720102 17:35118189-35118211 TGGAGCAGGGCTGGTGCTACTGG 0: 1
1: 0
2: 1
3: 27
4: 275
1146720096_1146720100 -4 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720100 17:35118176-35118198 TGATGGTTACAACTGGAGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 162
1146720096_1146720099 -5 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720099 17:35118175-35118197 TTGATGGTTACAACTGGAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 174
1146720096_1146720105 26 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720105 17:35118206-35118228 TACTGGCATCTAGTGGGCAGAGG 0: 23
1: 237
2: 688
3: 1070
4: 1557
1146720096_1146720103 19 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720103 17:35118199-35118221 CTGGTGCTACTGGCATCTAGTGG 0: 1
1: 22
2: 202
3: 610
4: 1209
1146720096_1146720104 20 Left 1146720096 17:35118157-35118179 CCATGTCAGGAGACATTTTTGAT 0: 1
1: 10
2: 41
3: 88
4: 285
Right 1146720104 17:35118200-35118222 TGGTGCTACTGGCATCTAGTGGG 0: 13
1: 169
2: 565
3: 1057
4: 1432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146720096 Original CRISPR ATCAAAAATGTCTCCTGACA TGG (reversed) Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
908304700 1:62800500-62800522 ATTAAAAATGTCTCCTAAAATGG - Intronic
908839732 1:68266899-68266921 ATACAAAATGTCTCCGGAGATGG + Intergenic
909196301 1:72629269-72629291 ATCAAAAATGTCACATCATAGGG + Intergenic
909531234 1:76684083-76684105 TTCCAAAATGACTCCTGTCAAGG + Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911289335 1:96037959-96037981 AACAAAACTGTCTCCTGCCATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913353478 1:117890147-117890169 ATCAAATATGTATGCTGAGAAGG + Intronic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
918778435 1:188667180-188667202 ATGAAGAATTTCCCCTGACAGGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921412487 1:214850552-214850574 ACCAAAAATGTCTCATTCCATGG - Intergenic
921699939 1:218257563-218257585 AAAAAAAATTTCTGCTGACATGG - Intergenic
923431655 1:233927628-233927650 TTCAAAAATGTCTTCTGAATTGG - Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924165350 1:241275759-241275781 ATCTAAACTGTCTCCTGGAATGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065766617 10:29036329-29036351 TTTAAAAATGTATCCTGGCATGG + Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069187698 10:65446620-65446642 ATCAGAAATTTCTCCTATCAAGG + Intergenic
1069270728 10:66524122-66524144 ATGAAAAATGTTTCCTGAGACGG - Intronic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1073615379 10:104989968-104989990 ATCAACAGTGTCTGCTAACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075924828 10:126242923-126242945 ATTAAAACTGTCCCCTGAAAGGG + Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076740498 10:132480688-132480710 AGCAACAATGTTTCCTGACCAGG + Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078872711 11:15363890-15363912 ATAAAAAATGTCTATGGACATGG - Intergenic
1079057209 11:17216592-17216614 ATCAAGGATGACTCCTGACCTGG - Intronic
1079352702 11:19705416-19705438 ATTAAGAATGTCTTCTAACAAGG - Intronic
1079372758 11:19865549-19865571 GTTAAAAATCACTCCTGACAAGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083092473 11:60214507-60214529 ATCAATAATGTATTCTGCCAGGG - Intronic
1083100547 11:60301103-60301125 ATAAAAAATGTATTCTGCCAGGG + Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1086388998 11:86341215-86341237 AACAAAAATGTATACTGATAAGG - Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086522320 11:87683494-87683516 ATCAAAAAAATCTCCCAACAGGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091127051 11:133109752-133109774 TTCAACAATGCTTCCTGACAGGG - Intronic
1091220309 11:133926642-133926664 AGCAAACATGTGGCCTGACAAGG + Intronic
1091585607 12:1814591-1814613 ATAGAAAATGTGTCCTGAAATGG - Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092623569 12:10301230-10301252 AAGAAAAAAGTCTTCTGACAAGG - Intergenic
1092884515 12:12913435-12913457 ATCTACAAATTCTCCTGACAAGG - Exonic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096140041 12:49235195-49235217 AATAAAAAGGGCTCCTGACACGG + Intronic
1097096514 12:56553210-56553232 CTCAAAAAAGACTCCTGGCAGGG - Intronic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1098311821 12:69156482-69156504 ACCAAAAATCTCTCCTGGCCAGG + Intergenic
1099650502 12:85421418-85421440 ATCAAACATTTCTCCTGAGGAGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105023268 12:132831798-132831820 AACCAAAATGTCCTCTGACATGG + Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107598971 13:41993180-41993202 ATCAAAGATGTCGCCTAAGATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1111742440 13:92220848-92220870 ATCAAAAATCTCTGTTTACATGG + Intronic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1113275050 13:108719133-108719155 ATCAGAACTCTTTCCTGACAGGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116298929 14:43151322-43151344 ATCAACACTGTGTCCTCACAAGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117034591 14:51715150-51715172 TTCAAAAATGTCACAGGACAGGG - Intronic
1117341570 14:54796627-54796649 CTCAAAAATTTTTTCTGACATGG - Intergenic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1120171667 14:81252273-81252295 ATCAAAACTGTCTTCTGAATGGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1126831312 15:52609249-52609271 ATCACTGATGTCTCCTAACAAGG + Exonic
1126863797 15:52914925-52914947 ATTAAAAATGACATCTGACAAGG + Intergenic
1129546173 15:76397770-76397792 ATAATAAAAGTCTCCTGACCGGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130762954 15:86839704-86839726 ACCAAAATTGCCTCCTGTCAAGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1133866944 16:9652765-9652787 ATGCTAAAGGTCTCCTGACAGGG - Intergenic
1134004283 16:10807512-10807534 ATGAAAAATGTCTCCTGATGTGG - Intronic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135744708 16:25006835-25006857 TTGAAAAATCTCTGCTGACATGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137757018 16:50910485-50910507 ATCAAAAATGTCTCCTGCAGGGG + Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139276880 16:65736011-65736033 ATCAAAACTGTCTCCTAGGAGGG - Intergenic
1139285762 16:65812537-65812559 GGAAAAAATGTCTACTGACAGGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145199264 17:20926787-20926809 ATGAAATATTTCTCCTGAAAAGG - Intergenic
1146499321 17:33351096-33351118 ATCAAATATGTGACTTGACAAGG + Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1149717961 17:58812377-58812399 ATCAAACATATCTCCTGCTATGG - Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151066746 17:71159504-71159526 ATCAAAAATGCCTCTTAATATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153748050 18:8200408-8200430 AACAACAATGTCTTGTGACAAGG - Intronic
1154289025 18:13089435-13089457 AAAAAAAATCTCTCCTGGCAGGG + Exonic
1154352578 18:13598491-13598513 ATCAAAAATGACCCCTGCAAAGG - Intronic
1155168659 18:23250722-23250744 ATCAGGAAGGTCTCCTGACCTGG - Intronic
1157488964 18:48108998-48109020 CTGAAAAATGTCTCCTGCCAGGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160196602 18:76760247-76760269 ATCAAAAGTGGGGCCTGACATGG - Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1163838974 19:19594113-19594135 ATTAAAAATGTCGCCGGGCATGG + Intronic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
925289595 2:2738562-2738584 ATCCCACCTGTCTCCTGACAAGG + Intergenic
928477225 2:31640863-31640885 AAAAAAAAAGTCTCCTGCCAGGG + Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929426340 2:41848159-41848181 ATCTAAAAAGGCTCCTTACAGGG + Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930502264 2:52236131-52236153 CTCAAACTTTTCTCCTGACAAGG - Intergenic
932101674 2:68906901-68906923 ATCAATGATGTCACCTGACCAGG - Intergenic
933165059 2:79066475-79066497 ATCAAAACTAGCTCCTGAAAGGG - Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939161178 2:138591174-138591196 ATCTGAAATGCCACCTGACAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941427796 2:165369950-165369972 ATCATAAATGACTGCTGACTGGG - Intronic
942380898 2:175388954-175388976 AACTAAAAAGTTTCCTGACATGG - Intergenic
943178390 2:184508773-184508795 AAGATAAATGTCTCATGACAGGG - Intergenic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
944736548 2:202572018-202572040 AGGAAAAATGTGTCCTGAAATGG + Intergenic
945883829 2:215354017-215354039 AAAAAAAAAGTTTCCTGACAAGG - Intergenic
946899523 2:224358826-224358848 ATTAAAAATGTTTCCTGGCCGGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947868066 2:233415166-233415188 AACAGCCATGTCTCCTGACAAGG - Intronic
948576301 2:238952553-238952575 AACCAAAATGTCCACTGACATGG - Intergenic
1169191061 20:3659672-3659694 AACCAAGATGCCTCCTGACAGGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172938276 20:38636631-38636653 ATCAAAAATGTCCACTAATAGGG - Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179146242 21:38770425-38770447 TTTAAAAGTGTCTTCTGACATGG + Intergenic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184632890 22:45799230-45799252 ATAAAAAATGTTTCCTGGGACGG - Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956100423 3:65762226-65762248 ATCACAAATGCCTCCTGAAGTGG + Intronic
956221196 3:66905263-66905285 TTCAAAGATGTCTCTTGCCATGG - Intergenic
956280969 3:67556287-67556309 ATCAACACTGTTTCCTGACTTGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961341795 3:126228363-126228385 TTCTAAATTATCTCCTGACAAGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962676045 3:137759505-137759527 AGCAAAAAAGTCTCCTTACCTGG + Intergenic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963398434 3:144764076-144764098 GTCAGAAATGTGTCCTGAGACGG - Intergenic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964901284 3:161661638-161661660 ATCATAAATGACCCCTGAGATGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969401658 4:6959637-6959659 CTCAAAAATGGATCCTGAGAGGG - Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970661558 4:18291423-18291445 ATCCAAACAGTCTCCTTACATGG - Intergenic
971246040 4:24928902-24928924 ACCATAAATGTCACCTGAAAAGG - Intronic
971400586 4:26272018-26272040 CTTAAAAATGTCTCCTGACTAGG + Intronic
971641567 4:29139858-29139880 TTCAAAAATGTTTACTGAAAAGG - Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
973803936 4:54506614-54506636 ATCAAAAATGTCTTTTTACCAGG - Intergenic
975500430 4:75079043-75079065 ATCACAAAGTTCTCCTGCCATGG + Intergenic
975770221 4:77712240-77712262 ATCACAAAGGTCTCTTAACAAGG + Intergenic
975967644 4:79993880-79993902 ATCAAACATTTCTCATGAGATGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977787141 4:101049553-101049575 ATCAAAGATTGCTCTTGACATGG + Intronic
978611844 4:110550250-110550272 AGCAAAAGAGTTTCCTGACAAGG + Intronic
981479896 4:145227889-145227911 ATCACAAATTTCTCGTGTCATGG + Intergenic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983430641 4:167645913-167645935 TTCAAAAATGTCTGCTAGCAAGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983700559 4:170588283-170588305 CTCAAAAATGTCTAATGAGAGGG + Intergenic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984080560 4:175244342-175244364 ATCAAAAATGTCTCACAATAAGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
986968007 5:13298958-13298980 ATTAAAAATCACTCCTTACAAGG + Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987273987 5:16342774-16342796 CTCAAAAATGGTTGCTGACATGG + Intergenic
988663925 5:33304137-33304159 CTCAAAGAAGTCTCCTGATAAGG - Intergenic
988888696 5:35589700-35589722 ATCAAAAAGAACTTCTGACAAGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992078765 5:73215438-73215460 ATGAATAATTTCACCTGACACGG + Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993514245 5:88810752-88810774 GACAAAAATGTCTCCTGGGATGG - Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995066614 5:107869914-107869936 ATGATAAATGTTTACTGACATGG + Intronic
995415029 5:111900763-111900785 ATAAAAAAAGTCTCCTAACAAGG + Intronic
996189465 5:120521274-120521296 ATCTAAAATGTTTCATGAAATGG + Intronic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997633777 5:135389837-135389859 GTCACAAATGTCTCCTGAAAAGG + Intronic
997645668 5:135480185-135480207 ACCAAAAATGCCACCTGGCAAGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998498406 5:142611113-142611135 ATCAAAAATATCTCCTTGCCAGG + Intronic
1000420144 5:161029301-161029323 ATCATAAAGGCCCCCTGACAGGG + Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000764546 5:165270638-165270660 ATAAAAAAGGTCTGCTAACATGG + Intergenic
1000795302 5:165657114-165657136 ATCAAAAAATTCGCCTGGCATGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003631911 6:7795007-7795029 AACATAAATGTTTCCTGTCAAGG - Intronic
1003720299 6:8693894-8693916 CTCAAGAATGTGTCCTGAAAAGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004040488 6:11970272-11970294 CTCAAAAGTGTCTCTTGAGATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005091816 6:22064400-22064422 TTTAAAAATATCTGCTGACAAGG + Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009799135 6:68510876-68510898 TTAAAAAATGTCTACTGATAAGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013425414 6:110008266-110008288 AACAAAAGGGTCTCATGACAAGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014406691 6:121061398-121061420 TTTAAAAATTTCTCCTTACATGG - Intergenic
1014536853 6:122624313-122624335 ATCAAAAAGGTTTCCTGCTATGG - Intronic
1015329429 6:131960015-131960037 AAAAAAAATCTCTCCTGAAATGG - Intergenic
1015590740 6:134820781-134820803 TTCAGAAATGACACCTGACATGG + Intergenic
1016381900 6:143492615-143492637 ATCAAATTTGTATCCTTACAAGG - Intergenic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020728583 7:11849432-11849454 CTCTAAAATGTCTCTGGACACGG + Intergenic
1021416022 7:20385919-20385941 ATCACAATTATCTCCTCACATGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023799292 7:43819617-43819639 ATCAAAAATGTTGCTTTACAAGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030145302 7:106347389-106347411 ATGAAAAATGTCCGCTGAGAAGG - Intergenic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030946805 7:115733575-115733597 ATCAAACATATCTTCTCACATGG + Intergenic
1031261863 7:119531800-119531822 CTCAAAAATGACTCCTGCCATGG - Intergenic
1031425902 7:121605588-121605610 ATCAACACTGACTCCTGTCAAGG + Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032744419 7:134771410-134771432 ATCAAGAGTGTCTCCTGTTATGG - Intronic
1032993301 7:137417805-137417827 ATGAAAACTGTGTCCTCACATGG - Intronic
1033133660 7:138767139-138767161 AACAATAATGTCTCATTACATGG - Intronic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035791345 8:2308097-2308119 AACAAGAATGTCTCCTTTCATGG + Intergenic
1035801460 8:2413608-2413630 AACAAGAATGTCTCCTTTCATGG - Intergenic
1036107807 8:5860399-5860421 TTCAAAAATATCTCTTGAGATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1042449126 8:68923726-68923748 ATAAAAAATGTTTCCTGAATTGG - Intergenic
1043208891 8:77485045-77485067 ATGATAAATGTCTGATGACATGG - Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045316242 8:101046194-101046216 ATCAAAAATGCCGGCTGCCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046581198 8:116094568-116094590 AACAAAGATGTCTAGTGACATGG + Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1049057642 8:140251383-140251405 CTTAAAAATGTCTGATGACACGG - Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051261011 9:15264857-15264879 ATCCAAAATGACTCCTGTGATGG - Intronic
1052155261 9:25179560-25179582 AACAAAAATGTCTACTAAAAAGG + Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1056961055 9:91123693-91123715 AACAAAAATGTGTTCTGACTAGG + Intergenic
1058542106 9:106022249-106022271 ATTAAAAATCTCTCCTGACTTGG + Intergenic
1058807578 9:108607124-108607146 ATGAAGAATGTCGCCTGGCATGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185646924 X:1622578-1622600 TTTAAAAATGTCTCCTGGCTGGG - Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188453603 X:30336417-30336439 ATCAAAAAAGCAACCTGACAAGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189836970 X:45033846-45033868 CTCAAGAATGTCTCTTGGCAAGG - Intronic
1193624920 X:83806578-83806600 AGCAAAAATCTCTTTTGACAAGG + Intergenic
1193763844 X:85500929-85500951 ATAAAAAATGTTTCCTAAAATGG - Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195284532 X:103371192-103371214 AACAAAAATGTGTCCTTTCATGG + Intergenic
1195409327 X:104552378-104552400 ATGAATATTGTCACCTGACAAGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199268876 X:145859373-145859395 ATCAAATAAGTTTCCTGAAAAGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201307085 Y:12560346-12560368 ATAAATAATGTTTGCTGACAGGG - Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201990928 Y:20024583-20024605 ATCAAAAATGGCACATGAGAGGG - Intergenic