ID: 1146727537

View in Genome Browser
Species Human (GRCh38)
Location 17:35168444-35168466
Sequence CTGCTGTCCTTGAGGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146727533_1146727537 6 Left 1146727533 17:35168415-35168437 CCAGGGACACCAAAATGAATGAG 0: 1
1: 1
2: 1
3: 37
4: 237
Right 1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG 0: 1
1: 0
2: 2
3: 21
4: 224
1146727535_1146727537 -3 Left 1146727535 17:35168424-35168446 CCAAAATGAATGAGTTGAGGCTG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG 0: 1
1: 0
2: 2
3: 21
4: 224
1146727531_1146727537 18 Left 1146727531 17:35168403-35168425 CCATGCCAGGCACCAGGGACACC 0: 1
1: 2
2: 5
3: 55
4: 403
Right 1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG 0: 1
1: 0
2: 2
3: 21
4: 224
1146727532_1146727537 13 Left 1146727532 17:35168408-35168430 CCAGGCACCAGGGACACCAAAAT 0: 1
1: 0
2: 3
3: 28
4: 244
Right 1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG 0: 1
1: 0
2: 2
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146727537 Original CRISPR CTGCTGTCCTTGAGGAGACC AGG Intronic
900088074 1:908190-908212 CTGCTGTCCACGAGGAGGACCGG - Intergenic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900472889 1:2863352-2863374 CTGCTGGCCATGAGGGGTCCTGG + Intergenic
900991789 1:6101501-6101523 CTGCTGTCCCTCTGGGGACCTGG + Intergenic
901107998 1:6772464-6772486 GTGCTGCTCTTGAGTAGACCTGG - Intergenic
901206202 1:7497259-7497281 GCGCTGTCCCTGAGGAGGCCTGG + Intronic
901917021 1:12507747-12507769 CAGCTGACCTTGAGGAGCCGGGG + Intronic
901922957 1:12549101-12549123 GTGCTGGCCTTGAAGAGGCCTGG + Intergenic
902268143 1:15283644-15283666 CTGCTGTGCCAGAGGAGAGCTGG - Intronic
904471484 1:30739304-30739326 CTGTTGTCCTTGAAGAGACCGGG - Intronic
905046850 1:35010943-35010965 CTGCTGACCTGGAGGAGGGCGGG + Exonic
905662089 1:39735478-39735500 CTGCTGTCCATGTGCAGGCCAGG + Intronic
906845779 1:49190299-49190321 CTGCAGGCCCTGAGGAGACAAGG - Intronic
907387289 1:54134297-54134319 CTGCTGTCCCTGGGGTGGCCAGG - Intronic
908143152 1:61209035-61209057 CTGCTGTACTGGAGTAGCCCTGG + Intronic
910131381 1:83911050-83911072 CTGTTGTGTGTGAGGAGACCTGG - Intronic
911034481 1:93526381-93526403 CTGCTGACCTTAAGGAGACATGG - Intronic
914245332 1:145881566-145881588 CTGCTTTCCTGGGGGTGACCTGG - Intronic
914444794 1:147740712-147740734 CAGCCTTCCTTCAGGAGACCTGG + Intergenic
915086285 1:153391040-153391062 CAGCTGTCTTTCAGAAGACCTGG - Exonic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915968523 1:160334105-160334127 CTGCTTTGCTTGCTGAGACCTGG - Intronic
916925356 1:169513719-169513741 GTGCAGTCCTTAGGGAGACCAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917705783 1:177633295-177633317 CTGCTTTGTTTGTGGAGACCTGG + Intergenic
918417031 1:184320748-184320770 CAGCTGTCCATGAGGAGAGCTGG + Intergenic
918852427 1:189709082-189709104 CTGCTGTCCTGGAGGAGCTGAGG - Intergenic
920518411 1:206603659-206603681 TTGCAGTCCTTGAGCAGTCCAGG - Intronic
920811104 1:209286402-209286424 CTGCTATCCTCTAGGAGAACAGG - Intergenic
921390136 1:214607680-214607702 CTGCTTTGGATGAGGAGACCCGG - Intronic
922721022 1:227900426-227900448 CCCATGTCCTTGAGGTGACCTGG + Intergenic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1064059784 10:12128303-12128325 CTGCTGTACTTGAGGTCAGCTGG - Intergenic
1066802634 10:39207784-39207806 CTGCTTTCCCTGAGGGGACTTGG + Intergenic
1067529675 10:47061101-47061123 CCCCTGGCCTTGAGGAGACCAGG - Intergenic
1068572156 10:58642068-58642090 AAGCTGGCCTTGAAGAGACCTGG - Intronic
1069112642 10:64465752-64465774 CTCCTGTCCATGGAGAGACCAGG - Intergenic
1069724940 10:70571493-70571515 CTGCTGCCCTGGTGGAGACCCGG + Intergenic
1070278823 10:75033903-75033925 CTGCAGTCCTTAAGGAGCCTGGG - Intergenic
1070604334 10:77888275-77888297 CTGCTGCCCAGGAGGAGGCCAGG - Intronic
1070638897 10:78151889-78151911 CTGCTGTCTTTCAGGTGACTAGG + Intergenic
1073339804 10:102735974-102735996 CTGCTGTCCAGAAGGAGACAGGG + Intronic
1074044211 10:109821661-109821683 CTGCCCTCCATGATGAGACCAGG + Intergenic
1075495691 10:122916820-122916842 CTGGTGTCCATGAAGAGACTAGG - Intergenic
1076629699 10:131844878-131844900 CTGCTGTCCTGGAGAAGCCTTGG + Intergenic
1077423674 11:2464600-2464622 GTCCTGTCCTTGGGGAGGCCTGG + Intronic
1077508515 11:2943181-2943203 CTGAGGTCCTGGGGGAGACCAGG + Intergenic
1077571021 11:3338802-3338824 CTGATGTACTAGAGGAGACCTGG + Intergenic
1078757550 11:14225085-14225107 CTGCTGTGAGTGAGCAGACCTGG - Intronic
1078896067 11:15598303-15598325 CTTTTGTCATTAAGGAGACCAGG - Intergenic
1079032345 11:16994904-16994926 CTGGTGTCCTCAAGGAGCCCAGG - Intronic
1079280247 11:19080746-19080768 CTGCTGACCTTGAGGGGATGTGG + Intergenic
1079469116 11:20761477-20761499 CTGCTTTTCTTGAGAATACCAGG + Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1084710681 11:70842011-70842033 CTCTTGTCCTGGAGGAGCCCAGG - Intronic
1085179604 11:74522276-74522298 CTGCTCAGCTTGAGGAGGCCAGG + Intronic
1088359389 11:108975099-108975121 CTGGTGTCATTGGGGAGACGTGG + Intergenic
1088890505 11:114040671-114040693 CTGAGTTCCTTGGGGAGACCAGG + Intergenic
1089627956 11:119763290-119763312 CTAGTGTCCAGGAGGAGACCTGG - Intergenic
1090631445 11:128652655-128652677 CTTCTGTCCTTGAGGAGTTAAGG + Intergenic
1091643544 12:2255617-2255639 CTGGTGGCCTTCAGAAGACCAGG + Intronic
1092720373 12:11435072-11435094 CTGAGGTCCTAGAGGAGAGCTGG + Intronic
1095410247 12:41913467-41913489 TTGGTATCCTTGAGGAGTCCTGG - Intergenic
1095986133 12:48001015-48001037 CTGCAGTCTTGGAGGAGGCCAGG - Intronic
1101947593 12:109149803-109149825 CCTCTGTCCTTAGGGAGACCAGG + Intronic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1102261965 12:111448327-111448349 CAGCTGCCCTTGAGGAGCACAGG + Exonic
1106135237 13:26968623-26968645 CTGCAGTCCTTGGGGACTCCTGG - Intergenic
1106647403 13:31651200-31651222 CAGCAGTCATTCAGGAGACCAGG - Intergenic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1107423162 13:40268548-40268570 CTGGGGTCCTTAAGGAGAGCTGG - Intergenic
1107661346 13:42642908-42642930 CTGCTGTCTCTGAAGAGTCCAGG - Intergenic
1108719910 13:53120535-53120557 CTACTGGCTTGGAGGAGACCAGG + Intergenic
1109097243 13:58134070-58134092 CTGCTGTCTCTGAGGAATCCGGG - Intergenic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1112850771 13:103703810-103703832 GTGCTCTCCTTGAGGGGAACAGG - Intergenic
1113625976 13:111846768-111846790 CTGCTGTCCTGGAGTATTCCTGG + Intergenic
1113883968 13:113647662-113647684 CGGCTGTCCTCGAGGACTCCGGG + Intergenic
1113925733 13:113940449-113940471 ATGGAGTCCTAGAGGAGACCAGG - Intergenic
1115037656 14:28879606-28879628 GTGCTGCCTTTGAGCAGACCTGG + Intergenic
1115801930 14:37004439-37004461 ATGCTGTGTTTGAGGACACCTGG + Intronic
1118646481 14:67846000-67846022 CTTCTGTGCTGGAGGAGCCCAGG + Intronic
1120861175 14:89256150-89256172 CAGGTGTCCTTGAGGGGACAGGG - Intronic
1122024336 14:98864217-98864239 CTGATTTCCATGAGGACACCAGG - Intergenic
1122492437 14:102128138-102128160 AGGGTGTCCTAGAGGAGACCAGG + Intronic
1123568968 15:21582565-21582587 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1123605077 15:22017886-22017908 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1123904301 15:24906885-24906907 CTGCTGTCCCTTAGGAGAAGAGG + Intronic
1125309924 15:38367689-38367711 CTGCTGTCCATAAGGGGACCCGG - Intergenic
1125540506 15:40467275-40467297 CTGTTGTCCTTGTGGAGACTAGG + Exonic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1129348194 15:74937862-74937884 CTCGTGTCCTTGCGGTGACCTGG - Intronic
1130253098 15:82313585-82313607 ATGCTGGCTTTGAGGAAACCAGG - Intergenic
1132145045 15:99424637-99424659 CTCCTGTCCTGCAGGAGAGCTGG + Intergenic
1202977322 15_KI270727v1_random:309655-309677 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1133261911 16:4556436-4556458 CCCTTGTCCTTGAGGACACCTGG + Intergenic
1134026122 16:10955363-10955385 GTGCTGACCTTGAGGAGCTCAGG + Intronic
1136120190 16:28127882-28127904 CTGCTGTCCTTGTGGAGTGGAGG - Intronic
1140111176 16:72006478-72006500 CTGCTGACCTTGAAGAAACTGGG - Intergenic
1140238337 16:73179081-73179103 CTACTGACCTTGTGGATACCTGG + Intergenic
1142542549 17:671657-671679 CTGCTGTCCAAGAGCTGACCAGG + Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1143947465 17:10605634-10605656 CTGCTGTACTCTAGGGGACCAGG + Intergenic
1143953966 17:10654697-10654719 CTGCTTTCTCTGAGGATACCTGG + Intronic
1144585997 17:16488162-16488184 CTGCTGTCTTTAAGGAGCCCTGG - Intronic
1144598248 17:16589409-16589431 CTGCGTTCCTTGAGGACCCCGGG - Intergenic
1144778059 17:17794836-17794858 CTGCTGTCCTTGACCAGGCTGGG - Exonic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1151184162 17:72351142-72351164 ATGCTGTCCCAGAGGAGCCCTGG - Intergenic
1151382445 17:73735147-73735169 CTGCTCTACCTGAGGAGACATGG - Intergenic
1152121583 17:78422181-78422203 CTGCAGCCCTTCAGGTGACCAGG - Intronic
1152397124 17:80040237-80040259 CTGCTGGCCCAGAGGTGACCTGG - Exonic
1152552987 17:81039081-81039103 CTGCTGTCACTGAGTAGACCTGG + Intronic
1152733611 17:81985872-81985894 CTTCTGTCCTTGTGGGGGCCTGG + Intronic
1154343967 18:13527394-13527416 TTGCTGGCCTTCTGGAGACCGGG + Intronic
1155522032 18:26677961-26677983 CTGGTGTCCTTAAAGAGAGCAGG + Intergenic
1155953754 18:31939916-31939938 CTGATTTCCTTCAGGAGACTGGG - Intronic
1159628724 18:70724774-70724796 CTTCTGTCCTTGAGTTGGCCAGG + Intergenic
1160508032 18:79438074-79438096 CTGTGGTCCCGGAGGAGACCTGG + Intronic
1161408533 19:4103415-4103437 CTGCTGTCCTGGGGGTGGCCTGG - Intronic
1161810443 19:6468251-6468273 CTGCTGTCACAGAGGAGACCTGG - Exonic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1162376707 19:10309446-10309468 TTGCTGGCATTGAGGAGTCCGGG + Exonic
1165833434 19:38740873-38740895 CTGTGGTCCTTGGGGTGACCAGG + Intronic
927250283 2:20990344-20990366 CTCCTGTCCCTGAGCAGTCCTGG + Intergenic
927553568 2:24017919-24017941 CTGCTGTCCTCGCAGAGCCCTGG + Intronic
933300061 2:80531135-80531157 CTGCTGTCCTTGACCGCACCAGG - Intronic
934516089 2:94987659-94987681 GTGCTGTCCTGGAGGGGACTGGG - Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
936047051 2:109196274-109196296 CTGCTGGCCTGGAGCAGCCCAGG - Intronic
936693502 2:114920810-114920832 CTACTGTTCTTGAGTAGACTGGG - Intronic
937228679 2:120384369-120384391 CTGCTGCCCTGAAGGATACCTGG + Intergenic
937812081 2:126210591-126210613 CTTCTATCCCTGAGGAGACAAGG - Intergenic
938101096 2:128498721-128498743 CTGCTGTCCCCGTGGAGTCCTGG + Intergenic
941717673 2:168780699-168780721 TTGCTTTCCTTGAAGTGACCTGG - Intergenic
945727845 2:213494814-213494836 CTGGTGTCATTGAGGAGATAGGG - Intronic
946666950 2:222060424-222060446 CTGCTGTCGTGAAGTAGACCTGG - Intergenic
948515626 2:238501641-238501663 CTGTTGGCCATGAGGACACCAGG + Intergenic
948708751 2:239812240-239812262 CTACTGTGCTTCAGGAGAGCAGG + Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1169425415 20:5493041-5493063 CTGAAGTCCTTGAGGATACCTGG - Intergenic
1172636175 20:36411482-36411504 AGGCTGTCCATGAGGAGACCGGG - Intronic
1174249416 20:49207331-49207353 CTTCTGTCCTGGAGGAGCCAGGG + Intergenic
1175163420 20:57025386-57025408 ATGAGGTCCTTGAGGAGCCCCGG - Intergenic
1175894035 20:62328188-62328210 ATGCTGTCCTTAAGGCCACCAGG + Intronic
1176305988 21:5123427-5123449 TTGCTGGCTTTCAGGAGACCGGG + Intronic
1179851069 21:44138604-44138626 TTGCTGGCTTTCAGGAGACCGGG - Intronic
1179965698 21:44803566-44803588 CTGCTCTCCTTTAGGAGCACTGG - Intergenic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1184979953 22:48089167-48089189 ATGCCGCCCTTGAGGAGACAAGG - Intergenic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
949750066 3:7341911-7341933 CTGCTGTCATTCAGAAGACAAGG + Intronic
951637327 3:24793982-24794004 CTGCTGACCCTCAGGAGCCCTGG + Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953921617 3:46955791-46955813 CTGCTGTCCTTGGGGTGAGAAGG - Intronic
954273878 3:49529980-49530002 CTTCTGCCCTTGGAGAGACCAGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
955726034 3:61933799-61933821 CTGGTATCATTGAGGAGACAAGG - Intronic
959251573 3:103954535-103954557 CTGCTGAGGTTGAGGAAACCTGG + Intergenic
960171787 3:114470937-114470959 CTGATCTCCTGGAGCAGACCTGG + Intronic
960521318 3:118658672-118658694 TTGGTGTCCTTGCGGGGACCGGG + Intergenic
960723380 3:120646325-120646347 TAGATGTCTTTGAGGAGACCAGG - Exonic
961051721 3:123752401-123752423 ATGCTGTCCATGAGGAGGACAGG - Exonic
961378382 3:126481891-126481913 CTGCTGGCCTGGAGGAGTTCGGG - Exonic
965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG + Intergenic
966748503 3:183300627-183300649 CACCTGTCCTTGAGGAGAGTGGG + Intronic
968922110 4:3527650-3527672 GTGCTGGCCTTGAGGGGCCCCGG + Intronic
969304833 4:6319641-6319663 CTGCTGTGCTGGAGGTCACCCGG - Intergenic
969539291 4:7776527-7776549 CTGCTGTCCCTGAGTGGACAAGG - Intronic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
975890270 4:79019203-79019225 CAGCTGTCCTTGAGAAGTCAGGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
985732379 5:1556526-1556548 CTGCTGGCCCTGGGGAGGCCAGG - Intergenic
986261572 5:6152096-6152118 CCGCTGTCCTTGAGATGTCCTGG + Intergenic
988526072 5:31988417-31988439 CTTCTGTCCTTGTGGAGATGGGG + Intronic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
990219058 5:53566600-53566622 TTGGTGTCCTTGAGGAGTCCTGG - Intronic
990333009 5:54745873-54745895 CTGATGTCCTTGAAGAGCCTGGG + Intergenic
996853716 5:127981159-127981181 CTTCTGTCCCTGAGTAGACTTGG + Intergenic
999938615 5:156516088-156516110 CTGCTGGCTCTGAGGAGGCCAGG + Intronic
1000719919 5:164693510-164693532 CTGCTGGCTCTGAGGAGACTGGG + Intergenic
1002164276 5:177334957-177334979 CAGCTGTGCCTGAGGAGACTGGG + Intronic
1002198765 5:177515144-177515166 CTGGGGTCCTTGAGGAGGGCTGG - Intronic
1002319739 5:178367905-178367927 CTGCTGTCCTGGAGGGGCTCAGG + Intronic
1002441297 5:179265759-179265781 CTCCTGTCCTCGTGCAGACCGGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1005271010 6:24163676-24163698 CTACTGTAATAGAGGAGACCAGG + Intergenic
1006339991 6:33441608-33441630 CTGATGTCGTTGAGGAGCCGGGG - Exonic
1007297755 6:40839607-40839629 CTGCTTTCCAGGTGGAGACCTGG - Intergenic
1007503357 6:42315647-42315669 CTGATATCCTTCAAGAGACCAGG + Intronic
1008493365 6:52108408-52108430 CTGCTGCCCTTCAGGAGGCGAGG - Intergenic
1011377609 6:86706696-86706718 CTGCTGGCTTTGAAGAGTCCGGG - Intergenic
1011749179 6:90438309-90438331 CTCCTGTCCCTGAGGAGAGGTGG - Intergenic
1011753823 6:90479164-90479186 CTTCTGTAGTTGAGGAGATCTGG + Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1013090856 6:106899734-106899756 CTGGTGTCCTGGAGAAGCCCTGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1017455348 6:154596583-154596605 CTGCAGCCCTTGAAGAGGCCTGG - Intergenic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1019595638 7:1857127-1857149 CTGCTGTTGGTGAGGAGTCCTGG - Intronic
1019785517 7:2974667-2974689 CTGCTGTGGTGTAGGAGACCTGG + Intronic
1020769674 7:12373432-12373454 CTGCTCTCCTTGAGCAGGGCAGG + Intronic
1023989800 7:45121938-45121960 CTGCTGCCCTTGAGGTGCACAGG - Intergenic
1025731563 7:64113102-64113124 TTGCTGCACTTGAGGAGATCTGG - Intronic
1026373061 7:69721201-69721223 CTGCAGTACTTGAGCAGATCAGG - Intronic
1026831985 7:73615954-73615976 GTGCTGGCCTTGAGGACCCCGGG + Intronic
1028204700 7:88003141-88003163 TTGCTGCCCCTGAGGAGAGCAGG + Intronic
1029457292 7:100677709-100677731 CTGCCCTCCGTGTGGAGACCTGG + Intronic
1030941915 7:115660965-115660987 CTGCAGGACTTGAGGATACCCGG - Intergenic
1038248669 8:25882405-25882427 GTGCTTTCCATGAAGAGACCTGG + Intronic
1039562052 8:38520412-38520434 CTGATGTCCCTGAGGAGCTCAGG - Intronic
1039587369 8:38718537-38718559 CTTCTGCCCTTGGGGAGACATGG - Intergenic
1040314297 8:46252861-46252883 CTCCTATCCTAGAGGACACCAGG + Intergenic
1040707365 8:50145146-50145168 CTGCTGTCCTCCAGGTGGCCAGG - Intronic
1043475375 8:80600580-80600602 ATTTTGTCCTTGAGGAAACCAGG + Intergenic
1045354455 8:101373111-101373133 CTGCTGACATGGAGGAGCCCAGG - Intergenic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1047778696 8:128094113-128094135 CAGCTGTCATTTAGGTGACCTGG - Intergenic
1047929595 8:129713524-129713546 CTGCTGTCACTGAGGAGCCTTGG + Intergenic
1048871714 8:138804405-138804427 CTGCTCTCCTTGTGGGGCCCAGG + Intronic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049233204 8:141494857-141494879 GTGACGTCCTGGAGGAGACCTGG - Intergenic
1049317705 8:141978104-141978126 GTGCTGTTCTTGAGCAGGCCTGG - Intergenic
1049531267 8:143156806-143156828 CTGCTTTCCCTAAGGAGCCCAGG + Intergenic
1051162475 9:14223841-14223863 CCGTTGCCCTTGAGGAGACCAGG - Intronic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1053577885 9:39371261-39371283 AGGCTGTCCTGGAGGAGACGTGG + Intergenic
1053842397 9:42199204-42199226 AGGCTGTCCTGGAGGAGACGTGG + Intergenic
1054099461 9:60929978-60930000 AGGCTGTCCTGGAGGAGACGTGG + Intergenic
1054120858 9:61205602-61205624 AGGCTGTCCTGGAGGAGACGTGG + Intergenic
1056497897 9:87178123-87178145 CACCTGTCTTTGAGGAGACAAGG + Intergenic
1056953307 9:91063083-91063105 TTTCTGTCCCTAAGGAGACCAGG + Intergenic
1058619301 9:106865317-106865339 CTGGTGACTTTCAGGAGACCTGG - Intronic
1060186808 9:121568601-121568623 ATGCGGTCCTTGGGGAGGCCAGG + Intronic
1061544891 9:131298864-131298886 CTGCTGTCCTGGAGGCTTCCCGG - Intronic
1061820773 9:133226203-133226225 CTGCTGTCCTTCTGCAGACAGGG - Intergenic
1062154446 9:135038860-135038882 ATGCTGTCCTCAAGGAGCCCTGG - Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062555890 9:137113317-137113339 CTGCTGTCCCTTAGGGGGCCTGG + Intronic
1186863051 X:13691951-13691973 CCCCTGTCCTTGAGTAGCCCAGG - Intronic
1188777364 X:34236976-34236998 CTTCTGCCCTTGAAGAGACTAGG + Intergenic
1189230077 X:39445292-39445314 CTCCTGTCCTTGTCTAGACCTGG + Intergenic
1191896178 X:65995793-65995815 CTGCTGCCCATGAAGTGACCCGG + Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic