ID: 1146728682

View in Genome Browser
Species Human (GRCh38)
Location 17:35175702-35175724
Sequence ATTTAGGGATGCAACCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146728682_1146728685 -10 Left 1146728682 17:35175702-35175724 CCTGGGTGGTTGCATCCCTAAAT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1146728685 17:35175715-35175737 ATCCCTAAATAGTGATAGTGGGG 0: 1
1: 0
2: 1
3: 8
4: 72
1146728682_1146728688 14 Left 1146728682 17:35175702-35175724 CCTGGGTGGTTGCATCCCTAAAT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1146728688 17:35175739-35175761 GTGCTCTTTGCAGCCTCACTTGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146728682 Original CRISPR ATTTAGGGATGCAACCACCC AGG (reversed) Intronic
906838454 1:49109440-49109462 ATTAAGGGATGGCCCCACCCAGG - Intronic
910130881 1:83903757-83903779 ATCCATGGATGCAACCAACCAGG - Intronic
910280362 1:85494003-85494025 GTTTTGGGATGCAACCAGGCTGG + Intronic
911940623 1:104042804-104042826 ACTTAGGGCTGCAACCACTTGGG - Intergenic
914032315 1:143972429-143972451 ACTTAGGGGTTCAACAACCCGGG + Intergenic
914157130 1:145095538-145095560 ACTTAGGGGTTCAACAACCCGGG - Intergenic
919811890 1:201414049-201414071 ACCTAGTGATGCCACCACCCAGG + Intronic
920467792 1:206203313-206203335 ACTTAGGGGTTCAACAACCCGGG + Intronic
920747591 1:208643556-208643578 ATTGAGGGATTCCACCTCCCTGG + Intergenic
924163248 1:241255593-241255615 ATTTAGGGAGCCCACCATCCTGG + Intronic
1063982048 10:11462181-11462203 ATTTAGGGATGCACGCACAGTGG - Exonic
1065091112 10:22234580-22234602 ATATAAGGATGAAACCAGCCTGG + Intergenic
1068453340 10:57222441-57222463 ATTTTGGGATGCCAGCACCGGGG - Intergenic
1069808293 10:71139840-71139862 ATTTTGAAATGCAACCAGCCTGG + Intergenic
1072247235 10:93554599-93554621 TTTTAAGGATGAAACCATCCTGG - Intergenic
1079932941 11:26587544-26587566 ACTTAGGTTTGCAACCACCCTGG + Intronic
1080199422 11:29651161-29651183 ATTTTGGAATGTAAGCACCCTGG - Intergenic
1081431865 11:42985159-42985181 ATTTAGGGATGCAAAAACTGAGG - Intergenic
1092729025 12:11511081-11511103 ATGTGGGGGTGCAGCCACCCAGG - Intergenic
1094167303 12:27455974-27455996 ATTTTGGGATCCACCCACCTCGG - Intergenic
1100440390 12:94611835-94611857 ATTCATGGATTCAACCAACCAGG - Intronic
1107732601 13:43363668-43363690 ATTTAAGGCTGAAACCACTCAGG + Intronic
1110757906 13:79197531-79197553 ATTTAGGGTTGCAGAGACCCAGG - Intergenic
1111942036 13:94619953-94619975 CTTGAGGGATCCACCCACCCTGG + Intronic
1114493029 14:23114916-23114938 ATGTAGGGAGGCATCCACCTGGG + Intergenic
1120305438 14:82763877-82763899 GTCCAGGGCTGCAACCACCCAGG - Intergenic
1122595898 14:102891875-102891897 ATTTAGAGGGGTAACCACCCAGG - Intronic
1132419997 15:101657290-101657312 ATTCAGGCAAGCAAGCACCCAGG + Intronic
1133835380 16:9362998-9363020 ATTTAGAGATGAAGTCACCCAGG + Intergenic
1141292839 16:82736237-82736259 AGTTAGGCATCCACCCACCCAGG - Intronic
1143871888 17:9962864-9962886 ATTTGGGGGCACAACCACCCAGG - Intronic
1144606563 17:16670910-16670932 ATTTAGAGATGAAACCATGCTGG + Intergenic
1146595863 17:34168131-34168153 ATTGAGTCATGCCACCACCCAGG + Intronic
1146728682 17:35175702-35175724 ATTTAGGGATGCAACCACCCAGG - Intronic
1147855619 17:43477438-43477460 CTTAAGGGATCCAACCACCTTGG - Intergenic
1154438900 18:14369629-14369651 ATTCTGGGATAAAACCACCCTGG - Intergenic
1161749799 19:6087302-6087324 ATTTAGGAATTCAAACAGCCTGG + Intronic
1163475364 19:17522892-17522914 ATCTTGAGATGAAACCACCCTGG - Intergenic
1164801424 19:31079952-31079974 GTTTTGTGATCCAACCACCCTGG + Intergenic
1165661609 19:37585631-37585653 ATTCAGGAATCCAACAACCCAGG - Intronic
1165863200 19:38919917-38919939 ATGTGGGGATGAAAACACCCGGG + Intronic
1168715892 19:58527058-58527080 TTTTCGGGATGGAACCAGCCAGG - Intronic
928179494 2:29058013-29058035 ATTTAGGGATGCTGACTCCCAGG - Exonic
928370130 2:30734591-30734613 GTTTAGGGAAGCAAGCTCCCAGG - Intronic
938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG + Intergenic
941513471 2:166442774-166442796 ATTTATGGATGAAACAACACTGG - Intronic
947072180 2:226301364-226301386 ATTTAGGGAGCCAAGCACCATGG - Intergenic
1175262320 20:57682357-57682379 TTTTATGGATGAAACCACCGAGG - Intronic
1176116725 20:63435021-63435043 ATGTAGCGATGCAGTCACCCTGG - Intronic
1176456783 21:6919803-6919825 ATTCTGGGATAAAACCACCCTGG + Intergenic
1176834956 21:13784863-13784885 ATTCTGGGATAAAACCACCCTGG + Intergenic
1179971973 21:44841074-44841096 ATTCAGGGAGGCATCCACCCGGG - Intergenic
1180338949 22:11601957-11601979 ATTTCAGGAAGAAACCACCCTGG + Intergenic
1184253556 22:43274594-43274616 CTTTTGGGATGCTACCACCTTGG - Intronic
965156541 3:165066022-165066044 ATTCATGGATTCAACCAACCAGG + Intronic
969090197 4:4688331-4688353 ATTTATGGATGGAAACACCAAGG + Intergenic
978051863 4:104210966-104210988 ATTTTAATATGCAACCACCCAGG + Intergenic
980766140 4:137307268-137307290 ATTTATTTTTGCAACCACCCTGG + Intergenic
983792182 4:171812837-171812859 ATTTGGGTCTGCAAACACCCGGG - Intronic
988721737 5:33885883-33885905 ATTTAAGGCTGCCTCCACCCTGG - Intronic
992625219 5:78630742-78630764 CTTTAGTGCTGCAAACACCCAGG + Intronic
997222160 5:132178438-132178460 ATTGGGGAATGCAACCTCCCAGG + Intergenic
997580286 5:135012653-135012675 CTTCAGGGGTGCCACCACCCAGG - Intergenic
1006596082 6:35193349-35193371 ATTTGAGGCTGCAACAACCCAGG + Intergenic
1008266566 6:49434956-49434978 ATTTAGGGATGGGACCATCCTGG + Intronic
1015263892 6:131269491-131269513 ATTCAGGGAGGAAACCACCGTGG + Intronic
1019394765 7:811816-811838 ATCTAGAGATGCGACCATCCTGG - Intergenic
1019767445 7:2862245-2862267 ATCTATGGATTCAATCACCCAGG - Intergenic
1022108730 7:27214682-27214704 CTTTGGGGCTGCAGCCACCCAGG - Intergenic
1022566944 7:31413275-31413297 CTTTAGGGATGCAGGAACCCAGG - Intergenic
1026601800 7:71783584-71783606 AATGAAGGATGCAACCACCCAGG - Exonic
1035224088 7:157424161-157424183 ATTTGGGGATGGGAGCACCCCGG + Intergenic
1036121741 8:6025064-6025086 ATTTGGGGATGAAATCACACAGG - Intergenic
1036438670 8:8760393-8760415 ATTCAGAGATGTAACTACCCTGG + Intergenic
1036806939 8:11841569-11841591 ATTTAGGAATGCAACCTCTTGGG - Intergenic
1037892621 8:22631456-22631478 ATTTAGGGCTCAAACAACCCAGG + Intronic
1038608974 8:29041764-29041786 ATATATGCATGCTACCACCCAGG - Intronic
1038855028 8:31321526-31321548 ATTAAGGGATGCAGTTACCCAGG + Intergenic
1039819308 8:41122203-41122225 AAGCAGGGATGCATCCACCCAGG - Intergenic
1048081033 8:131127320-131127342 ATTGATGGTTGCAACCACCCAGG + Intergenic
1049984430 9:935333-935355 ATTTCAGGCTGCAACCAGCCAGG - Intronic
1050281742 9:4057371-4057393 TATTAGGGATGGATCCACCCAGG - Intronic
1052963774 9:34322618-34322640 CTTAAGGGATCCAACCACCTTGG - Intronic
1055497600 9:76871173-76871195 ATTCATGGATTCAACCAACCAGG + Intronic
1055636897 9:78287822-78287844 ATTTCGTGATCCAACCACCTCGG - Intergenic
1056370061 9:85944878-85944900 ACTGTGGTATGCAACCACCCTGG - Intronic
1057570612 9:96201639-96201661 ATTTAGGAATGCCAGCCCCCAGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1188810436 X:34647971-34647993 ATCTAGGAATGCAGCCAACCAGG + Intronic
1188999979 X:36933582-36933604 ATTCACGAATGCAGCCACCCTGG + Intergenic
1189221917 X:39379542-39379564 ATTCACGGATTCAACCAACCAGG + Intergenic
1193273745 X:79560313-79560335 ATTTATATATGTAACCACCCAGG + Intergenic
1196045301 X:111250266-111250288 ATTTTGAGATGAAACCATCCAGG + Intronic
1196200399 X:112880072-112880094 ATTTAGGCATCCATCCATCCAGG - Intergenic
1199318661 X:146412003-146412025 ATTTAGGAATACAACTAACCAGG + Intergenic
1200325624 X:155235528-155235550 ATTCAGGGATGCATGTACCCTGG - Intronic