ID: 1146730970

View in Genome Browser
Species Human (GRCh38)
Location 17:35193761-35193783
Sequence TGGACTCTGGACACTACAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 4, 1: 1, 2: 2, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146730970_1146730977 4 Left 1146730970 17:35193761-35193783 CCTCCTGTAGTGTCCAGAGTCCA 0: 4
1: 1
2: 2
3: 12
4: 145
Right 1146730977 17:35193788-35193810 CCACAATGATGATTAGTCCTAGG 0: 2
1: 3
2: 0
3: 9
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146730970 Original CRISPR TGGACTCTGGACACTACAGG AGG (reversed) Exonic
900250027 1:1663932-1663954 TATATTCTCGACACTACAGGAGG + Exonic
900261060 1:1729842-1729864 TATATTCTCGACACTACAGGAGG + Intronic
903382946 1:22909347-22909369 AGGACTCTGGACTCTCCAGGGGG + Intronic
904467290 1:30715870-30715892 TGGACCCTGGACACCACTGATGG - Intronic
907965594 1:59325492-59325514 TGGGCTCTGGACAGTAGAGAGGG - Intronic
908180029 1:61594335-61594357 TGGCCTCAGGACACTGGAGGAGG + Intergenic
910000764 1:82339672-82339694 TGAACTCTAAACACTAAAGGTGG - Intergenic
912174825 1:107141720-107141742 TGGGCTCCGGACACAACAAGAGG - Intronic
915034649 1:152911556-152911578 GGGCCTCTGGACACTGCGGGTGG - Exonic
917004757 1:170401799-170401821 TAGACACTGGAGACTACTGGGGG + Intergenic
919570650 1:199243389-199243411 TGGGCTCTTGACTTTACAGGGGG - Intergenic
920092061 1:203461888-203461910 TAGACTCTGGGCTCCACAGGTGG - Intergenic
922803447 1:228374232-228374254 TGGACCCTGGAGACACCAGGAGG - Intronic
1067140832 10:43655316-43655338 TGGGACCTGGACACTCCAGGTGG + Intergenic
1070783816 10:79151793-79151815 TGGACTCTGGAGGCTGCAGTGGG + Intronic
1071425186 10:85542471-85542493 TGGACTCTGGAATTTGCAGGAGG - Intergenic
1071996066 10:91150773-91150795 GGGAATCTGGAAACTATAGGAGG + Intergenic
1072929295 10:99646834-99646856 TAGACACTGGAGACTACAGAAGG - Intergenic
1073063110 10:100743947-100743969 TGGGCTCTGGAGGATACAGGAGG + Intronic
1074222098 10:111447980-111448002 TGGACTTTGGAGACTCAAGGTGG - Intergenic
1074878680 10:117634465-117634487 GGGACTCTGGACAGGACAAGAGG - Intergenic
1075614586 10:123882254-123882276 TGGCTTCTAGACACTAAAGGGGG - Intronic
1076058753 10:127396542-127396564 TGGACTCCAGAGACAACAGGAGG - Intronic
1076405474 10:130209463-130209485 TGGACCCTGGACACAAAATGAGG - Intergenic
1076663322 10:132069607-132069629 TGGCCGCTGGACACAACAGGAGG - Intergenic
1077415237 11:2421695-2421717 TGGACTCTGGCCCCTGCAGCTGG + Intronic
1078155914 11:8799879-8799901 AGGACTGTAGACACTACACGTGG - Intronic
1079238125 11:18703981-18704003 TGAACCCTGGACACTAAAGAGGG + Exonic
1082745265 11:56954288-56954310 TAGACTCTGGAGACTACTAGGGG + Intergenic
1084491867 11:69483289-69483311 TACACTCTGGAGCCTACAGGTGG + Intergenic
1087065945 11:94028138-94028160 TGGGCTCTGGACAGTAGAGTTGG + Intronic
1092916707 12:13196069-13196091 TGGACTCTCCACATTCCAGGAGG - Intergenic
1097959289 12:65516808-65516830 TGGAGGCTGGACACCAAAGGTGG - Intergenic
1101432809 12:104641000-104641022 TGGACATTGGAGACTACAGTTGG + Intronic
1103247885 12:119473616-119473638 TGGACTCTGGGGACTCCTGGGGG - Intronic
1104783766 12:131437112-131437134 GGGACTCTGGAGACAGCAGGGGG - Intergenic
1107832048 13:44383172-44383194 TAGACCCTTGACAATACAGGTGG - Intronic
1110268548 13:73567534-73567556 TGCTGTCTGGACACTCCAGGCGG + Intergenic
1110671698 13:78188040-78188062 TGGACTGAAAACACTACAGGGGG + Intergenic
1112363787 13:98740309-98740331 TGGACGGTGGACAGTCCAGGTGG - Intronic
1117750914 14:58923272-58923294 TGGACCCTGGGAACTACAAGAGG + Intergenic
1120375130 14:83695203-83695225 CTGCCTCTGGACACTACAGAAGG - Intergenic
1120965298 14:90161920-90161942 TGGAATCTCAACACTTCAGGAGG + Intronic
1121373169 14:93379687-93379709 TGGACTTTGGGGACTGCAGGGGG + Intronic
1122372639 14:101237101-101237123 TGGACTCTGCCCATCACAGGGGG - Intergenic
1126073017 15:44882549-44882571 TGGACTCTAGGCTCTACTGGTGG - Intergenic
1126205750 15:46042832-46042854 TGGAGGCTGGCTACTACAGGTGG - Intergenic
1131670482 15:94614604-94614626 TGGACTCTGCACACCCCTGGAGG - Intergenic
1132267130 15:100484035-100484057 TGGGCTGTGCACCCTACAGGAGG + Intronic
1132940121 16:2502226-2502248 TTGCCTCTGGGCACTATAGGGGG + Exonic
1137039278 16:35595052-35595074 TGGAAACTGGACACTGCAGTAGG - Intergenic
1137373999 16:47936071-47936093 TAGACACTGGGGACTACAGGAGG - Intergenic
1138444563 16:57055289-57055311 TGGATTCTGGACACTTCCAGAGG + Intronic
1139229437 16:65269235-65269257 TGGACACTGGAGACTGCTGGAGG - Intergenic
1139357787 16:66377559-66377581 TGGACTCTGTACATCACAAGAGG - Intronic
1140451253 16:75072502-75072524 TGGACACTGAACAGTACAAGGGG - Intronic
1143527791 17:7482509-7482531 TGGACTCTGGACACTACAGGAGG + Exonic
1143912836 17:10266193-10266215 TGGACACTGGACACTAAGGCTGG + Intergenic
1144807480 17:17977487-17977509 TGGCCACAAGACACTACAGGGGG + Intronic
1146730970 17:35193761-35193783 TGGACTCTGGACACTACAGGAGG - Exonic
1146996711 17:37326880-37326902 TGGACTCTAGAAAATACATGAGG + Intronic
1147636886 17:41969386-41969408 TGGACTCTGGCCACTCTAGCAGG + Intronic
1148278068 17:46323990-46324012 TGGACTTTGGTAACTGCAGGGGG + Intronic
1149534599 17:57422952-57422974 TGGACTGGTGACACTTCAGGAGG + Intronic
1150014491 17:61539797-61539819 TAGACGCTGGACACTACTGGTGG - Intergenic
1152571902 17:81124600-81124622 TGGCGTGTGGCCACTACAGGTGG + Intronic
1154115531 18:11610120-11610142 TGGACTCTGGACACTACAGGAGG + Intergenic
1154119977 18:11644335-11644357 AGGACTCTGGACACTACAGGAGG + Intergenic
1155171087 18:23267279-23267301 TGGCCTCAGGACACCACTGGGGG + Intronic
1155176650 18:23307061-23307083 TGGACTCTGTTCACTGTAGGAGG - Intronic
1160303038 18:77703887-77703909 TGGACTCTGGAAACTACTGCAGG + Intergenic
1160673263 19:376291-376313 TGGGCTCTGGACATTACCGACGG - Intergenic
1161021476 19:2013546-2013568 TGGACCCTGGACTCTGCAGAAGG - Intronic
1164255915 19:23528080-23528102 TGCACTCTGGCCACTAGAGCTGG - Intronic
1165944402 19:39433021-39433043 TGCACACTGGACTCTACTGGAGG + Intergenic
925702735 2:6655145-6655167 TGTACTCTGGAAACTTCAGGAGG - Intergenic
926045156 2:9704651-9704673 TGGATTTTGCACATTACAGGGGG - Intergenic
928682616 2:33717821-33717843 TGTTCTCTGCACACTGCAGGTGG - Intergenic
930004656 2:46886966-46886988 TAGCCTCTGCACACTACTGGAGG + Intergenic
943283746 2:185970800-185970822 TGCACTCTGGACACTTGAGCTGG + Intergenic
943384513 2:187184856-187184878 TGGACACTGGAGACTACAGTTGG - Intergenic
944102561 2:196044421-196044443 TGGACTCTGGAGACTCAAGGGGG + Intronic
946374582 2:219300283-219300305 TGGCCTCTGGACAGTGCTGGGGG + Intronic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947222298 2:227805120-227805142 TGGAAACTGTACACTACAGCTGG - Intergenic
947571431 2:231238713-231238735 TGGACTCAGGATAATATAGGAGG + Intronic
948359448 2:237409023-237409045 TGGAATCTGGACATTTCAAGGGG - Intronic
948668695 2:239552514-239552536 TGGCCTCTGCACAGGACAGGCGG + Intergenic
948794913 2:240397557-240397579 AGGACTCTGGGCAGTGCAGGGGG - Intergenic
1171823622 20:29876237-29876259 AGGGCTCTGGACTCTCCAGGCGG - Intergenic
1172039625 20:32034838-32034860 GGGTCTCTGGATGCTACAGGAGG - Intergenic
1172448988 20:35008568-35008590 TGGACGCTGGTGACTAAAGGAGG + Intronic
1173163325 20:40668760-40668782 TGGACTCTGCTCTCTCCAGGCGG - Intergenic
1175745217 20:61451746-61451768 TGGACTCTGGACAGGGCAGGAGG + Intronic
1176178483 20:63739336-63739358 TGGACCCTGGACTCCACGGGAGG + Intronic
1176584020 21:8559164-8559186 TGTAATCTGAACACTTCAGGAGG + Intergenic
1180266831 22:10536076-10536098 TGTAATCTGAACACTTCAGGAGG + Intergenic
1182231272 22:28839191-28839213 TGGACTGCAGACACTATAGGGGG + Intergenic
1185267197 22:49910554-49910576 TGGACTCTGGACGTTACAAAAGG - Exonic
950742298 3:15061596-15061618 TGCACTCTGGACACTTTGGGAGG - Intronic
964308821 3:155370545-155370567 TGGACTCAAGATAATACAGGAGG + Intergenic
964664677 3:159159170-159159192 TGGACTCTGGGCTATAGAGGTGG + Intronic
966881451 3:184353417-184353439 TGGACTCTGGACAGAACAGGTGG + Exonic
969068967 4:4516188-4516210 TGGGCTCTGTACATTTCAGGGGG + Intronic
971847382 4:31937004-31937026 TGGACTCTGGGGACTCCAGGTGG + Intergenic
978937844 4:114399688-114399710 TGGACACTGGGGACTACAGCTGG - Intergenic
979854414 4:125613207-125613229 TGGACTCAGGACCCTATAGAGGG + Intergenic
979858564 4:125664955-125664977 GGGACACTGGAGACTACAGCTGG - Intergenic
980721869 4:136708134-136708156 TGGACTCTGACCAATACAGGTGG - Intergenic
983662537 4:170144323-170144345 TGGACTTTGGAGACTGCGGGGGG - Intergenic
985445465 4:190019051-190019073 AGGGCTCTGGACTCTCCAGGCGG - Intergenic
985627083 5:994734-994756 TGGACTCTGAACACTGCATGGGG - Intergenic
985702996 5:1384785-1384807 AGGACACTGGACACTGCAGCTGG - Intergenic
992852086 5:80820932-80820954 TGGACTCTGGTCCCTAAAGTGGG + Intronic
993872776 5:93271655-93271677 TGGGCACTGGGCACTCCAGGAGG + Intergenic
998402823 5:141856776-141856798 TGGGCCCTGGATGCTACAGGGGG - Intronic
999186582 5:149715142-149715164 TGGACTCTGGAGGATCCAGGGGG + Intergenic
1001090155 5:168734015-168734037 TGGACACTGGAGACTACAAAAGG + Intronic
1001255843 5:170183073-170183095 TGGACTCTGGTCTGAACAGGGGG + Intergenic
1007930613 6:45687324-45687346 TGGACTCTGGACTCCACGAGCGG + Intergenic
1008683848 6:53903047-53903069 TGGTCTCTGGGCACCACAGCTGG - Intronic
1010664721 6:78615294-78615316 TAGGCTCTGGACACTCCAGAAGG - Intergenic
1013224886 6:108113786-108113808 TGGAGACTGGACACTCCATGGGG + Intronic
1013498036 6:110718358-110718380 AGGGCTCTGGACTCTGCAGGAGG - Intronic
1016846798 6:148576241-148576263 TGGAGAATGGGCACTACAGGGGG - Intergenic
1020739491 7:11995950-11995972 TGGACACTGGGCAATACAAGAGG - Intergenic
1028942609 7:96540747-96540769 TAGACACTGGAAACTACTGGGGG - Intronic
1031248239 7:119345801-119345823 TGGACACTGGAAACTACTTGAGG - Intergenic
1033497831 7:141917453-141917475 AGGACTCTGGAGAAAACAGGTGG + Intronic
1035071507 7:156148304-156148326 TGGGCTGTGGACACTATAAGGGG + Intergenic
1035731908 8:1859667-1859689 TGCAGCCTGGTCACTACAGGAGG - Intronic
1036716362 8:11127789-11127811 TGGAATATGGACACTGCGGGGGG + Intronic
1036737567 8:11331631-11331653 TGGACTCTGGACACTACAGGAGG + Exonic
1037427408 8:18771087-18771109 TGGACATTGGAGACTACAGCTGG - Intronic
1038369075 8:26969847-26969869 TGGACGTTGGAGACTACAGTTGG - Intergenic
1040022869 8:42756108-42756130 TGGCCTCTGGACAAGACAAGGGG - Exonic
1040778026 8:51070888-51070910 TTGAATCTGTACCCTACAGGTGG - Intergenic
1041211414 8:55555004-55555026 TGGGTTCGGGAAACTACAGGTGG + Intergenic
1041988419 8:63954751-63954773 TGGACATTGGAGACTACAGTCGG - Intergenic
1045799921 8:106090291-106090313 TGGACACTGGAGGCTACAAGAGG - Intergenic
1046181015 8:110647761-110647783 TAGACACTGGGCACTACAAGAGG + Intergenic
1048439584 8:134450174-134450196 TGGACTTAGGAGACTACAGTTGG + Intergenic
1049247280 8:141569599-141569621 TGGCCTTGGGACACTCCAGGTGG + Intergenic
1049515085 8:143050092-143050114 TGGACTCTGCGCCCTGCAGGTGG + Intronic
1049695864 8:143984031-143984053 TGGACCCCAGACAGTACAGGTGG - Exonic
1050396004 9:5196532-5196554 TAGACTCTGGGGACTACAAGAGG - Intergenic
1051191970 9:14522710-14522732 TGGACTTTGAACAATAAAGGTGG - Intergenic
1054254538 9:62800274-62800296 AGGGCTCTGGACTCTCCAGGCGG + Intergenic
1054336763 9:63815328-63815350 AGGGCTCTGGACTCTCCAGGCGG - Intergenic
1056920312 9:90781963-90781985 TGGAAACTGGACACAACAGTAGG - Intergenic
1056958986 9:91105207-91105229 TGGATTCTGGACAACAGAGGCGG + Intergenic
1058174349 9:101720829-101720851 TAGACTCTGGAGCCTACTGGAGG + Intronic
1058922978 9:109635325-109635347 TGGACTCTGGGAACTTGAGGGGG + Intergenic
1062423200 9:136493943-136493965 AGGACTCTGGCCCCTATAGGAGG - Intergenic
1186069741 X:5805874-5805896 TGGAGTCTGGAGGCTTCAGGTGG + Intergenic
1187449939 X:19387312-19387334 TGAACTCTGGACACCAGATGGGG + Intronic
1191131633 X:57019220-57019242 TAGACACTGGAGACTACTGGAGG - Intergenic
1192458452 X:71297248-71297270 TGGAATCTGGACACCACAGGTGG + Intronic
1193427849 X:81361618-81361640 TAGACACTGGAGACTACAGAAGG + Intergenic
1195014066 X:100761259-100761281 TGGACTCTGGAAACTTGGGGGGG + Intergenic
1199531037 X:148847906-148847928 TGGACTGTGTACACTTCAGGAGG - Intronic
1199823558 X:151475184-151475206 TGGACACTGGAGACTACTTGGGG - Intergenic
1201548060 Y:15188539-15188561 TGGAATCTGAACTCTATAGGCGG - Intergenic
1201994038 Y:20063496-20063518 GAGACTCTGGACACTACCGAAGG + Intergenic