ID: 1146730989

View in Genome Browser
Species Human (GRCh38)
Location 17:35193858-35193880
Sequence CTCAAGGCAGAGAGTGAGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 2, 2: 3, 3: 70, 4: 594}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146730978_1146730989 30 Left 1146730978 17:35193805-35193827 CCTAGGATGCAGCCCAACAGTCC 0: 1
1: 4
2: 0
3: 13
4: 171
Right 1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG 0: 1
1: 2
2: 3
3: 70
4: 594
1146730980_1146730989 17 Left 1146730980 17:35193818-35193840 CCAACAGTCCACACCAGTCGTAG 0: 3
1: 1
2: 1
3: 6
4: 54
Right 1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG 0: 1
1: 2
2: 3
3: 70
4: 594
1146730981_1146730989 9 Left 1146730981 17:35193826-35193848 CCACACCAGTCGTAGCCACTGAG 0: 3
1: 0
2: 1
3: 11
4: 82
Right 1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG 0: 1
1: 2
2: 3
3: 70
4: 594
1146730982_1146730989 4 Left 1146730982 17:35193831-35193853 CCAGTCGTAGCCACTGAGACCCT 0: 2
1: 1
2: 1
3: 8
4: 98
Right 1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG 0: 1
1: 2
2: 3
3: 70
4: 594
1146730984_1146730989 -6 Left 1146730984 17:35193841-35193863 CCACTGAGACCCTGGCTCTCAAG 0: 2
1: 2
2: 2
3: 21
4: 272
Right 1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG 0: 1
1: 2
2: 3
3: 70
4: 594
1146730979_1146730989 18 Left 1146730979 17:35193817-35193839 CCCAACAGTCCACACCAGTCGTA 0: 3
1: 1
2: 0
3: 3
4: 151
Right 1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG 0: 1
1: 2
2: 3
3: 70
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146730989 Original CRISPR CTCAAGGCAGAGAGTGAGGA CGG Exonic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900763010 1:4485607-4485629 CTGACGGCTGAGAGGGAGGAAGG + Intergenic
900816931 1:4854886-4854908 CCCAAGGCAGAAAGTTAAGAGGG - Intergenic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901149869 1:7094104-7094126 CTAAAGGCAGAGGGTGAAGACGG + Intronic
901492700 1:9604654-9604676 CTCAAGTCTGAGGGTGAGGATGG - Intronic
901921751 1:12541807-12541829 CCCGTGGCAGAGAGTGAGGGAGG - Intergenic
902077659 1:13800737-13800759 CTCAAAGCAGGGAGTCAGTATGG - Intronic
903183698 1:21618053-21618075 CTCAGGGCTGAGAGTGCGGATGG + Intronic
904426038 1:30423772-30423794 CAGAAGGCAGAGGATGAGGAAGG + Intergenic
905267070 1:36761575-36761597 GGCAAGGCAGAGTGTGAGGGTGG - Intergenic
905293320 1:36938262-36938284 GACCAGGCAGAGAGAGAGGATGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
906514921 1:46433179-46433201 TTCAGGGCAGAGGGTGAGGAGGG + Intergenic
906534341 1:46543497-46543519 CCCAAGGCCCAAAGTGAGGAGGG - Intergenic
906649679 1:47503728-47503750 GTCAAGGAAGAGAGTTGGGATGG + Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907868857 1:58424742-58424764 TGAAAGACAGAGAGTGAGGAGGG + Intronic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
908063131 1:60372995-60373017 CTCATGGCAGAAAGTGAAGAGGG - Intergenic
908152182 1:61313359-61313381 CTCATGGCAGAGGGTGACGCAGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908365160 1:63414848-63414870 CACAAGGCAGGCAGTCAGGAGGG + Intronic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
909468244 1:75998883-75998905 ATCATGGCAGAAGGTGAGGAGGG - Intergenic
909860105 1:80594284-80594306 TTCAAGGCAGCCAGTGAGCAGGG - Intergenic
910142201 1:84038275-84038297 TTCCAGGCAGTGAGTGAGCAGGG + Intergenic
910291904 1:85607508-85607530 CTCAAGGAAGAGAGTGAGTCAGG - Intergenic
911671199 1:100610195-100610217 CTCAAAGCAGTGATGGAGGAAGG - Intergenic
911762050 1:101627581-101627603 CTCATGACAGAAAGTGAGGCAGG - Intergenic
912517043 1:110223001-110223023 CTCCAGGCAGAAAGTGGTGATGG - Exonic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912714043 1:111969355-111969377 CTCAAGTCAGAGGTTGTGGAAGG + Intronic
912952076 1:114127188-114127210 CTCAAGTGAGAGTGTGTGGAAGG + Intronic
913567339 1:120085648-120085670 CTAGAGGCAGAGTGTGATGAAGG - Intergenic
913630795 1:120707898-120707920 CTAGAGGCAGAGTGTGATGAAGG + Intergenic
913707197 1:121437115-121437137 CTAAAGGAAGAGAGAAAGGAAGG + Intergenic
913960108 1:143332872-143332894 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914054464 1:144158445-144158467 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914124682 1:144807916-144807938 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
914240533 1:145849877-145849899 CTCAAGGCAGGGAAAGGGGAAGG - Intronic
914288087 1:146246354-146246376 CTAGAGGCAGAGTGTGATGAAGG - Intergenic
914549123 1:148697100-148697122 CTAGAGGCAGAGTGTGATGAAGG - Intergenic
914617559 1:149374619-149374641 CTAGAGGCAGAGTGTGATGAAGG + Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917505275 1:175621720-175621742 ATAAAGGCAGAGAGGAAGGAGGG - Intronic
917664358 1:177209368-177209390 ATTAGGGCAGAGAGTGAGGATGG + Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
918112565 1:181469948-181469970 CTTCAGCCAGAGGGTGAGGAGGG + Intronic
918440200 1:184559321-184559343 CTCATGGCAGAAAGTGAGGCAGG - Intronic
918992424 1:191714895-191714917 ATCAAGTGAGAGAGTGGGGAGGG + Intergenic
919755059 1:201061509-201061531 GACAAGGCAGAGAGTCAGGCTGG + Intronic
920037460 1:203075508-203075530 CTCCAGGCAGGGCGTGAGGATGG + Intronic
920195521 1:204223664-204223686 CCCCAGGCAGGGAGTGAGGCAGG + Intronic
922396108 1:225202566-225202588 TTCCAGGCAGAGGGTGAGCAGGG + Intronic
922435375 1:225600022-225600044 CTCATGGCAGAAAGTGAAGTGGG - Intronic
922464884 1:225839806-225839828 CTGAAGGCAGAGAGAGGGGCCGG - Intronic
923020562 1:230160111-230160133 TTCATGGAAGGGAGTGAGGAAGG - Intronic
924067248 1:240236602-240236624 CTCACGGCAGAAGGTGAAGAGGG + Intronic
1063764434 10:9121709-9121731 CTCATGGCAGAATGTGAAGAGGG - Intergenic
1064029981 10:11877480-11877502 CCCAAGGCAGTGGGTGGGGAAGG + Intergenic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1064715252 10:18170187-18170209 CACAAGGCTAAGAATGAGGAGGG + Intronic
1065054207 10:21827234-21827256 CCCAAGGCAGACACTGGGGAGGG - Intronic
1066293432 10:34034257-34034279 GTCCAGGGAGAGAGGGAGGATGG - Intergenic
1066390653 10:34975250-34975272 CTCAAAGGGGAGAATGAGGAGGG + Intergenic
1066763079 10:38775770-38775792 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1067356434 10:45532550-45532572 CACATGGCATAGAGGGAGGAAGG - Intronic
1067752353 10:48980071-48980093 GTCAGGGCAGACAGAGAGGAAGG - Intronic
1067764001 10:49071590-49071612 AGCAAGGCTGAGAGTGAAGAGGG + Intronic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1068257334 10:54530170-54530192 GGAAAGGCGGAGAGTGAGGAAGG - Intronic
1068554287 10:58440622-58440644 CTCAAGGAGGAGAGTGGGGTGGG - Intergenic
1068949318 10:62761504-62761526 ACCAAGGCACAGAGAGAGGAAGG - Intergenic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1069785052 10:70982387-70982409 CTCAAGGCAGAGCCTGAGGCAGG - Intergenic
1070456833 10:76625381-76625403 CTAAAAGGACAGAGTGAGGAGGG + Intergenic
1070842236 10:79495176-79495198 TGCAAGGAAGGGAGTGAGGAGGG - Intergenic
1070940191 10:80337691-80337713 CTCCAGGCAGAGAGCATGGAAGG - Intronic
1071568723 10:86684925-86684947 CTCAGGTCAGAGTGAGAGGAAGG + Intronic
1072771237 10:98140437-98140459 CAATAGGCAGAGAGAGAGGAGGG + Intronic
1073127805 10:101162832-101162854 CTCTAGGGAGAGAGTTAGAAAGG - Intergenic
1073398607 10:103238872-103238894 CAGAAAGGAGAGAGTGAGGATGG + Intergenic
1074681580 10:115912859-115912881 CACAAGGCAGGGAGGGAGCATGG + Intronic
1075005862 10:118829801-118829823 CTCACTGCTGATAGTGAGGATGG - Intergenic
1075649349 10:124117445-124117467 ACCAAGGCAGAGAGGGAGGGTGG - Intergenic
1075808782 10:125209229-125209251 CTCAGGCCAGAGAGGGAGAAAGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076828372 10:132981846-132981868 CTCCAGGCCGAGGGTGAGGATGG - Intergenic
1077116970 11:889589-889611 CTCCAGGCTGAATGTGAGGAAGG + Intronic
1077206009 11:1344766-1344788 CTCAAGGCAGAAACTGTGGATGG + Intergenic
1077890566 11:6415206-6415228 CTCAAGGCAGGGAGTTGGGCAGG + Intronic
1078082131 11:8211693-8211715 CTCAAGCAATAGGGTGAGGAGGG + Intergenic
1078335828 11:10462511-10462533 CCCAAGGCAGAGATGGAGGCAGG + Intronic
1078452801 11:11452918-11452940 TTCGAGGCAGAGATTGAGCAGGG + Intronic
1079205817 11:18413412-18413434 CCAAAAGCAGAGAGGGAGGAGGG - Intronic
1079372749 11:19865497-19865519 CCCCAGGAAGAGAGTGAGGCTGG - Intronic
1080878767 11:36300276-36300298 CTCATGGCAGAAGGTGAGGGGGG + Intronic
1081574919 11:44313065-44313087 CTCAAGGCACAGGCTCAGGAAGG - Intergenic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1082738632 11:56885339-56885361 CTCAAAGCAGACATTCAGGAAGG - Intergenic
1082789945 11:57340231-57340253 CTCCAGGCAGAGATTGATGGGGG + Intronic
1083528572 11:63396080-63396102 TTCCAGGCAGTGAGTGAGCAGGG + Intronic
1083949629 11:65946939-65946961 CTCAAGGCAGACAGCAAAGAAGG + Exonic
1084274573 11:68044820-68044842 CTCACGTCAGAGAGAGGGGAAGG + Intronic
1084462845 11:69305926-69305948 CTCAGGGCAGAGACAGAGGCAGG + Intronic
1084721604 11:70909326-70909348 CTCACGGCACAGAATGAGGGAGG + Intronic
1085750472 11:79156592-79156614 ATCTAGACAGAGGGTGAGGAAGG - Intronic
1086720250 11:90111824-90111846 CTCACAGCTGAGAGTGAGGATGG - Intergenic
1087651590 11:100874654-100874676 ATCAAGGCAGAGAATGAAAAAGG - Intronic
1087942432 11:104115045-104115067 CTCAGGGAAGAGGGTGGGGAGGG - Intronic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1088715245 11:112543337-112543359 CTTAAATCAGAGAGTCAGGAAGG - Intergenic
1089213610 11:116822389-116822411 CTCATGGAAGAGAGGGAGGGAGG - Intronic
1089587462 11:119519628-119519650 GCCAGGGCAGAGAGTGAGGGAGG + Intergenic
1089775396 11:120832072-120832094 CTCAAGGCAAGGAGGGGGGAGGG - Intronic
1090301484 11:125644388-125644410 GTCAAGGAAGAAAGAGAGGAGGG + Intronic
1090620124 11:128553200-128553222 CTCCAGGCTGATAGGGAGGAGGG + Intronic
1090758072 11:129812541-129812563 CTCAAGGGAAAGTGGGAGGAGGG + Intergenic
1090878484 11:130812756-130812778 GCCAAGGCAGAGAGGAAGGAGGG + Intergenic
1092893506 12:12991467-12991489 CTCAATGCAGAAAGTGGTGATGG - Intronic
1093758238 12:22876409-22876431 TTCCAGGCAGCCAGTGAGGAGGG + Intergenic
1094115426 12:26906800-26906822 CTCATTGGAGAGAGTGAGCATGG - Intronic
1094120495 12:26969057-26969079 TTTAGGGGAGAGAGTGAGGAGGG + Intergenic
1094263495 12:28527976-28527998 TTCCAGGCAGTGAGTGAGCAGGG + Intronic
1094317065 12:29146484-29146506 CTTTAGGCAGACAGTAAGGAAGG - Intergenic
1095636068 12:44435070-44435092 CTCAAGGCAGAAGGTGAAGAGGG - Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096693413 12:53334736-53334758 CCCAAGGCACAGAGTTGGGAAGG - Intronic
1096968471 12:55647217-55647239 CGCAGAGCAGAGAGTGGGGAGGG + Intergenic
1096995356 12:55834819-55834841 CACAGGGCAGAGAGGGAGTAAGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097607104 12:61768959-61768981 TTCAAGGCAGCCAGTGAGCAGGG - Intronic
1097650518 12:62292404-62292426 CTCTAGGCAGAGAGTGGGACAGG + Intronic
1097751213 12:63355070-63355092 CTCAAGCCTGTGAGTGAGGTAGG - Intergenic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1097971278 12:65635719-65635741 CTTAAGGCATAGAGTTAGGATGG + Intergenic
1098397018 12:70029931-70029953 CTCAAGGCTGTGGGAGAGGAAGG - Intergenic
1099481381 12:83170530-83170552 TTAAAGGAAGAGAGTAAGGAGGG + Intergenic
1100361907 12:93886931-93886953 CGCAAGACAGAGAGTGAGGTGGG + Intronic
1101268900 12:103122145-103122167 CTCAAGGCAATGAGTCAGTAGGG + Intergenic
1101471049 12:104997609-104997631 CTAAAGGCAGTGAGAGAGAAGGG - Intronic
1101676703 12:106923729-106923751 CTCAAGGCAGAAGGTGAAGGAGG + Intergenic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102745029 12:115242787-115242809 TTCAAGTCAGGGAGTGAGGTGGG - Intergenic
1103719427 12:122965529-122965551 CTCAAGTCCCAGAGTGAGGCTGG - Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1104357111 12:128096876-128096898 CTCAAGGCAGAGCATGGGGGTGG + Intergenic
1107067556 13:36231664-36231686 CTCAAGTCAGAGTGTAAGGAAGG - Intronic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108128382 13:47269764-47269786 CTCAAGACAGAGAATGAGAAAGG + Intergenic
1108893468 13:55293619-55293641 GTCATGGCAGAGGGTGAGGCAGG - Intergenic
1109044761 13:57395310-57395332 CTCAAGACAGAGAACTAGGAGGG - Intergenic
1109308098 13:60662587-60662609 CCCAATGCTGATAGTGAGGAAGG - Intergenic
1109459892 13:62643077-62643099 GTCAAGGCAGAGAATGAGTCAGG - Intergenic
1109461408 13:62663645-62663667 CTCAAAAAAGAGACTGAGGATGG + Intergenic
1109534692 13:63700515-63700537 TTCCAGGCAGTGAGTGAGCAGGG + Intergenic
1109715080 13:66211664-66211686 CTGAATGCAGAAAGTGAGGCTGG + Intergenic
1109946635 13:69442812-69442834 CTCATGGCAGAAGGTGAAGAGGG - Intergenic
1110794243 13:79618909-79618931 ATCAAGGCAGGTGGTGAGGAAGG - Intergenic
1111634378 13:90884449-90884471 CTCAAGGGAGAAAGGGAGAAGGG + Intergenic
1113108040 13:106792173-106792195 CTCAGGACAGAGAATGAAGATGG - Intergenic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1113870043 13:113553765-113553787 CAAAAGGCAGACAGGGAGGAAGG - Intronic
1113893411 13:113748437-113748459 CTCAAGCGAGGGACTGAGGAAGG + Intergenic
1114333419 14:21661413-21661435 AAGAAGGCAGGGAGTGAGGAAGG - Intergenic
1114340519 14:21738176-21738198 CTCAATGGAGAAAATGAGGAAGG + Intergenic
1115087560 14:29535627-29535649 CGGAAGGAAGGGAGTGAGGAAGG - Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116763881 14:49047494-49047516 TACAAGGCAGGGAGAGAGGAAGG + Intergenic
1117273296 14:54166939-54166961 CCTAAGGCAAAGGGTGAGGAGGG - Intergenic
1117639796 14:57786031-57786053 TTCCAGGCAGAGGGTGAGGGGGG - Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119171603 14:72540035-72540057 CTAAAGCCAGAAAGTGAGCAAGG + Exonic
1119378505 14:74214053-74214075 GCCAAGGCAGTGAGGGAGGAAGG - Intergenic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1120208161 14:81608387-81608409 CACATGGAAGAGAGTGATGAAGG - Intergenic
1120900665 14:89572941-89572963 CTCCTGGCAGAGAGGGAGGCAGG + Intronic
1120930608 14:89844647-89844669 GGGAAGGCTGAGAGTGAGGAAGG - Intronic
1121574393 14:94971559-94971581 CTCCAAGCAGAGAGTGAGTCAGG + Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122023614 14:98859086-98859108 CGCAAGGCAGGGACTGAGGAGGG + Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122389315 14:101369473-101369495 ATGAAGCCAGAGGGTGAGGAGGG - Intergenic
1122659728 14:103287332-103287354 CACACAGCACAGAGTGAGGATGG - Intergenic
1122708132 14:103634496-103634518 CTCAAGACAGAGGCTGAGGCTGG + Intronic
1122714555 14:103687282-103687304 CTCAAGTCTGTGGGTGAGGAAGG - Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1202934407 14_KI270725v1_random:72018-72040 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1123922237 15:25078466-25078488 CTCAATGCAAAGTGTGTGGAAGG + Intergenic
1124155530 15:27222068-27222090 CTCCAGGAAGAAAATGAGGAGGG - Intronic
1124349189 15:28943066-28943088 CTCAAGGAACCGCGTGAGGAAGG - Intronic
1124465309 15:29933795-29933817 CTGAAAGCAGAGGGAGAGGATGG + Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125884557 15:43218978-43219000 TGAAAGGCAGAGAGGGAGGAGGG - Intronic
1126663287 15:51052913-51052935 CTCATGGCAGAAAGTGAAGTGGG - Intergenic
1127208802 15:56749481-56749503 CTAAAAGGAGAGAGTGAGGCTGG + Intronic
1128221276 15:65970374-65970396 CTGCAGGCCGAGGGTGAGGAGGG + Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128729976 15:70014501-70014523 CCCAAGCCAGTGAGTGGGGAGGG - Intergenic
1128997884 15:72310049-72310071 ATCAGGGCAGAGAGTTAGGTAGG - Intronic
1129686491 15:77689085-77689107 GAAAGGGCAGAGAGTGAGGAAGG + Intronic
1130296311 15:82648714-82648736 GCAAAGGCAGAGAGGGAGGACGG + Intronic
1130874633 15:88002860-88002882 CCCAAGCCAGAGAAAGAGGAAGG + Intronic
1131225948 15:90624479-90624501 GTCAGGGCAGAGGGTGAGGAGGG - Intronic
1131528749 15:93174095-93174117 CTCAAGGCAGAAGGTGAAGGGGG + Intergenic
1132582193 16:690051-690073 CTCAGGGCTGACAGTGTGGACGG - Exonic
1132949743 16:2554506-2554528 CTCAAGGGGGAGCGTGAGGCTGG - Intronic
1132964605 16:2645661-2645683 CTCAAGGGGGAGCGTGAGGCTGG + Intergenic
1133147890 16:3803692-3803714 GTCCAGGAAGAGAGTGGGGAGGG - Intronic
1133455299 16:5936562-5936584 ACCAGGGCAGAGAGAGAGGAAGG + Intergenic
1133728794 16:8560551-8560573 CTCAAGGAAGAAAGGGAGGGAGG + Intergenic
1133758648 16:8781031-8781053 CTCAAAGGAGAGAGGGAGGGAGG + Intronic
1133913648 16:10088444-10088466 CTCAGGGCTGTGAGTGAGGATGG + Intronic
1133917955 16:10125998-10126020 GTGAAGGCAGGGAGTCAGGAAGG - Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135964313 16:27023193-27023215 ATCAATGCAGTGAGAGAGGAAGG - Intergenic
1138116089 16:54361833-54361855 CTCAGGGGAGAGGGTGAGGGTGG + Intergenic
1138459504 16:57139825-57139847 CCCAAGTCACACAGTGAGGAAGG - Intronic
1138732367 16:59209152-59209174 CTCATGGCAAAAAGTGAAGAGGG - Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1138945955 16:61850185-61850207 CTCATGGCAGAAGGTGAAGAGGG + Intronic
1139085743 16:63583518-63583540 GGTAGGGCAGAGAGTGAGGATGG + Intergenic
1139265127 16:65631292-65631314 TTCATGGCGGGGAGTGAGGAAGG + Intergenic
1139293979 16:65883983-65884005 CTCTAGGCAAGGAGAGAGGAAGG + Intergenic
1139330308 16:66183508-66183530 GGCAAGGCAGAGAGAAAGGAAGG + Intergenic
1139875056 16:70139306-70139328 CTCAAGGCAGACCGGGAAGAAGG - Intronic
1140360727 16:74341825-74341847 CTCAAGGCAGACCGGGAAGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140681133 16:77385840-77385862 CTCAAGGCAGGGGGTGAGGAGGG - Intronic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141066735 16:80920167-80920189 ATCTAGGAAGAGAGTGTGGATGG + Intergenic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1142174909 16:88640686-88640708 CTCAAGGCACTGCTTGAGGAAGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142374024 16:89697664-89697686 CTCACGGCGCAGAGAGAGGAAGG + Exonic
1143010072 17:3861385-3861407 ATCAAGGGAGAGAGTGAGATGGG + Intronic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1143527770 17:7482412-7482434 CTCAAGGCAGAGGGTGAGGACGG - Exonic
1144270394 17:13609902-13609924 CTAAAGCCAGAGGGTGAGGCTGG - Intergenic
1145021319 17:19433683-19433705 CTCAAGGCAGATATTCAGAAGGG - Intergenic
1145269030 17:21394670-21394692 CTCGAGGCTGAGGGTGGGGAAGG + Intronic
1145979927 17:29005430-29005452 CGCAAGGCAGTGAGTCGGGACGG - Intronic
1146164418 17:30576693-30576715 CCCAAGGCACAGAGAGAGGGAGG + Intergenic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1151842391 17:76627497-76627519 GTCCAGGAAGAGAGTGAGGTTGG + Exonic
1152189008 17:78876857-78876879 CTCCAGGCAGAGAGGGGAGATGG - Intronic
1152235180 17:79134928-79134950 GTCACAGCAGAGATTGAGGAGGG + Intronic
1152420896 17:80192634-80192656 GTCAAGGCAGTGAGGGAGGCGGG - Intronic
1152499225 17:80697100-80697122 CTACAGTCAGAGAGTGAGCAAGG + Intronic
1152768418 17:82153167-82153189 GCCAAGGCAGAGGGAGAGGAAGG + Intronic
1153577905 18:6541304-6541326 CTCCAGGCAGTGTGTGAGGCTGG - Intronic
1153738720 18:8100094-8100116 AGCAAGGCAGAGAGTGAGGAGGG + Intronic
1153872009 18:9330419-9330441 AACAAGGCAGGGAGGGAGGAGGG + Intergenic
1153917608 18:9759677-9759699 GTCAAGACAGAGAGACAGGAGGG + Intronic
1154115511 18:11610023-11610045 CTCAAGGCAGAGGGTGAGGATGG - Intergenic
1155070044 18:22307054-22307076 CTCAAGGCACAGGGAGAAGAAGG + Intergenic
1155134857 18:22980523-22980545 CTCAAGGAAGAGAGTGTGGCAGG + Intronic
1155238927 18:23847278-23847300 CTCATGGCAGACAGTGTGGATGG - Intronic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1156540017 18:37900413-37900435 CTGAAGTGAGTGAGTGAGGAAGG + Intergenic
1157054339 18:44208873-44208895 CTAAAGGCAAAGAGAGATGATGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157575321 18:48739502-48739524 CACAGGCCAGAGAGTGAGCAAGG - Intronic
1157924529 18:51748895-51748917 ACCTAGGCAGAGGGTGAGGATGG - Intergenic
1159673966 18:71258276-71258298 GTGAAGGGAGAGAGTGAGGATGG - Intergenic
1160006917 18:75074850-75074872 CTCCAGGCCAAGAGTGAGGATGG + Intergenic
1160105790 18:75974860-75974882 ATGAAGGGAGAGAGTGAGGGAGG - Intergenic
1160721293 19:598030-598052 CTCAATCCAGAGGGTGAGGCTGG + Intronic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1163242708 19:16074186-16074208 AGCAAGTCAGAGAGGGAGGAAGG + Intronic
1163692761 19:18746202-18746224 CTCAAGGCAGGAGTTGAGGAAGG + Intronic
1164015872 19:21255641-21255663 GCCAAGGCAGAGGCTGAGGAAGG + Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164928143 19:32147334-32147356 CTCAGGGGAAAGGGTGAGGATGG - Intergenic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166890284 19:45987582-45987604 GTCAAGGGTGAGGGTGAGGATGG - Intergenic
1166929702 19:46294894-46294916 TTCAAGGGAGAAACTGAGGAAGG - Intergenic
1166938174 19:46347429-46347451 CTCAGTGGAGAGACTGAGGAGGG + Intronic
1167390412 19:49190999-49191021 CTCATGGCAGAAAGTGAGGGAGG + Intronic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
1167587031 19:50381040-50381062 CTGAGGGCAGAGAGTGAGCGAGG - Intronic
1167714081 19:51129844-51129866 GTCAGAGCAGACAGTGAGGATGG - Intronic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1168118550 19:54239741-54239763 TTCAAGGCAGAGAGAGATGTTGG - Intronic
1202693943 1_KI270712v1_random:111123-111145 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
925230157 2:2225937-2225959 CCCAGGTCAGAGAGTGAGGGTGG + Intronic
925234139 2:2263277-2263299 CTACTGGCAGAGAGCGAGGAGGG + Intronic
925498431 2:4478666-4478688 CTCATGGCAGAAAGTGAAGCAGG + Intergenic
925732043 2:6926195-6926217 TTGAAGGCAGTGAGAGAGGAGGG + Intronic
926052032 2:9751489-9751511 CTCCAGGGACAGAGTGTGGACGG - Intergenic
926267860 2:11343530-11343552 CTAAAAGGAGAGAGTGAGGGCGG + Intronic
926272755 2:11378949-11378971 CACAGGGCAGGGAGTGAGGTGGG - Intergenic
927323952 2:21781391-21781413 CACAAGGCAGGGATTCAGGATGG - Intergenic
928211878 2:29329493-29329515 AACAAGGCAGAGAGTAAGGCAGG - Intronic
928295411 2:30078734-30078756 CTAAAGGCAGAAAGCAAGGATGG + Intergenic
928432012 2:31227992-31228014 CACCAGGCAGAGGGTGGGGAAGG + Intronic
929178820 2:39010586-39010608 CTCAAACCACAGAGTGAGGTTGG + Exonic
929918503 2:46155554-46155576 CTGAAGGGAGAAAGTGAGTAGGG - Intronic
930069785 2:47356820-47356842 CTCAAGGGAATGTGTGAGGATGG + Intronic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
933158153 2:78996536-78996558 CTCAAGGCACAGGGTCAGGGAGG + Intergenic
933260543 2:80126663-80126685 CGAAAGGGAGGGAGTGAGGAAGG - Intronic
933758391 2:85658430-85658452 GCCAAGGGAGAGAGTGAGGTAGG + Exonic
933952618 2:87343452-87343474 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934236863 2:90239798-90239820 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934306846 2:91832308-91832330 CTCATAGCTGAGAGTGAGGATGG + Intergenic
934326410 2:92020434-92020456 CTCATAGCTGAGAGTGAGGATGG - Intergenic
934464770 2:94251050-94251072 CTCATTGCTGAGAGTGAGGATGG - Intergenic
934475157 2:94588621-94588643 CCCAAGGGAGAGGCTGAGGATGG - Intronic
934737106 2:96695194-96695216 GACAAGGCAGCGGGTGAGGAGGG + Intergenic
935279977 2:101508535-101508557 CTCAGTGCAGAGAGTGTGGGAGG + Intergenic
935355054 2:102190047-102190069 CTTAAGGCAGGGAGTAAGCATGG + Intronic
935732579 2:106076450-106076472 CCCAAGGCAGAGGCTGAGGTGGG + Intronic
936634144 2:114236144-114236166 CCCAAGAAAGAGAGAGAGGAAGG + Intergenic
937309692 2:120894493-120894515 CTCTAGAAAGAGAGTGAGAAGGG - Intronic
938110362 2:128560184-128560206 ATCACTGCTGAGAGTGAGGATGG + Intergenic
938220619 2:129563608-129563630 CACAAGCCACAGAGTGGGGAAGG - Intergenic
938263986 2:129913324-129913346 TGCAAGGCAGAGAGTAAGGTGGG + Intergenic
938297029 2:130184803-130184825 CTCAGGGCAGAGGGTGTGGCAGG + Intronic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
938587545 2:132706473-132706495 CTCAAGGCAGAAGGTTAGAAGGG - Intronic
938824502 2:134991634-134991656 CTCAAGCCAGAGTCTGGGGATGG + Intronic
938981397 2:136530657-136530679 CTAGAAGCAGAGAGTAAGGAGGG - Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
941376712 2:164740462-164740484 CTCCAGGCAGAGAGCAAGGTAGG - Intronic
941644469 2:168025170-168025192 ATCAAGGGAGAGAATGAGAAGGG - Intronic
945312073 2:208325562-208325584 CACAGGGCAGAGACTCAGGAGGG - Exonic
945450107 2:209984651-209984673 CTCAAGGCAATGGGGGAGGAAGG - Intronic
946256588 2:218446701-218446723 CTCAAGGAAGAAAGTCAGTATGG + Intronic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
946445399 2:219735517-219735539 ATCAAGGGAGGGAGTGAAGAGGG - Intergenic
947071031 2:226288050-226288072 CTTAAGGAAGAGAGTGAAGAAGG - Intergenic
947200816 2:227613081-227613103 CTAAAGGCTGAGAGTAAGTAAGG + Intronic
947889768 2:233606697-233606719 CTCATGGCAGAAGGTGAGGCAGG + Intergenic
947889907 2:233608241-233608263 CTCATGGCAGAAGGTGAGGGTGG + Intergenic
947895336 2:233666096-233666118 CTCATGGCAGAAGGTGAGGGTGG + Intronic
948511337 2:238467193-238467215 CACATGGCAGAGGGGGAGGAAGG + Intergenic
948877270 2:240836477-240836499 CCCAAGGCAGGGGCTGAGGAGGG - Intergenic
949054204 2:241916554-241916576 TTAAAGGCAGAGAGAGAGAAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169373284 20:5044964-5044986 CTCCAAGAAGGGAGTGAGGAAGG - Intergenic
1169759862 20:9079479-9079501 GGACAGGCAGAGAGTGAGGAAGG - Intronic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1171364073 20:24611651-24611673 CTCCAGGCAGAGGCTGAGGAGGG - Intronic
1171456223 20:25274106-25274128 CTCAAGATAGACAGTGGGGACGG - Intronic
1172009507 20:31838177-31838199 TTCCAGACAGAGAGTGAGGAGGG + Intergenic
1172572573 20:35982118-35982140 GTCAAGCCAGCGAGTCAGGAAGG + Intronic
1172692077 20:36796955-36796977 GTCAAGGAAGAGAGACAGGAAGG + Intronic
1173264242 20:41464019-41464041 CACAAAGGAGAGAGTGAGAAAGG + Intronic
1173427827 20:42958246-42958268 AGGAAGGGAGAGAGTGAGGAAGG + Intronic
1173917914 20:46723310-46723332 CTCCAAGAAGAGGGTGAGGAGGG - Intronic
1174568508 20:51484348-51484370 CTTAAGGCAGGGTGTGTGGAGGG - Intronic
1174734195 20:52949332-52949354 GGCAAGGTAGAGAGTGATGAAGG + Intergenic
1174738610 20:52989689-52989711 CTCTAGGGAGAGACTGAGAAAGG - Intronic
1174823890 20:53751353-53751375 CTAAAGTCAGAGAGAGAGAACGG - Intergenic
1174884343 20:54315780-54315802 CTCTAGGCAAAGAATGTGGATGG + Intergenic
1175070910 20:56333001-56333023 CTCATGGCAGAAGGTGAGGAGGG - Intergenic
1175800935 20:61800701-61800723 CTCAAGGCAGAGCCTCAGGCAGG + Intronic
1175898974 20:62352591-62352613 CCCAAGGAAGGGGGTGAGGATGG - Intronic
1176155828 20:63619905-63619927 TTCAAGACAGAAAGAGAGGAGGG + Intronic
1177650135 21:23949652-23949674 CTCAGTGCAGAGGGAGAGGAAGG + Intergenic
1178411064 21:32364178-32364200 CTCACTGCAGAGACTGAGTAGGG + Intronic
1178746068 21:35251442-35251464 CTTAAGCCATAGAATGAGGATGG - Intronic
1179618398 21:42596518-42596540 CTCCAGGTAGAGTGTCAGGATGG - Intergenic
1180278669 22:10671335-10671357 CTCATAGCTGAGGGTGAGGATGG - Intergenic
1180585922 22:16890197-16890219 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1180590415 22:16932500-16932522 CTGAAGGCAGAAAGTGAGGCAGG + Intergenic
1180832164 22:18911893-18911915 GGCCAGGCAGAGAGTGAGGCTGG + Exonic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181067680 22:20314449-20314471 GACCAGGCAGAGAGTGAGGCTGG - Exonic
1181137805 22:20781283-20781305 CTCTAAGCTGAGAGTGTGGAAGG + Intronic
1181636143 22:24175779-24175801 CACAAGGCAGTGAGAGGGGATGG - Intronic
1181689936 22:24553608-24553630 CCCAAGCCACAGAGTAAGGAGGG - Intronic
1181842516 22:25675960-25675982 TCCAAGGCAGAAAGTGTGGAGGG - Intronic
1181843887 22:25690440-25690462 CTCTCCGCAGACAGTGAGGAAGG - Intronic
1181893345 22:26084309-26084331 CTCGAGGGAGAGACTGAGGCTGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182294237 22:29303736-29303758 CTCATGGGAGAGAAGGAGGAAGG + Intergenic
1182396699 22:30041448-30041470 GTCAAGGCAGAGTGGGGGGATGG - Intergenic
1182621319 22:31620254-31620276 GTCAAAGGTGAGAGTGAGGAGGG - Intronic
1182623116 22:31628630-31628652 CTCAGGGCAGAGGTAGAGGAAGG - Intronic
1182961767 22:34481960-34481982 CTCATGGCAGAAGGTGAAGAGGG - Intergenic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183169483 22:36175817-36175839 CACAAGGCAGATGGTTAGGAAGG - Intergenic
1183241405 22:36660460-36660482 TCCAAGACAGAGAGTGAGAATGG - Intronic
1183281554 22:36935275-36935297 CTCAGGGCAGGGAGTGGGGTTGG - Intronic
1183385315 22:37510751-37510773 CTCATGGCAGAAAAGGAGGAGGG + Intronic
1184069961 22:42141495-42141517 CCCAAGGCAGGGACTGAGGGAGG - Intergenic
1184115094 22:42417614-42417636 GTTGGGGCAGAGAGTGAGGAGGG + Intronic
1184320894 22:43741450-43741472 TTCAAGTAAGCGAGTGAGGAAGG - Intronic
1184735918 22:46397836-46397858 CTTAATGCAGGGAGTGAGGATGG - Exonic
1184899616 22:47436793-47436815 CTCAAGGCAGAAGGTGAAGGAGG - Intergenic
1185236418 22:49716208-49716230 CTCAGGGCAGATGGTGCGGATGG - Intergenic
1203282249 22_KI270734v1_random:137198-137220 GGCCAGGCAGAGAGTGAGGCTGG + Intergenic
949679224 3:6493979-6494001 CTAAAGGGAGGGAGTGAAGAAGG - Intergenic
949885465 3:8689732-8689754 CTCAAAGCCAAGATTGAGGACGG - Intronic
950899765 3:16486989-16487011 CACATGGCAGAGAGGGAGGGAGG - Intronic
953039774 3:39245432-39245454 CTCAAGGCAGAGAGTCAAAGAGG - Intergenic
954020774 3:47739430-47739452 CTCAAGGCTGAGGTTGAGGTGGG - Intronic
954030739 3:47818210-47818232 CTCCAGAAAGTGAGTGAGGAAGG + Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954289148 3:49640016-49640038 CTCAAGGCAGAGAGCAGGGCTGG + Intronic
954462952 3:50638143-50638165 CACAAGGCAGGCAGTGAGGAGGG + Intronic
954821274 3:53330450-53330472 CTCAGGGCAGTGGCTGAGGATGG + Intronic
956230554 3:67011528-67011550 CTCATGGCAGAGGGTGAAGCGGG + Intergenic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956797865 3:72732421-72732443 CTAAAGAGAGAGAGAGAGGAAGG - Intergenic
956798303 3:72735695-72735717 CTAAAGAGAGAGAGAGAGGAAGG + Intergenic
957043521 3:75355892-75355914 CTCAAAGCCAAGATTGAGGATGG + Intergenic
957444149 3:80292913-80292935 GGCAGGGGAGAGAGTGAGGAGGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
959188707 3:103082003-103082025 CTCATGGCAGAGGGTGAAGTGGG - Intergenic
959582254 3:107993580-107993602 CCCAAGGCACAGGGTGAGGGGGG - Intergenic
959686960 3:109158003-109158025 CAGAAGACAGAGAGTGAGGGGGG + Intergenic
959884398 3:111482132-111482154 CTCATGGCAGAGGGTGCAGAAGG + Intronic
960319895 3:116221736-116221758 CTCCAGGGCGAGAGTGAGGATGG - Intronic
960516503 3:118608098-118608120 TTCTAGGCAGAGGGTGAGCAGGG - Intergenic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961478184 3:127161635-127161657 CTCCAGGCAGAGAGAGGGGCAGG - Intergenic
961480178 3:127174478-127174500 TTCAAGGCCGTGAGTGAGGAAGG - Intergenic
962103579 3:132367917-132367939 CAAAAGGCAGGGTGTGAGGATGG - Exonic
962110708 3:132443720-132443742 CTTAAGGAAGGGAGTGCGGAGGG + Intronic
962371896 3:134827744-134827766 TTAAAGGCAGAGACTGAGAATGG + Intronic
962756117 3:138466819-138466841 CTCAGGGCAGAAGGTGAAGAGGG + Intronic
962826529 3:139104704-139104726 TTCCAGCCACAGAGTGAGGAGGG - Intronic
963040065 3:141063945-141063967 GGCAAGGCAGAGTGAGAGGAGGG - Intronic
963386979 3:144610002-144610024 TTAAAGGAAGAGAGGGAGGAAGG - Intergenic
964671170 3:159228089-159228111 CTAAAGGTAGAGGATGAGGAAGG - Intronic
964719054 3:159753757-159753779 CTGATGGTGGAGAGTGAGGAGGG - Intronic
964825896 3:160827902-160827924 CTCAAGGCAGAAGGTGAGGCGGG + Intronic
965449213 3:168816825-168816847 CTGAAGGCAGAGAGTCAGTGAGG + Intergenic
965634489 3:170767464-170767486 TACAAAGAAGAGAGTGAGGAAGG - Intronic
966905708 3:184524572-184524594 CTCAGGGATGAGGGTGAGGAAGG + Intronic
967182717 3:186920275-186920297 TTGAAGGCAGAGAGAGATGAAGG + Intergenic
967750293 3:193106578-193106600 CTAAAGGCAGCTAGTGAGAAAGG - Intergenic
968597646 4:1493566-1493588 CTCCTGGCAGATAGTGGGGAGGG - Intergenic
969027073 4:4182248-4182270 CTCAAAGCCAAGATTGAGGACGG + Intergenic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
970690343 4:18612660-18612682 AGAAAGGCAGAGAGGGAGGAAGG + Intergenic
971702261 4:29993751-29993773 CTCAAGGTAGATAGTTGGGAAGG + Intergenic
972371332 4:38426315-38426337 CTCAAGAAAGAGATTGAGCATGG - Intergenic
972996872 4:44891313-44891335 CTAAAGGAAGACAGGGAGGAAGG - Intergenic
974580540 4:63794858-63794880 AACAAGGGAGAGAGTGGGGATGG - Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
974799964 4:66804013-66804035 CTAAAGGGATAGAGTGAGGCGGG + Intergenic
974881083 4:67757875-67757897 CTGAAGGGAAAGAGTGATGATGG + Intergenic
974891184 4:67885988-67886010 CTCAACGCAGAAAGGGAGGTGGG + Intergenic
976195463 4:82527661-82527683 CACTGGGCAGAGAGTTAGGAAGG - Intronic
976347875 4:84026148-84026170 CACAAGGCAGAGTGTGCTGAGGG + Intergenic
977668192 4:99665315-99665337 CTGAAGGCATACAGAGAGGATGG - Intergenic
977913723 4:102566514-102566536 CACATGGCACAGAGTTAGGATGG + Intronic
978361779 4:107938538-107938560 ATGAAGTCAGAGAGAGAGGAGGG + Intronic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
981376751 4:144024950-144024972 TTCAAGGCAGTGGGTGAGCAGGG - Intergenic
981387252 4:144146296-144146318 TTCAAGGCAGTGGGTGAGCAGGG - Intergenic
981953098 4:150434993-150435015 CAAAAGACAGAGAGAGAGGAAGG + Intronic
983677229 4:170309703-170309725 CTCATGGCAGAAGGTGAGGTAGG - Intergenic
985947967 5:3201327-3201349 CAGAAGCCAGAGAGTCAGGAGGG - Intergenic
986060172 5:4181285-4181307 CTCAAAGAAGACAGTGAAGAAGG - Intergenic
986524403 5:8657543-8657565 GTCCAGGAAGAGAGTGAGAAAGG + Intergenic
986759794 5:10869479-10869501 TTCAAGGTAGAGAGGAAGGAAGG - Intergenic
987216062 5:15738581-15738603 TTCAAGGAAGAGAGTGAAAAGGG - Intronic
987492425 5:18597669-18597691 CTCATGGCAGAGGGTGAAGTAGG - Intergenic
987694670 5:21312295-21312317 CTCAAGGGAAAGAGTGGGAAAGG - Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
988744815 5:34124449-34124471 GTCATGGCAGAAAGTGAGGCAGG + Exonic
988832698 5:35003142-35003164 TTCAAGGAAGGGAGTGGGGAGGG + Intronic
989177088 5:38538705-38538727 CGTATGCCAGAGAGTGAGGAGGG - Intronic
989531408 5:42512253-42512275 CTCAAGGCAGAGAATGGTGGGGG + Intronic
990658745 5:57988216-57988238 AAGAAGGGAGAGAGTGAGGAAGG - Intergenic
990991532 5:61689167-61689189 CCCTAGGCAGAGAATGAGGCTGG + Intronic
991509511 5:67361230-67361252 CTCAAGAGAAGGAGTGAGGATGG - Intergenic
991745565 5:69737178-69737200 CTCAAGGGAAAGAGTGGGAAAGG + Intergenic
991752141 5:69818055-69818077 CTCAAGGGAAAGAGTGGGAAAGG - Intergenic
991797132 5:70316931-70316953 CTCAAGGGAAAGAGTGGGAAAGG + Intergenic
991824943 5:70612492-70612514 CTCAAGGGAAAGAGTGGGAAAGG + Intergenic
991831461 5:70693160-70693182 CTCAAGGGAAAGAGTGGGAAAGG - Intergenic
991889511 5:71316464-71316486 CTCAAGGGAAAGAGTGGGAAAGG + Intergenic
992296499 5:75332063-75332085 CTCAAGGCAGAGAGTTAAATAGG - Intergenic
992352894 5:75949146-75949168 CTCATGGCAGAAAGTGAAGCAGG - Intergenic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
992901393 5:81300696-81300718 CTCAAAGGAGAGACTGAGCAAGG + Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
993966493 5:94366333-94366355 TTCAAGGCAGAGGGTGAGTCAGG - Intronic
994559425 5:101347942-101347964 CAAAAGGCAGAGATTGGGGAGGG + Intergenic
994758039 5:103818595-103818617 CTCATTGCTGAGAGTGCGGACGG - Intergenic
994785265 5:104151871-104151893 CTCAAAGCATACTGTGAGGAAGG + Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
995035583 5:107530633-107530655 ATCAAGGCAGAGTGAGAAGAAGG + Intronic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
997602168 5:135148086-135148108 CTCAAGGCAGAATATGGGGAAGG - Intronic
997607054 5:135182700-135182722 CTCAAGGGGGAAGGTGAGGAAGG + Intronic
997886500 5:137634859-137634881 CTGAGGGCTGAGAGTGAGGTTGG + Intronic
998558089 5:143145401-143145423 ATAAAGAGAGAGAGTGAGGACGG - Intronic
998758382 5:145405615-145405637 ATCATGGCAGAAAGTGAAGAGGG + Intergenic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999444291 5:151626904-151626926 CCCAAAGCAGAGAATGGGGAAGG + Intergenic
999670641 5:153956396-153956418 CACAAAGCAGAGAGTGGGGGTGG + Intergenic
1000122317 5:158209009-158209031 CTGAGGGCAGAGAGTGGAGAGGG + Intergenic
1000803996 5:165765786-165765808 ATCATGGCAGAGAGTGAAGGGGG - Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1002260774 5:177992730-177992752 CTCAAGGCTGAGGGGGAGCATGG + Exonic
1003264524 6:4553620-4553642 ATCTAGGCAGTGAGTGACGATGG + Intergenic
1003724635 6:8746899-8746921 TTGAAGGCAGAGTGTAAGGATGG + Intergenic
1003822718 6:9917927-9917949 CTGAAGGCTGAGAGTAGGGAAGG - Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004481185 6:16020833-16020855 CAGAAGCCAGAGAGAGAGGAGGG - Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007074982 6:39060594-39060616 ATCAAGGCAGGGAGGGAGCAGGG + Intronic
1007222513 6:40290334-40290356 ATCAAGGCCCAGAGAGAGGATGG + Intergenic
1007249777 6:40487899-40487921 CTCAAGGCTGAGATTGGGAAAGG - Intronic
1007608479 6:43132977-43132999 CCCAATGCACAGAGTGACGATGG + Intronic
1007925620 6:45647281-45647303 CTCAAGGCTGAAAGTAAGAAAGG + Intronic
1008466377 6:51835573-51835595 CTAAAGGCAAAGAGAGATGAAGG + Intronic
1009211767 6:60870951-60870973 ATCAGGGCACAGGGTGAGGATGG + Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1011467009 6:87668659-87668681 CTTAAAGCAGGGAGTGAGGTGGG - Intergenic
1012037067 6:94155780-94155802 CACAAGGCAGACAGTCAGGAAGG - Intergenic
1013190697 6:107802565-107802587 CTCGAGGGAGGGAGGGAGGAAGG + Intronic
1014554648 6:122831014-122831036 CACAAGGCAGACAGTCTGGAAGG + Intergenic
1015489864 6:133812782-133812804 CTCATGGCAGAAAATGAAGAAGG + Intergenic
1015864825 6:137717485-137717507 AACAAGGAAGAGAGGGAGGAGGG + Intergenic
1016343469 6:143086402-143086424 GTCAAGGCAGAGAGAGAGAGGGG - Intronic
1017032993 6:150240674-150240696 TGCAATGCAGAAAGTGAGGAGGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1018668289 6:166159565-166159587 CTCAAGGCATAAAATGAGGAAGG + Intronic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1019773268 7:2896968-2896990 CGCAATTCAGAGAGAGAGGAGGG - Intergenic
1019901649 7:4025865-4025887 CACAAGGCAGAAAGACAGGAAGG - Intronic
1021542100 7:21771198-21771220 TTCAAGGGAGGGAGGGAGGAAGG - Intronic
1022708697 7:32831749-32831771 CTCATGGTGGAGAGTGAGGAAGG + Intergenic
1022914357 7:34932920-34932942 CTCATGGTGGAGAGTGAGGGAGG - Intronic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1023148213 7:37174021-37174043 TTCAAGGCAAAGAGAGAGCAGGG - Intronic
1023231700 7:38038575-38038597 CTAAGGGCACAGAGTGAGTAGGG + Intergenic
1023694185 7:42827825-42827847 CTAAAGGCACAAAGAGAGGAGGG + Intergenic
1023787894 7:43726221-43726243 TTCAAGGCAGAGAGACAGGGAGG + Intronic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024294098 7:47829059-47829081 ATGAAGGCAGGGAGAGAGGAAGG + Intronic
1024653704 7:51431299-51431321 CTCAAATCAGAGAGACAGGATGG - Intergenic
1026122518 7:67550307-67550329 AGCAAGGAAGAGAGGGAGGAAGG - Intergenic
1026534381 7:71228075-71228097 AGCAAGGCAGATAATGAGGAGGG + Intronic
1026614870 7:71892745-71892767 CTCAAGCCTGTGAATGAGGAGGG - Intronic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1027539962 7:79453945-79453967 GTGAAGGCAGAGAGAGAGGCAGG + Intergenic
1028883592 7:95907668-95907690 TAAAAGGCAGAGAATGAGGACGG - Intronic
1030322084 7:108179644-108179666 TGCAAGGGAGAGAGTAAGGAAGG - Intronic
1030888701 7:114970648-114970670 TTAAAGGCAGTGAGTGGGGAAGG + Intronic
1032128316 7:129210580-129210602 CCCAAGGCTGAGGGTGAGGCGGG - Intronic
1032422957 7:131797900-131797922 CTCCAGGCAGACAGTGAGTAGGG + Intergenic
1032705864 7:134420882-134420904 GGCAAGCCAGAGAATGAGGATGG + Intergenic
1032802491 7:135328158-135328180 CACAAGGAAGAGAGGGTGGATGG - Intergenic
1033600634 7:142886018-142886040 CTCTAGGCAGTGAGAAAGGAGGG + Intergenic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034491059 7:151393350-151393372 GTCCTGGCAGAGAGTCAGGAAGG - Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1034843070 7:154417595-154417617 CCCAAGGCAGGGAGTAAAGAAGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036377434 8:8213075-8213097 CTAAAAGCAGAGACTGAGGCAGG + Intergenic
1036852120 8:12210073-12210095 CTAAAAGCAGAGACTGAGGCAGG - Intergenic
1036873487 8:12452595-12452617 CTAAAAGCAGAGACTGAGGCAGG - Intergenic
1036992999 8:13620429-13620451 CTAAAAGCAGAAAGTGAGCAAGG + Intergenic
1037476542 8:19263355-19263377 CTCAAGGGAGAGGGTGGGAAGGG - Intergenic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038084004 8:24173653-24173675 GGCCACGCAGAGAGTGAGGAGGG + Intergenic
1038149031 8:24925871-24925893 CTCGAGCAAGAGAGTGAGGTGGG - Intergenic
1038270262 8:26069208-26069230 GTCAATGTAGAGAGTGAGGAGGG + Intergenic
1038435403 8:27532197-27532219 CTGAGGGGAGAGGGTGAGGAGGG - Intronic
1038462333 8:27727780-27727802 CTCAAAGCAGAGAGCAAGAAGGG + Intergenic
1039104953 8:33980219-33980241 TTCAAGGGAGAGGGGGAGGAAGG + Intergenic
1040350444 8:46561504-46561526 CAAAAGACAGAGAGTGATGAAGG + Intergenic
1042189045 8:66167056-66167078 CTGAAGGCAGACAGAGAGGCAGG - Intronic
1042398368 8:68317167-68317189 CTCAAGGATGAGAGACAGGAGGG + Intronic
1044115599 8:88329271-88329293 CACAAGGCAGACTGTCAGGAAGG - Intergenic
1045544116 8:103112604-103112626 CACATGGGAGAGAGTGAGCATGG + Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1048606169 8:135971091-135971113 ATCCAGGCAGAGAGTGAGGGAGG - Intergenic
1049561873 8:143316169-143316191 CTCAGGGCAGACAGGGAGGGTGG - Intronic
1049595540 8:143481638-143481660 CTGAAGGCAGACAGGGACGATGG + Intronic
1049912245 9:280492-280514 CGCAGGGCAGATAGTCAGGAAGG + Intronic
1050301550 9:4263921-4263943 CCCAAAGGAGGGAGTGAGGATGG - Intronic
1051244904 9:15100222-15100244 CTAAAGCCAGAGAGAGTGGATGG - Intergenic
1052552138 9:29965952-29965974 GTCATGGCAGAAAGTGAAGACGG + Intergenic
1052854894 9:33401141-33401163 CCCAAGGGAGAGGCTGAGGATGG + Intronic
1053449665 9:38182431-38182453 CTCATGGCAGAAGGGGAGGAAGG + Intergenic
1053682915 9:40497470-40497492 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1053694853 9:40627809-40627831 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1053932896 9:43125784-43125806 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054269988 9:63012310-63012332 CTCATAGCTGAGAGTGAGGGTGG + Intergenic
1054280799 9:63127458-63127480 CCCAAGGGAGAGGCTGAGGATGG - Intergenic
1054296015 9:63332970-63332992 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054306097 9:63427033-63427055 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054394031 9:64637465-64637487 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054404839 9:64751012-64751034 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054428680 9:65142677-65142699 CCCAAGGGAGAGGCTGAGGATGG + Intergenic
1054438463 9:65236504-65236526 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054491941 9:65785444-65785466 CTCATAGCTGAGAGTGAGGGTGG + Intergenic
1054501699 9:65878865-65878887 CCCAAGGGAGAGGCTGAGGATGG - Intronic
1054758162 9:68979895-68979917 CTCAGGGCTGAAAGTGAGAAAGG + Intronic
1055339379 9:75264594-75264616 ACCAAGGCAGGGAGTGAGGAAGG + Intergenic
1055700265 9:78937257-78937279 CACAAAGCAGAGAGTAAGCATGG - Intergenic
1056234791 9:84584051-84584073 CACAAAGCAAAGAATGAGGAAGG - Intergenic
1056665353 9:88577022-88577044 CTCAAGGTAGAGGGTGAGGGAGG + Intronic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057479243 9:95431270-95431292 CTCAGGACAGACAGTCAGGAAGG - Intergenic
1057841242 9:98487014-98487036 CTCAAGGAAGGGAGCGAAGAGGG + Intronic
1057930021 9:99185141-99185163 CTCAAGGGCGAGAGGGAGGCAGG + Intergenic
1058187248 9:101869487-101869509 CTAGAAGCAGAGACTGAGGAGGG - Intergenic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059646248 9:116270893-116270915 ATCAAGGCAGGGAGTGGTGAAGG + Intronic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1061798194 9:133100654-133100676 CTCAAGGAAGTGTGGGAGGAGGG - Intronic
1062024794 9:134335403-134335425 ATCAAGGCAGAGAGAATGGATGG + Intronic
1062179366 9:135182740-135182762 CTCCAGGCTGAGTGTGAAGAGGG - Intergenic
1062744648 9:138203574-138203596 GACAAGGAAGAGAATGAGGAGGG + Intergenic
1202777298 9_KI270717v1_random:1415-1437 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1185713321 X:2321579-2321601 CGCAGGGCAGAGAGAGAGGGGGG - Intronic
1185877259 X:3711737-3711759 GGGAAGGCAGAGAGAGAGGAGGG + Intronic
1185959095 X:4527563-4527585 CTCAATGCAGAGACTGATGTCGG + Intergenic
1186169188 X:6859126-6859148 ATCATGGCAGAAGGTGAGGAAGG - Intergenic
1186370431 X:8940974-8940996 CTCAAGGCAGAGAGTGTGAGGGG + Intergenic
1187053083 X:15713672-15713694 GACAAGGCAGCGAGTGAGGCTGG - Intronic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1189246123 X:39564933-39564955 AACAAGGGAGGGAGTGAGGAAGG - Intergenic
1189247028 X:39571287-39571309 CCTAAGGCAGAGAGTGTGCAGGG - Intergenic
1189755760 X:44269920-44269942 TTAAATACAGAGAGTGAGGAGGG - Intronic
1189893799 X:45632755-45632777 CTCCAGGCTGAGATTGAGGGCGG - Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1190579696 X:51880403-51880425 CCCAAAGCAGAGAGTGAGAGGGG + Intronic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1190780555 X:53590595-53590617 CTCAAGCTAAAGAGAGAGGAAGG + Intronic
1191045306 X:56129784-56129806 TTCCAGGCAGTGAGTGAGCAGGG - Intergenic
1192068510 X:67912015-67912037 CTCAAGGTAGAAAGCTAGGATGG + Intergenic
1192069105 X:67918288-67918310 TTCCAGGCAGTGAGTGAGCAGGG + Intergenic
1192179151 X:68905147-68905169 CTGAAGCCAGAGAGAGGGGAAGG - Intergenic
1192416423 X:70985036-70985058 CTCAAGAAAGAAAGAGAGGAAGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192672766 X:73163664-73163686 CTCAGGGGAAAGAGTGAGGGGGG - Intergenic
1193451309 X:81671497-81671519 CTCAAGGAAGAGTGGGAGGGTGG - Intergenic
1193937078 X:87636584-87636606 TTCAAGGCAGCCAGTGAGCAGGG - Intronic
1195280341 X:103327241-103327263 TGCAAGCCGGAGAGTGAGGAAGG + Intergenic
1195297299 X:103491481-103491503 CTGAAGGCAGAGAGTAACTATGG - Intergenic
1195907263 X:109856761-109856783 GAGAAGGCAGAGAGAGAGGATGG + Intergenic
1196047714 X:111273691-111273713 ATCAGGGAAGAGACTGAGGATGG + Intergenic
1196218863 X:113088176-113088198 TTCCAGGCAGAGAGTGAGACAGG - Intergenic
1196872627 X:120127198-120127220 CTCAAGACAGAGATCCAGGAAGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1199241989 X:145557545-145557567 CAAAAGGAAGAGAGAGAGGAAGG - Intergenic
1200142458 X:153908902-153908924 CCCAAGGCAGAGCCTGTGGAGGG - Intronic
1201192652 Y:11459762-11459784 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1201550118 Y:15210447-15210469 AGAAAGGCAGAGAGTGAGGAAGG + Intergenic
1201976680 Y:19856978-19857000 CTAAAGGCAGTTAGAGAGGAAGG - Intergenic