ID: 1146731100

View in Genome Browser
Species Human (GRCh38)
Location 17:35194370-35194392
Sequence CATTGTGACCTCATTGGAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146731093_1146731100 -6 Left 1146731093 17:35194353-35194375 CCCCTCAGAGCTCCAGCCATTGT 0: 3
1: 1
2: 0
3: 20
4: 186
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127
1146731094_1146731100 -7 Left 1146731094 17:35194354-35194376 CCCTCAGAGCTCCAGCCATTGTG 0: 3
1: 1
2: 0
3: 15
4: 176
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127
1146731092_1146731100 0 Left 1146731092 17:35194347-35194369 CCTGGGCCCCTCAGAGCTCCAGC 0: 4
1: 0
2: 5
3: 52
4: 524
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127
1146731091_1146731100 14 Left 1146731091 17:35194333-35194355 CCTGGCTCAGGGAGCCTGGGCCC 0: 4
1: 0
2: 6
3: 59
4: 488
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127
1146731089_1146731100 17 Left 1146731089 17:35194330-35194352 CCTCCTGGCTCAGGGAGCCTGGG 0: 4
1: 0
2: 2
3: 55
4: 444
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127
1146731095_1146731100 -8 Left 1146731095 17:35194355-35194377 CCTCAGAGCTCCAGCCATTGTGA 0: 3
1: 1
2: 1
3: 35
4: 627
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127
1146731087_1146731100 22 Left 1146731087 17:35194325-35194347 CCTCTCCTCCTGGCTCAGGGAGC 0: 4
1: 0
2: 5
3: 53
4: 434
Right 1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG 0: 1
1: 1
2: 1
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146731100 Original CRISPR CATTGTGACCTCATTGGAGT GGG Exonic
900836046 1:5004914-5004936 CATAGAGACCTAATTGGATTAGG - Intergenic
904998306 1:34648426-34648448 GATTGTGAGCTCCTTGGGGTGGG - Intergenic
909665985 1:78134090-78134112 CTTTGTGTACTCATTGTAGTTGG + Intronic
912456060 1:109798170-109798192 CATGGTGGCCTCAAAGGAGTTGG + Intergenic
913398573 1:118401014-118401036 CATTCAGATCTCATTGGAGAAGG + Intergenic
916967020 1:169958092-169958114 TATGGTGACCTCCTGGGAGTTGG - Intronic
917665090 1:177218586-177218608 CATTCTCACCTCATTGGAAATGG - Intronic
918184242 1:182113196-182113218 CATTGTGACTTTATAAGAGTGGG + Intergenic
918418317 1:184335781-184335803 TATGGTGACCTCCTGGGAGTGGG + Intergenic
918633801 1:186750781-186750803 AATTGTGACCTAATTGGTCTAGG + Intergenic
921912930 1:220571884-220571906 TATGGTGACCTCCTGGGAGTGGG - Intronic
924443229 1:244104045-244104067 TATGGTGACCTCACTGGAGCAGG + Intergenic
1062810127 10:457050-457072 CATTGTGCCGTAATTGGAGGTGG - Intronic
1063202236 10:3794816-3794838 CATGGTGGCCTCCTTGGAGATGG - Intergenic
1063506040 10:6600515-6600537 TATTATGAGCTCGTTGGAGTTGG + Intergenic
1064459734 10:15522589-15522611 TATTGTGTCCTCAATGGACTTGG - Intronic
1064504650 10:16015481-16015503 CTTTGTGACGTAATTTGAGTAGG - Intergenic
1070588618 10:77785607-77785629 CATTGTTACCCCATGGAAGTTGG + Intergenic
1074205710 10:111281094-111281116 AATTCTGACCTCATAGGAGGAGG - Intergenic
1075488946 10:122849765-122849787 CATTGTGAACTCCTTAGAATGGG + Intronic
1078246825 11:9581052-9581074 TATGGTGACCTCTGTGGAGTGGG + Intronic
1079610698 11:22429391-22429413 CACTGTAACACCATTGGAGTTGG - Intergenic
1084898096 11:72290239-72290261 CAGTGAGAACTCATTGAAGTTGG - Intergenic
1089501053 11:118931330-118931352 TATGGTGACCTCCTAGGAGTGGG + Intronic
1090645034 11:128760462-128760484 CATTGGGAGCTCCTTGGAGAAGG - Intronic
1091148998 11:133308863-133308885 TATTGTGAACTCTTTGAAGTTGG - Intronic
1092006586 12:5075310-5075332 CTTTTTGACATCATTGCAGTTGG + Intergenic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1096432184 12:51555607-51555629 GATTGTGACCTTATTGGATGTGG + Intergenic
1096916682 12:55040440-55040462 CACTGTTACCTCATTACAGTTGG + Intergenic
1101180927 12:102217458-102217480 CATGGTGACCTCCCAGGAGTGGG - Intergenic
1101195478 12:102377696-102377718 GATAGTGACCTGATTGGAGGAGG + Intergenic
1102799340 12:115717848-115717870 TATGGTGACCTCCTGGGAGTGGG + Intergenic
1105694999 13:22879267-22879289 CATGGTGACCTCCTGGGAGCAGG - Intergenic
1106745929 13:32706710-32706732 CATTTTGACCTCATTTGAATGGG + Intronic
1107128911 13:36874040-36874062 CATTGTAACCTTCTAGGAGTCGG - Intronic
1111041454 13:82754810-82754832 AGTTCTGACATCATTGGAGTTGG + Intergenic
1117269823 14:54131735-54131757 CAATGTGAAATCATAGGAGTTGG - Intergenic
1118130034 14:62952769-62952791 CATTTGGACCTCATTCTAGTAGG - Intronic
1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG + Intergenic
1120139554 14:80913489-80913511 AATTGTTACCTCTTTTGAGTGGG + Intronic
1122165255 14:99818336-99818358 CATTGTCACCTCCTTGGTTTGGG - Intronic
1124857574 15:33405697-33405719 CTTTGCAACCTCATTTGAGTTGG - Intronic
1127359215 15:58230327-58230349 CACTTTGACTTCATTTGAGTGGG - Intronic
1130327498 15:82892721-82892743 CCTTGTGACATCATAGAAGTAGG + Exonic
1131923260 15:97353628-97353650 TATGGTGACCTCTTGGGAGTGGG + Intergenic
1133893363 16:9902751-9902773 CATTGTGTATTCATGGGAGTAGG - Intronic
1143527566 17:7481432-7481454 CATTGTGACATGGTTGGAGTGGG - Exonic
1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG + Exonic
1149943891 17:60900022-60900044 TATGGTGACCTCATAGGAGTAGG + Intronic
1154115402 18:11609511-11609533 CACTGTGACCTCATTGGAGTTGG - Intergenic
1155254427 18:23982333-23982355 CATGGCAACCTCATTTGAGTGGG + Intergenic
1155423507 18:25681454-25681476 CATTGTGACCTCATTTCCATAGG + Intergenic
1156189034 18:34697326-34697348 CACAGTGACCTCACAGGAGTTGG - Intronic
1157358170 18:46954146-46954168 AATTGTAACCTGATTGGAGAAGG + Intronic
1157367567 18:47079744-47079766 CATTGTGTCCTCATGGTAGTAGG + Intronic
1162578969 19:11516188-11516210 TATTGTGACCTCCTGGGACTTGG - Intronic
1162826698 19:13256844-13256866 CATTCTGACATCAGTGGAGTGGG - Intronic
1163958464 19:20665290-20665312 CATTTTGAGCTCCTTGGAGGAGG - Intronic
1165932536 19:39369281-39369303 TATGGTGACCTCCTAGGAGTGGG + Intronic
928684492 2:33734149-33734171 CATTTTAACCATATTGGAGTGGG + Intergenic
929159157 2:38814396-38814418 CATTGTAGGCTCCTTGGAGTGGG - Intronic
929464227 2:42130287-42130309 CATTGTGAACCCTTTTGAGTGGG - Intergenic
932215532 2:69963674-69963696 CCTTGGGACCTCATTTGAGTGGG + Intergenic
935171661 2:100614960-100614982 CAATGTGCCCTCAGTGGAGCAGG + Intergenic
935315563 2:101830281-101830303 CATTGTGACTTCATTGTAGTAGG + Intronic
939259497 2:139788975-139788997 AATTATAACCTCATTTGAGTGGG + Intergenic
940751793 2:157634209-157634231 CCTTGTGACCTCATTCAGGTAGG - Intergenic
948335935 2:237207130-237207152 CTGTGTGCCCTCATTGGGGTAGG - Intergenic
1171105888 20:22431978-22432000 CATTGTGACCACCCTGGCGTGGG + Intergenic
1172770835 20:37381775-37381797 TATCGTGACCTCAATGGAATAGG + Intronic
1174959573 20:55139889-55139911 TACTTTGACCTCATTAGAGTGGG + Intergenic
1178975251 21:37215736-37215758 TATGGTGACCTCCTGGGAGTGGG + Intergenic
1180244215 21:46535927-46535949 CATGGTGACCTTCTAGGAGTGGG + Intronic
1183581686 22:38730220-38730242 CATTGTCCCCTCATTGGAAAAGG + Intronic
1184279677 22:43429849-43429871 CACTGTGGCCTCCGTGGAGTGGG + Intronic
1185051797 22:48557880-48557902 CATTGTGACCTCAAGGGACAGGG - Intronic
951409593 3:22346066-22346088 CATTTTCAGCTCATTGCAGTTGG - Intronic
952914722 3:38226186-38226208 GATTGTGACCTTATTACAGTGGG - Intronic
954634106 3:52062360-52062382 CTTGGTGACCTCATGGGAGATGG - Intergenic
955913927 3:63887021-63887043 CATTGAAACTTCATGGGAGTGGG - Intronic
958945828 3:100360924-100360946 GCTTGTGACCTCATTAGATTTGG + Intergenic
959619600 3:108385804-108385826 GAATGTGACCTGGTTGGAGTGGG - Intronic
960312958 3:116139404-116139426 CATTATGACATCAATGAAGTTGG + Intronic
960667242 3:120122040-120122062 TATGGTGACCTCCTGGGAGTGGG + Intergenic
961569935 3:127790500-127790522 CACTGTGACCTCATGGCAGCAGG + Intronic
961782747 3:129330520-129330542 TAATGTGACCTCAATGGAGTAGG - Intergenic
962839866 3:139223673-139223695 CATTCTTACCCCATAGGAGTAGG - Intronic
962884319 3:139609814-139609836 TATGGTGACCTCCTGGGAGTGGG - Intronic
966426897 3:179789585-179789607 CATTGTTACCTCTGTGGAGGAGG + Intergenic
967083865 3:186076432-186076454 TATGGTGACCTCCTGGGAGTGGG - Intronic
970387927 4:15575084-15575106 CATACTGCCCTCATTGGATTTGG + Intronic
976847364 4:89505163-89505185 CATTGTGACCTCTTTTAGGTTGG + Intergenic
977073153 4:92418426-92418448 AATTGTGACCTGATTGCATTTGG + Intronic
981731781 4:147907047-147907069 CATTTTGATCTCAGTGGAGATGG + Intronic
981858193 4:149321176-149321198 CATGGAGTCCTAATTGGAGTGGG - Intergenic
982248680 4:153381869-153381891 TATGGTGACCTCCTGGGAGTGGG - Intronic
984872920 4:184343201-184343223 CATGGTGACCTCTTTGGTGGAGG + Intergenic
985859130 5:2456544-2456566 CAGAGTGACCTGATTGGAGAGGG - Intergenic
988579352 5:32455412-32455434 CCCTGTGACCTCATAGGAGATGG + Intergenic
992017616 5:72591973-72591995 CAATGGGATCCCATTGGAGTGGG + Intergenic
998960075 5:147476954-147476976 AATTGTGAACTCATGTGAGTTGG - Intronic
1000248813 5:159472935-159472957 CATAGTGACCTTTTTGGAGGTGG + Intergenic
1003197028 6:3924249-3924271 CTTTGTGGCCTCATTGAATTAGG + Intergenic
1005750521 6:28877780-28877802 CATTATGCCCTCCTTAGAGTAGG - Intergenic
1006021586 6:31120896-31120918 GAATGGGACCTCATTGGGGTTGG - Intronic
1009744600 6:67796897-67796919 CATAGTGACCTGAATGGAATTGG + Intergenic
1010808384 6:80266502-80266524 CATTGTGACCTTTTTTCAGTAGG + Intronic
1014319140 6:119905014-119905036 AATTCTGTCCTCATTAGAGTGGG + Intergenic
1015581518 6:134730316-134730338 AATTGTGACCTGATTTGAGGTGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017838356 6:158200754-158200776 CAGTGTGATCTCATTGGGATAGG - Intergenic
1017870435 6:158482108-158482130 CTTTGTGCCCTCAGTGGATTTGG + Intronic
1020853964 7:13393529-13393551 CATTTTTACCTCATAGGATTTGG - Intergenic
1022267212 7:28768797-28768819 CACTGTTAACTCATTTGAGTGGG - Intronic
1023410927 7:39888498-39888520 TATGGTGACCTCCTGGGAGTGGG + Intergenic
1024972306 7:55082035-55082057 CATTGTGAAATCACTGGAGTGGG - Intronic
1029684980 7:102141040-102141062 CACTCTGACATCATTGGATTTGG - Intronic
1029887814 7:103891414-103891436 CATTGTGCACTCATTGGAATTGG - Intronic
1030788168 7:113688182-113688204 CATTTTAACATCATTGAAGTAGG - Intergenic
1033325055 7:140370770-140370792 CATTGTGATTTAATTGAAGTAGG - Intronic
1033712315 7:143960545-143960567 GATGGTGACCTCATTGGAGGAGG - Exonic
1035052483 7:156007533-156007555 CAGTGGGACCTCATTGCAGCGGG + Intergenic
1037094915 8:14974568-14974590 CATTGTGATTTAATTGGTGTGGG - Intronic
1038130644 8:24727335-24727357 CAGTGTGACCTCATTGCACATGG - Intergenic
1041838802 8:62246747-62246769 CACTGCAACCTCATTGGGGTGGG - Intergenic
1045742792 8:105381577-105381599 CATAGTTCCCTCATTGCAGTGGG + Intronic
1046763322 8:118043661-118043683 CACTGTGTCTGCATTGGAGTTGG - Intronic
1047732218 8:127737000-127737022 CATCCTGAGCTCCTTGGAGTAGG + Intronic
1055088683 9:72340250-72340272 TATTGTGTCCTCAATGTAGTTGG + Intergenic
1057218094 9:93240556-93240578 CATCGAGGCCTCATTGGAGGGGG + Intronic
1057862556 9:98652932-98652954 GATACTGACCTCATTGGTGTGGG + Intronic
1057892144 9:98877372-98877394 CATGGTGACCTCATTCCAGGTGG - Intergenic
1185734951 X:2489382-2489404 CATGCTGAGCTCCTTGGAGTCGG + Exonic
1189503290 X:41584609-41584631 CATTAGGTCCTCATAGGAGTGGG - Intronic
1189809985 X:44772920-44772942 AATGGTGACCTCTTGGGAGTAGG - Intergenic
1191165649 X:57387905-57387927 CATTATTACATCATTGGAGGTGG + Intronic
1194887525 X:99335216-99335238 CATTGTGACCTAATTGAGGGTGG - Intergenic
1197182997 X:123556664-123556686 AATTCTGACCTAATTGGTGTAGG - Intergenic
1199872471 X:151912240-151912262 CACTGTGACCTCAGGGGACTAGG + Intergenic
1200017484 X:153178332-153178354 CATTGCCACCTCATGGGACTGGG + Intergenic