ID: 1146737945

View in Genome Browser
Species Human (GRCh38)
Location 17:35255436-35255458
Sequence ACGCATACACACACATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1446
Summary {0: 1, 1: 0, 2: 17, 3: 170, 4: 1258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146737945_1146737948 11 Left 1146737945 17:35255436-35255458 CCATGATATGTGTGTGTATGCGT 0: 1
1: 0
2: 17
3: 170
4: 1258
Right 1146737948 17:35255470-35255492 CATACGCATGGGTGTTTTAGCGG 0: 1
1: 0
2: 0
3: 3
4: 81
1146737945_1146737947 0 Left 1146737945 17:35255436-35255458 CCATGATATGTGTGTGTATGCGT 0: 1
1: 0
2: 17
3: 170
4: 1258
Right 1146737947 17:35255459-35255481 GCGCACATGTGCATACGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1146737945_1146737946 -1 Left 1146737945 17:35255436-35255458 CCATGATATGTGTGTGTATGCGT 0: 1
1: 0
2: 17
3: 170
4: 1258
Right 1146737946 17:35255458-35255480 TGCGCACATGTGCATACGCATGG 0: 1
1: 0
2: 0
3: 11
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146737945 Original CRISPR ACGCATACACACACATATCA TGG (reversed) Intronic
900788068 1:4662037-4662059 ACACACACACACAAATATAAAGG - Intronic
902056404 1:13604143-13604165 ACGCATACACACACACATACAGG - Intronic
903184383 1:21620972-21620994 ACACACACAAACACATATGATGG + Intronic
903681178 1:25098299-25098321 ACACACACACACACAGCTCAGGG + Intergenic
904217153 1:28930466-28930488 ACACACACACACACAGTTCAGGG - Intronic
904288412 1:29468528-29468550 ACGCATACACACACACGTCTTGG + Intergenic
904922121 1:34016006-34016028 ACACACACACACACAGAGCAAGG - Intronic
905174369 1:36126641-36126663 ACGCATGCACACACACACCCAGG - Intergenic
906055816 1:42916048-42916070 AAGCAGACACAGACATAGCAGGG + Intergenic
906379203 1:45321263-45321285 ACACGTACACACACACATCTTGG + Intergenic
906699374 1:47846882-47846904 ACACACACACACACAAATGAGGG + Intronic
908069706 1:60444967-60444989 ACACACACACACACACACCAGGG - Intergenic
908096821 1:60747909-60747931 ATGTATACACATACATAACATGG - Intergenic
908361465 1:63372476-63372498 ACACAGACACACACATATATAGG + Intronic
908578008 1:65482128-65482150 ACACACACACACACACACCAGGG + Intronic
909206111 1:72759734-72759756 ATATATACACACACATACCATGG - Intergenic
909313633 1:74187366-74187388 ACACACACACACACACACCATGG + Intronic
909743774 1:79066844-79066866 GCACACACACACACATATCTTGG - Intergenic
909778198 1:79510716-79510738 AAGCATTCAGTCACATATCATGG - Intergenic
909860563 1:80599910-80599932 ACACACACACACACACACCATGG + Intergenic
909893832 1:81040757-81040779 ACAAACACACACACATATTAAGG + Intergenic
909947843 1:81683650-81683672 ACACACACACACACACATAATGG - Intronic
910290692 1:85597624-85597646 ACACACACACACACACAGCACGG + Intergenic
910527107 1:88192361-88192383 ACACACACACACACATATAAAGG + Intergenic
910589312 1:88912477-88912499 ACACACACACACACACACCATGG - Intergenic
910769634 1:90817927-90817949 ACACATACACACATATATATAGG + Intergenic
911255071 1:95623836-95623858 ACACATTGAAACACATATCAAGG - Intergenic
911315453 1:96351145-96351167 ACCAATACACACACACATTATGG - Intergenic
911426293 1:97717803-97717825 ACACATGCACACACACACCATGG - Intronic
911562478 1:99423414-99423436 ACACACACACACACACACCATGG + Intergenic
911574244 1:99556055-99556077 ACGCATACACACATACAACTAGG + Intergenic
911644904 1:100327727-100327749 ACACACACACACACAAATAATGG - Intergenic
911660185 1:100492835-100492857 ACACACACACACACACAGCAGGG - Intronic
911715663 1:101129863-101129885 ACACACACACACACACACCATGG - Intergenic
911870158 1:103087006-103087028 ACGCATACATACATATATGTGGG + Intronic
911958708 1:104271295-104271317 ACACACACACACACACACCATGG + Intergenic
912075373 1:105868277-105868299 ACACACACACACACACACCAAGG + Intergenic
912081248 1:105939399-105939421 ACACACACACACACACACCATGG - Intergenic
912284478 1:108354478-108354500 ACACACACACACACACACCATGG + Intergenic
912821020 1:112867762-112867784 ACACACACACACACAGATTAGGG - Intergenic
912826826 1:112912214-112912236 AATCATATACACAAATATCAAGG + Exonic
912980796 1:114369694-114369716 ACACATATACACACACATCTTGG - Intergenic
913080358 1:115379281-115379303 ACACACACACACACACACCATGG - Intergenic
913384126 1:118241156-118241178 ACACACACAAACATATATCATGG + Intergenic
913483017 1:119307382-119307404 ACACACACACACACACACCACGG + Intergenic
913575249 1:120166413-120166435 ACACACACACACACACACCATGG + Intronic
913576270 1:120178277-120178299 ACACACACACACACACACCATGG - Intergenic
913716894 1:121544513-121544535 ACACACACACACACAGAGCATGG - Intergenic
914557555 1:148782053-148782075 ACACACACACACACACACCATGG + Intergenic
914615279 1:149348177-149348199 ACACACACACACACACACCATGG - Intergenic
914702253 1:150145583-150145605 ACACACACACACACAAAACAGGG - Intergenic
914726580 1:150332892-150332914 ACAGATATACACACACATCATGG - Intronic
914978569 1:152390918-152390940 ACACATACACATATATATGATGG - Intergenic
915855191 1:159376008-159376030 ACACACACACACACACACCATGG - Intergenic
915994747 1:160550997-160551019 AACCATATACACATATATCATGG - Exonic
916346204 1:163794188-163794210 ACACACACACACACACACCATGG - Intergenic
916624484 1:166540406-166540428 ACACACACACACACACATCTTGG + Intergenic
916624996 1:166545947-166545969 ACACACACACACACACACCATGG - Intergenic
916855922 1:168749491-168749513 ACACACACACACACACACCATGG - Intergenic
917061130 1:171041342-171041364 ACACACACACACACACATCATGG - Intronic
917232222 1:172850819-172850841 ACACGTACATACACATATCTTGG + Intergenic
917311382 1:173682707-173682729 ACACACACACACACACATCTTGG + Intergenic
917643357 1:177005694-177005716 ACACATACACATACACACCATGG - Intronic
917913087 1:179671945-179671967 ACACACACACACACACACCATGG - Intronic
918529749 1:185505107-185505129 ACACACACACACACACACCATGG - Intergenic
918554903 1:185787132-185787154 ACACACACACACATACATCATGG - Intronic
918558645 1:185837001-185837023 ACACACACACACACACACCATGG - Intronic
918573966 1:186033078-186033100 ACACACACACACACACACCATGG + Intronic
918576163 1:186063027-186063049 ACACACACACACACATTCCATGG - Intronic
918731887 1:188008709-188008731 ACACACACACACACATTGCATGG - Intergenic
918860400 1:189818190-189818212 ACACACACACACACATATATGGG - Intergenic
918882695 1:190145835-190145857 ACATATATACACACATACCATGG + Intronic
919225058 1:194687103-194687125 ACACACACACACACACACCATGG + Intergenic
919236184 1:194845509-194845531 ACACACACACACACACATAATGG - Intergenic
919317421 1:195991015-195991037 ACACACACACACACATATATAGG + Intergenic
919543765 1:198885300-198885322 ACACACACACACACAGATAATGG + Intergenic
919666580 1:200298568-200298590 ACACACACACACACATATTATGG - Intergenic
919871667 1:201826613-201826635 ACACAGACATACACATATCCTGG - Exonic
919877093 1:201877499-201877521 ACACACACACACACAAATCATGG + Exonic
920392513 1:205617958-205617980 ACACACACACACACATATATGGG - Intronic
920620293 1:207539603-207539625 ACACACACACACACACATTAAGG + Intronic
920622075 1:207558160-207558182 ACACACACACACACACATTAAGG + Intronic
920636320 1:207707806-207707828 ACACACACACACACATATTAAGG + Intronic
921242138 1:213195817-213195839 ACACACACACACACACACCATGG - Intronic
921448299 1:215272409-215272431 ACACACACACACACACACCATGG + Intergenic
921590230 1:216994469-216994491 ACACACACACACACACATCCTGG + Intronic
921679668 1:218015551-218015573 ACACATACACACACAGAACTTGG - Intergenic
922035535 1:221844469-221844491 ACACACACACACACAAAGCATGG + Intergenic
922074133 1:222226039-222226061 ACACATATACACAAATATCCTGG + Intergenic
922078535 1:222271827-222271849 ACACATACACACAAACACCATGG + Intergenic
922588443 1:226753634-226753656 ACGCACACACACACATATACAGG - Intergenic
922925761 1:229345538-229345560 ACACACACACACAAATATAAGGG + Intergenic
923007699 1:230065418-230065440 ACACACACACACACATATCTAGG - Intronic
923180296 1:231511346-231511368 ACACACACACACACACTTCATGG + Intergenic
923498485 1:234544995-234545017 ACACACACACACACACACCAGGG - Intergenic
923945075 1:238876347-238876369 ACACATTCACACACATACAACGG - Intergenic
924562565 1:245169324-245169346 ACACACACACACACACACCATGG - Intronic
1062853557 10:765730-765752 ACACACACACACACACACCATGG + Intergenic
1063063839 10:2588715-2588737 ACAAATACACACACATCGCAGGG - Intergenic
1063170741 10:3507911-3507933 ACACACACACACACACACCATGG + Intergenic
1063285951 10:4688634-4688656 ACACACACACACACATATGCAGG + Intergenic
1063599952 10:7471895-7471917 ACACATACACACATACAGCATGG + Intergenic
1063601759 10:7488241-7488263 ACACACACACACACATATTTTGG + Intergenic
1063855756 10:10251701-10251723 ACACACACACACAAATATAAAGG + Intergenic
1064106392 10:12504234-12504256 ACACACACACACACACATCTAGG + Intronic
1064155506 10:12900248-12900270 ATGCTCACACACACATATAAAGG - Intronic
1064637230 10:17380732-17380754 ACACATACACACACACATCTTGG - Intronic
1064801198 10:19074415-19074437 ACACAAACACACAGACATCAAGG - Intronic
1065148430 10:22797126-22797148 ACACATACATACACATATTTTGG - Intergenic
1065291981 10:24239668-24239690 ACACACACACACACACATCTGGG - Intronic
1066023642 10:31328990-31329012 ACACACACACACACACACCAGGG - Intronic
1066023860 10:31331761-31331783 ACACATGCACACACATATTGTGG + Intronic
1066193913 10:33080238-33080260 ACACACACACACACACACCATGG - Intergenic
1066762203 10:38765927-38765949 ACACACACACACACACATTATGG - Intergenic
1067012247 10:42725218-42725240 ACACATACACACACACACAAAGG - Intergenic
1067420190 10:46138665-46138687 ACACATACACACACACATCTTGG + Intergenic
1067425830 10:46210851-46210873 ACACATACACACACACATCTTGG - Intergenic
1067485900 10:46649691-46649713 ACACATGCACACACATTTTAAGG + Intergenic
1067505536 10:46845151-46845173 ACACATACACACACACATCTTGG + Intergenic
1067608856 10:47691962-47691984 ACACATGCACACACATTTTAAGG - Intergenic
1067846825 10:49730884-49730906 ACACACACACACACACACCATGG + Intergenic
1067901482 10:50246126-50246148 ACACACACATACAAATATCAAGG + Intronic
1068168932 10:53368484-53368506 ACACACACACACAAATATCTTGG - Intergenic
1068228068 10:54132845-54132867 ACACACACACACACACACCAAGG + Intronic
1068485036 10:57647055-57647077 ACACACACACACACACACCAGGG - Intergenic
1068502860 10:57862180-57862202 ACACACACACACACACATAAAGG - Intergenic
1068670813 10:59721370-59721392 ACACACACACACACACACCACGG - Intronic
1069077582 10:64054052-64054074 AAGCAAACCCACATATATCAAGG - Intergenic
1069129038 10:64675860-64675882 ACGCATACATACATACACCATGG - Intergenic
1069187190 10:65439498-65439520 ACATATTCACACACATTTCATGG - Intergenic
1070281995 10:75056687-75056709 AAACATATACACACATATAAAGG - Intronic
1070375195 10:75823768-75823790 ACACATACACACACACACCATGG + Intronic
1070477346 10:76842828-76842850 ACACACACACACACACACCAAGG - Intergenic
1070772975 10:79093162-79093184 ACACACACACACACATATTCAGG + Intronic
1071037958 10:81270093-81270115 ACACACACACACACAAATCAAGG - Intergenic
1071249056 10:83797321-83797343 ACACACACACACACAGAGCAAGG - Intergenic
1071321788 10:84467455-84467477 ACACATACACACACATATGTGGG - Intronic
1071411869 10:85405290-85405312 ACACACACACACACACATCTGGG - Intergenic
1071451924 10:85802869-85802891 ACACACACACACACACACCAAGG + Intronic
1071624440 10:87153604-87153626 ACACATGCACACACATTTTAAGG - Intronic
1071756920 10:88552737-88552759 ACATATACACACACATATATAGG + Intronic
1071953910 10:90736086-90736108 ACACACACACACACATAAAATGG + Intergenic
1072486286 10:95858965-95858987 ATACAAACACACACATATAAAGG - Intronic
1072551858 10:96484613-96484635 ACACACACACACACACACCATGG + Intronic
1073204567 10:101762084-101762106 ACTCGTACACACTCATACCAGGG + Intergenic
1073370963 10:102988554-102988576 ATGCATACACACACATACTTTGG + Intronic
1073654812 10:105402384-105402406 ATACATATACACACATATAATGG + Intergenic
1073663270 10:105501449-105501471 ACACACACACACACAAATGAAGG + Intergenic
1073711744 10:106050998-106051020 ACACACACACACACACTTCAAGG + Intergenic
1073894179 10:108135417-108135439 AGACATACACACACATATACAGG + Intergenic
1074398609 10:113121782-113121804 ACACACACACACACAAATGAAGG + Intronic
1074620862 10:115119329-115119351 ACACACACATATACATATCAGGG - Intronic
1075125092 10:119693093-119693115 ACACACACACACACAGATGAGGG - Intergenic
1075128574 10:119720878-119720900 ACCCTCACACACACATATCCAGG + Intergenic
1075351162 10:121726215-121726237 ACACACACACACACATAACAAGG - Intergenic
1075988324 10:126808462-126808484 ACACACACACACACAGATAATGG - Intergenic
1076534504 10:131168178-131168200 ATGCACACACACACATAGAAAGG + Intronic
1076684691 10:132192834-132192856 ACCCAGACACTCACAGATCATGG - Exonic
1076763576 10:132617809-132617831 ACGCAGGCAAACACATATGATGG - Intronic
1077205478 11:1340719-1340741 ACACATACACAAACACATCCAGG + Intergenic
1077205489 11:1340853-1340875 ACACATACACAAACACATCCAGG + Intergenic
1077727914 11:4694586-4694608 ACACACACACACACATATGCAGG + Intronic
1077741676 11:4853229-4853251 ATGCACACACACACATACAAGGG + Intronic
1077832268 11:5886172-5886194 ACACATACACACACACACAAAGG - Intronic
1078294615 11:10055555-10055577 ACACACACACACACACACCATGG + Intronic
1078369316 11:10731936-10731958 ACACACACACACACACATGAGGG - Intergenic
1078572339 11:12470065-12470087 ACGCATGCACGCACATTTCTGGG - Intronic
1078769428 11:14334544-14334566 ACACACACACACACACATAATGG + Intronic
1078939119 11:15980860-15980882 ACACATACACACACAAGACATGG - Intronic
1078960329 11:16259938-16259960 ACACACACACACACATATTTGGG - Intronic
1079179948 11:18183151-18183173 ACACACACACACACACACCATGG + Intronic
1079270286 11:18978197-18978219 ACACACACACACATATACCATGG - Intergenic
1079519349 11:21307315-21307337 ACACAAACACACACACATCCAGG - Intronic
1079564397 11:21864429-21864451 ACTCATACACACATATCCCAAGG - Intergenic
1079597950 11:22275320-22275342 ACACACACACACGCTTATCAAGG + Intronic
1079627099 11:22628992-22629014 ACACACACACACACATACCATGG - Intronic
1079691404 11:23422499-23422521 GCACACACACACACATATCTTGG - Intergenic
1079888232 11:26016263-26016285 AGGCATACAGTCACATTTCAGGG - Intergenic
1080273943 11:30482052-30482074 ACTCATAGACACACATTTTACGG + Intronic
1080402772 11:31952818-31952840 ACACACACACACACATACAATGG + Intronic
1080431834 11:32206764-32206786 ACACACACACACACAGATTAGGG - Intergenic
1080638159 11:34141333-34141355 ACACACACACACACAAATCCAGG + Intronic
1080738008 11:35036299-35036321 ATGCAGACACAAACACATCAGGG - Intergenic
1080995662 11:37597367-37597389 ACTCATATACACACATAAGATGG + Intergenic
1081159001 11:39730805-39730827 ACACACACACACACATATCTGGG - Intergenic
1081985054 11:47295709-47295731 TCGTATACACACACCTATGATGG - Intronic
1082126764 11:48441228-48441250 ACACACACACACACACACCATGG - Intergenic
1082560334 11:54612188-54612210 ACACACACACACACACACCATGG - Intergenic
1082692340 11:56321815-56321837 ACACATGCACACACATATGCAGG + Intergenic
1082868941 11:57925714-57925736 ACACACACACACACACACCATGG - Intergenic
1082942407 11:58721581-58721603 ACACATACACACATACATCTTGG + Intronic
1083072387 11:59998846-59998868 ACACACACACACACATCTCTTGG - Intergenic
1084214761 11:67641225-67641247 TCGCACACACACACGTATCAGGG - Intergenic
1084578911 11:70010130-70010152 ACACACACACACACACACCATGG - Intergenic
1085314269 11:75534877-75534899 ACACACACACACACACGTCAGGG - Intergenic
1085573268 11:77578322-77578344 ACCCATATACACACATATCTTGG - Intronic
1085654552 11:78301186-78301208 ACACATATACACACACATAATGG + Intronic
1085693501 11:78684544-78684566 AGACACACACACACACATCATGG + Intronic
1086051098 11:82591396-82591418 ACACACACACACACACACCATGG - Intergenic
1086117075 11:83264087-83264109 ACATACACACACACATATCTTGG - Intronic
1086259881 11:84926357-84926379 ACACATACACACATATATCTGGG - Intronic
1086274374 11:85108012-85108034 ACACACACACACACACATCCAGG + Intronic
1086315234 11:85584335-85584357 ACACACACACACACACACCATGG - Intronic
1086737764 11:90328362-90328384 ACATATACACTCACATATGAAGG + Intergenic
1086877785 11:92118184-92118206 ACACACACACACACACAGCATGG + Intergenic
1086950553 11:92886324-92886346 ACACACACACACACACACCAGGG - Intronic
1086998048 11:93381517-93381539 AAGCATACTGACACATTTCAAGG - Intronic
1087041369 11:93804045-93804067 ACGCACACACACACACATAAAGG + Intronic
1087050049 11:93877721-93877743 ACACACACACACACACATCTTGG + Intergenic
1087145837 11:94810868-94810890 ACGCGTACACACACATATCTTGG + Intronic
1087358311 11:97123409-97123431 ACACAGACACACACATACAAAGG + Intergenic
1087429599 11:98035982-98036004 ACACACACACACACACACCATGG + Intergenic
1087846331 11:102977681-102977703 ACACACACACACACACATCAGGG - Intergenic
1088187029 11:107181985-107182007 ACACACACACACACACACCATGG + Intergenic
1088756440 11:112889328-112889350 ACACATACACATACATATGGGGG + Intergenic
1088913196 11:114207613-114207635 ACACACACACACACATATTGAGG + Intronic
1089323302 11:117640884-117640906 ACACAAACACACACACAGCAGGG - Intronic
1089354013 11:117838051-117838073 ACACACACACACACACATCACGG + Exonic
1089915465 11:122151322-122151344 ACACACACACACACATCTTAAGG + Intergenic
1090180681 11:124696489-124696511 ACACACACACACAGATCTCATGG + Exonic
1090866056 11:130701817-130701839 ACACACACACACACAAAACAGGG - Intronic
1091022416 11:132112745-132112767 ACACACACACACACATTACATGG + Intronic
1091074038 11:132597825-132597847 ACGCATACATACACAGATAAAGG - Intronic
1091327835 11:134704500-134704522 ACGCATACACACACAGACACAGG + Intergenic
1091513534 12:1154198-1154220 ATACATACACACACACACCATGG - Intronic
1092840140 12:12532439-12532461 AGGCATACAAACACATACGATGG + Intronic
1093266590 12:17010941-17010963 ACACAGACACACACATACAATGG - Intergenic
1093290663 12:17317214-17317236 ACACACACACACCTATATCATGG - Intergenic
1093297839 12:17413216-17413238 ACACACACACACACATATAAAGG + Intergenic
1093471130 12:19503324-19503346 ACACACACACACACACACCAAGG - Intronic
1093625024 12:21335723-21335745 TCCCAAACACACACACATCAAGG + Intronic
1093720211 12:22433102-22433124 ACACACACACACACACACCATGG - Intronic
1093820470 12:23611349-23611371 ACGCACACACACACACACGATGG - Intronic
1094015824 12:25862950-25862972 ATACACACACACACATATAATGG - Intergenic
1094051848 12:26228660-26228682 ACACACACACACACAGAACATGG + Intronic
1094209942 12:27878378-27878400 ACACACACACACACTTATCCAGG + Intergenic
1094578476 12:31710572-31710594 ACACACACACACACATTTAAAGG + Intronic
1095375771 12:41526752-41526774 ATGCATACAAACACAGATCATGG + Intronic
1095500578 12:42833748-42833770 ACACACACACATACATACCATGG - Intergenic
1095532516 12:43205943-43205965 ACACATACACACACACACTATGG - Intergenic
1095777496 12:46025645-46025667 ACACACACACACACACACCAAGG - Intergenic
1095808986 12:46351709-46351731 ACACACACACACACACACCATGG - Intergenic
1095842441 12:46708389-46708411 ACACACACACACACAAATCCAGG - Intergenic
1096344780 12:50836227-50836249 ACACACACACACACACACCATGG + Intergenic
1096449913 12:51730375-51730397 AAGCATAGACAAACAGATCAAGG - Intronic
1096695110 12:53344161-53344183 ACACATCAACACACAGATCAAGG - Intronic
1096859465 12:54513961-54513983 ACACACACACACACATCTGAAGG - Intronic
1097536893 12:60883537-60883559 ACACACACACACACACACCACGG - Intergenic
1097960579 12:65528511-65528533 ACACACACACACACAAAACACGG - Intergenic
1098406600 12:70132857-70132879 ATGCATACACACACACACGATGG - Intergenic
1098561415 12:71877185-71877207 ACACACACACACACATAACATGG - Intronic
1098698545 12:73591634-73591656 ACACACACACACACACATAAGGG - Intergenic
1098707244 12:73706165-73706187 ACACACACACACAAATTTCAGGG + Intergenic
1099139619 12:78955791-78955813 ACACACACACACAAATATCTTGG - Intronic
1099497012 12:83360990-83361012 ACACACACACACACATAACTTGG - Intergenic
1099665496 12:85623172-85623194 ACACACACACACACAAATCATGG + Intergenic
1099697887 12:86044475-86044497 ATGCATGCACACACATATTCTGG + Intronic
1099739852 12:86620347-86620369 ACACACACACACACATATCCTGG + Intronic
1099765974 12:86984956-86984978 ACACACACACACACACACCATGG + Intergenic
1099994174 12:89759129-89759151 ATGTATACCCACACATACCATGG + Intergenic
1100137324 12:91569541-91569563 ATACACACACACACATATAAAGG - Intergenic
1100234548 12:92647089-92647111 TATTATACACACACATATCAGGG - Intergenic
1100234551 12:92647253-92647275 ACACACACACACACATACAATGG + Intergenic
1100519831 12:95363826-95363848 ACACACACACACATATATGAAGG + Intergenic
1101009600 12:100435801-100435823 ACACACACACACACACACCATGG - Intergenic
1101295061 12:103413840-103413862 ACACATACACACACACACCATGG - Intronic
1101322516 12:103685417-103685439 ACACACACACACACACAGCATGG - Intronic
1101543874 12:105691193-105691215 ACACACACACACACACACCATGG - Intergenic
1102200191 12:111052730-111052752 ACACATACACAGACATACTAAGG - Intronic
1102201600 12:111061200-111061222 ACACACACACACACACAGCAAGG + Intronic
1102202857 12:111069513-111069535 ACACACACACACACAGAGCAAGG - Intronic
1102459483 12:113091426-113091448 ACACAGACACACAGATACCAGGG - Intronic
1102765022 12:115425245-115425267 ATACATACACACACACACCATGG + Intergenic
1102946395 12:116992757-116992779 ACACACACACACACACACCATGG - Intronic
1103170319 12:118813024-118813046 ACACACATACACACATCTCAGGG - Intergenic
1103499141 12:121387271-121387293 ACACAAACACACACATTTCTGGG + Intronic
1103508569 12:121457764-121457786 ACACACACACACAAATATCTTGG + Intronic
1103665607 12:122562432-122562454 ACACACACACACACAAAACATGG - Intronic
1103839872 12:123853938-123853960 ACGCACACACACACACATTTGGG + Intronic
1104019666 12:124983431-124983453 ACACACACACACACAGAACAAGG + Intronic
1104039539 12:125120734-125120756 ACCCATGCACACACAGAGCACGG - Intronic
1104068334 12:125324025-125324047 ACACATACACACACACAACGGGG + Intronic
1104536635 12:129623628-129623650 ACACATACACACACACACCATGG - Intronic
1104585273 12:130043742-130043764 ACACATACAAACACATATGCAGG - Intergenic
1104707792 12:130960673-130960695 ACACATACACACACACCTCCTGG + Intronic
1105630589 13:22161124-22161146 ACACATACACACACACCTCTTGG + Intergenic
1105636204 13:22217798-22217820 ACGCACACACACTCATGTCATGG + Intergenic
1105850662 13:24332589-24332611 ACACACACACACACATATTATGG - Intergenic
1105971285 13:25431020-25431042 ACACACACACACACACATAATGG + Intronic
1106213460 13:27672891-27672913 ACACACACACACACATATGATGG + Intergenic
1106403190 13:29449337-29449359 ACACATACACACACATACAGTGG + Intronic
1106433167 13:29701712-29701734 ACACACACACACACATACCATGG + Intergenic
1106555519 13:30805098-30805120 ACACACACACACACACACCAGGG + Intergenic
1106681624 13:32014168-32014190 ACACACACACACACACATCCTGG - Intergenic
1106759490 13:32854181-32854203 ACACACACACACACATATAGGGG + Intergenic
1106888536 13:34217001-34217023 ACACACACACACACACACCAAGG - Intergenic
1107000301 13:35536497-35536519 ACCAATACACACACATATATAGG - Intronic
1107345783 13:39459189-39459211 ACACACACACACACACATTAAGG - Intronic
1107566252 13:41608062-41608084 ACATACACACAAACATATCAAGG + Intronic
1107584421 13:41829567-41829589 ATGCACACACACACACACCATGG + Intronic
1107614556 13:42151474-42151496 ACACACACACACACACACCATGG - Intronic
1107948318 13:45439706-45439728 TCGCATACACACACACAAAAAGG + Intergenic
1108223566 13:48263940-48263962 ACACACACACACACATATGATGG - Exonic
1108335219 13:49434026-49434048 ACGCATACACACTCTTGTGATGG - Intronic
1108798334 13:54061513-54061535 ACACATACACACACATTATAAGG + Intergenic
1108875923 13:55051092-55051114 ACACACACACACACACACCATGG + Intergenic
1108902373 13:55427807-55427829 ACACACACACACACACACCATGG + Intergenic
1108904616 13:55452742-55452764 ACACACACACACACACATAAAGG - Intergenic
1109040170 13:57324081-57324103 ACACACACACACACACACCATGG - Intergenic
1109117164 13:58402801-58402823 ACATATACATACACACATCATGG - Intergenic
1109178016 13:59179332-59179354 ACACATACAGACACATACAATGG - Intergenic
1109340926 13:61057698-61057720 ACACATACACACACACTTCTGGG - Intergenic
1109388313 13:61662491-61662513 AAGCAAACACAAAAATATCAAGG - Intergenic
1109462338 13:62678107-62678129 AAACATGCACACACATCTCAAGG + Intergenic
1109599159 13:64600449-64600471 ACACATACACACACATAAGTAGG - Intergenic
1109649591 13:65309193-65309215 ACACACACACACACAAAACAAGG - Intergenic
1109932802 13:69237778-69237800 ACACATACACACACAAAACCTGG + Intergenic
1109939891 13:69348007-69348029 ACACACACACACACACACCATGG + Intergenic
1109954187 13:69544402-69544424 ACACACACACACACACACCATGG + Intergenic
1110305247 13:73979385-73979407 ACACACACACACACAAATCATGG + Intronic
1110335176 13:74321718-74321740 ATTCATACACACACACATGAGGG + Intergenic
1111038778 13:82715915-82715937 ACACACACACACATATATCCTGG - Intergenic
1111259517 13:85718247-85718269 ACACACACACACACACACCAAGG + Intergenic
1111297119 13:86294436-86294458 ACACATACACACACACATATAGG + Intergenic
1111371536 13:87325341-87325363 ACACACACACACACATATTTTGG - Intergenic
1111659987 13:91197359-91197381 ACACACACACACACATACAACGG - Intergenic
1112079087 13:95948239-95948261 ACACACACACACACATATAAAGG + Intronic
1112154392 13:96801503-96801525 ACACACACACACATATATAAAGG - Intronic
1112888127 13:104198805-104198827 ACACACAAACACACAAATCAGGG + Intergenic
1112937363 13:104817752-104817774 ACACACACACACACATATGGGGG + Intergenic
1113002402 13:105657299-105657321 AATCACACACACACATATTATGG + Intergenic
1113096130 13:106665922-106665944 AAGCAAACATAGACATATCAGGG - Intergenic
1113118990 13:106906107-106906129 ACACACACACACACAGAGCAAGG + Intergenic
1113209401 13:107957635-107957657 ACACATACACACACACATACAGG - Intergenic
1113853205 13:113429552-113429574 ATGCATCCACACACAGATGACGG - Intronic
1114196629 14:20483485-20483507 ACACACACACACACACATCCTGG - Intergenic
1114391498 14:22313327-22313349 ACACACACACACACATATCATGG + Intergenic
1114505251 14:23206994-23207016 ACACATACACACACACATCTTGG + Intronic
1114898098 14:27018791-27018813 ACGCACACACACACATCTTCAGG - Intergenic
1114904950 14:27115653-27115675 ACACATACACACACACACAAAGG - Intergenic
1115053576 14:29094659-29094681 ACACACACACACACACACCATGG - Intergenic
1115236541 14:31213538-31213560 ACACATACACACACTAGTCAGGG + Intergenic
1115250871 14:31345912-31345934 ACGCACACACACACACACAATGG + Intronic
1115329083 14:32174734-32174756 ACACAGACACACACACACCATGG - Intergenic
1116003517 14:39268500-39268522 AAGCATACACACACAGTGCAGGG + Intronic
1116158805 14:41240011-41240033 ACACACACACACACATATAAGGG + Intergenic
1116159460 14:41250623-41250645 ACACACACACACACAACTCAGGG - Intergenic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1116375257 14:44191177-44191199 ACACACACACATATATATCATGG - Intergenic
1116401563 14:44514066-44514088 ATGCAGACACACACAAATAAAGG - Intergenic
1116460863 14:45171686-45171708 ACACACACACACACACAACATGG - Intronic
1116657731 14:47673627-47673649 ACACACACACACACACATCCAGG - Intronic
1117022506 14:51585916-51585938 ACACACACACACACATGCCATGG - Intronic
1117151830 14:52897032-52897054 ACACACACACACACACACCATGG + Intronic
1117187843 14:53260130-53260152 ACACATACACACACACATCTTGG + Intergenic
1117192742 14:53309147-53309169 ACACACACACACACACACCATGG - Intergenic
1117486019 14:56197931-56197953 ACACACACACACACACACCAGGG + Intronic
1117760662 14:59024671-59024693 ATGCATGCACACACATCTAAAGG + Intergenic
1117798362 14:59417879-59417901 ACACAGACACACACAGACCAAGG + Intergenic
1118117724 14:62799731-62799753 ACACACACACACACATATCAGGG + Intronic
1118366696 14:65102475-65102497 ACTCACACACACACACAACACGG + Intronic
1118658950 14:67986004-67986026 ACACACACACACACAAATCAAGG - Intronic
1118664437 14:68051867-68051889 ACACACACACACACATATGTGGG - Intronic
1118827053 14:69393446-69393468 ATGCATGCACACACATCCCATGG + Intronic
1119683135 14:76607758-76607780 ACGTGTGCACACACATGTCAGGG + Intergenic
1119884722 14:78130595-78130617 TCACACACACACACAAATCAAGG - Intergenic
1120000098 14:79293096-79293118 ACCAATACACACACATAAAATGG - Intronic
1120055768 14:79922380-79922402 ACACACACACACACACACCATGG - Intergenic
1120156307 14:81096919-81096941 ACACACACACACACACACCAGGG - Intronic
1120216514 14:81686413-81686435 ACACACACACACACAAACCATGG + Intergenic
1120236186 14:81893972-81893994 ACACACACACACACACACCATGG + Intergenic
1120273772 14:82347433-82347455 ACACATACACACACACATATGGG + Intergenic
1120401612 14:84039656-84039678 ATGCATACACACAAATTTCCAGG + Intergenic
1120450496 14:84660535-84660557 ACACACACACACACAGAGCATGG - Intergenic
1120761266 14:88287670-88287692 ACACACACACACACACACCATGG - Intronic
1120885427 14:89448279-89448301 ACGCCCACACACACAGGTCAAGG + Intronic
1120925937 14:89797072-89797094 ATACATACACACACATATATGGG - Exonic
1121281604 14:92703049-92703071 ACACACACACACACAGGTCAGGG - Intergenic
1122161620 14:99788624-99788646 ACACACACACACACATATTAGGG - Intronic
1122751636 14:103938375-103938397 ACACACACACACACATATATGGG - Intronic
1202831193 14_GL000009v2_random:33163-33185 AAACATACACACACTTATTAAGG + Intergenic
1123989041 15:25669671-25669693 ACACACACACACACACACCATGG - Intergenic
1124028475 15:25988596-25988618 ACACACACACACACAAAACAAGG - Intergenic
1124108467 15:26763622-26763644 ACACACACACACACACACCATGG + Intronic
1125228504 15:37424756-37424778 ACACACACACACACACACCATGG - Intergenic
1125331543 15:38587491-38587513 ACGCACACACACACAAAGTATGG - Intergenic
1125614600 15:40999006-40999028 ACACACACACACACAAATAAGGG + Intronic
1126430236 15:48575827-48575849 ACACACACACACACACACCATGG + Intronic
1126524006 15:49630025-49630047 ACACACACACACACACAACATGG + Intronic
1126708218 15:51427581-51427603 ACACACACACACACATATCCTGG + Intergenic
1126954291 15:53914874-53914896 ATACATACACACACATATTTAGG - Intergenic
1127036211 15:54920441-54920463 ACACACACACACACACACCATGG - Intergenic
1127337590 15:58004686-58004708 ACACGCACACACACAAATCATGG - Intronic
1127986503 15:64076317-64076339 ACACACACACCCACATATCAGGG + Intronic
1128196648 15:65763331-65763353 TCACAGACACACACATGTCAAGG - Intronic
1128529411 15:68433474-68433496 ACACACACACACACACACCAGGG - Intergenic
1128700488 15:69800593-69800615 ACATATACACACACATATGTGGG + Intergenic
1128723500 15:69970713-69970735 ACACACACACACACACACCAGGG + Intergenic
1129560216 15:76558823-76558845 ATACATACACACACACACCATGG + Intronic
1130073009 15:80664933-80664955 ACACACACACACACACAGCAGGG + Intergenic
1130167106 15:81472764-81472786 ACGCACACACACACGCATCCTGG - Intergenic
1130789663 15:87140157-87140179 ACACACACACACACATATACTGG + Intergenic
1130878687 15:88036200-88036222 ACACACACACACGTATATCAAGG + Intronic
1130951814 15:88597048-88597070 ACACATACACACACAGATAGAGG + Intergenic
1131084309 15:89563251-89563273 ATACACACACACACATATAAAGG - Intergenic
1131149592 15:90038700-90038722 ACACACACACACACAGAGCAGGG - Intronic
1131365893 15:91839236-91839258 ATGCATACAGACACATATTTAGG - Intergenic
1131748506 15:95478036-95478058 ACGCATACACACATATATCCAGG - Intergenic
1132100857 15:99021949-99021971 ACACACACACACACATCACAAGG - Intergenic
1133156248 16:3879248-3879270 ACACACACACACACAAAACAAGG + Intronic
1133251255 16:4483156-4483178 ACACACACACACACACACCAGGG - Intronic
1133420310 16:5640839-5640861 ACACACACACACACACACCATGG + Intergenic
1133500962 16:6366078-6366100 ACACACACACACACATAGAATGG - Intronic
1133574157 16:7071580-7071602 ACACACACACACACATATCTGGG - Intronic
1133595042 16:7282937-7282959 ACACAAACACACACACATGATGG - Intronic
1133727311 16:8549622-8549644 ACACATACACACACACACGAAGG - Intergenic
1133811137 16:9161862-9161884 ACACACACACACACAAATTATGG - Intergenic
1134056310 16:11171976-11171998 ACACAATCACACACATACCAGGG + Intronic
1134190269 16:12115478-12115500 ACACACACACACACAAATCAAGG - Intronic
1134366896 16:13587475-13587497 ACACACACACACACATACCATGG + Intergenic
1134501002 16:14769218-14769240 ACACACACACACACATACAAAGG - Intronic
1134579581 16:15359832-15359854 ACACACACACACACATACAAAGG + Intergenic
1134715124 16:16354366-16354388 ACACACACACACACATACAAAGG - Intergenic
1134723002 16:16397727-16397749 ACACACACACACACATACAAAGG - Intergenic
1134944426 16:18314144-18314166 ACACACACACACACATACAAAGG + Intergenic
1134951691 16:18354294-18354316 ACACACACACACACATACAAAGG + Intergenic
1135091225 16:19519427-19519449 GCACATACACACACATATATAGG - Intronic
1135224572 16:20644563-20644585 ACACACACACACACACATAATGG + Intronic
1135374691 16:21935234-21935256 ACACATGCACACACAGCTCAAGG - Intergenic
1135745407 16:25012670-25012692 ACACATACACACACACATCTAGG + Intronic
1136154779 16:28375299-28375321 ACACATGCACACACAGCTCAAGG + Intergenic
1136208313 16:28739959-28739981 ACACATGCACACACAGCTCAAGG - Intergenic
1136264399 16:29106640-29106662 ACACATGCACACACAGCTCAAGG - Intergenic
1136272209 16:29155059-29155081 ACACACACACACACACACCAGGG + Intergenic
1136482386 16:30550542-30550564 ACACATACACAAACATTCCAAGG + Intronic
1137398984 16:48137861-48137883 ACACATACACTCACACATCCAGG - Intronic
1137793571 16:51195923-51195945 ACACATGCACACACACATTAAGG + Intergenic
1137868312 16:51924449-51924471 ACACATACACACACAGAGGATGG - Intergenic
1138767369 16:59620423-59620445 ACACATGCACACCCATATAAAGG - Intergenic
1138867118 16:60835248-60835270 ACACACACACACCCCTATCAAGG - Intergenic
1138984103 16:62305943-62305965 ATACATACACACACATATGAGGG - Intergenic
1139027015 16:62830761-62830783 ACACACACACACACATATTTGGG + Intergenic
1139063212 16:63280964-63280986 ACACACACACACACACACCATGG + Intergenic
1139152565 16:64400883-64400905 ATACATATACACACACATCAAGG - Intergenic
1139296108 16:65902405-65902427 ACACACACACACACATATGCAGG + Intergenic
1139389940 16:66601076-66601098 ACACACACACACACAAACCATGG - Intergenic
1139739224 16:69020887-69020909 ACACATACATACATATATAAAGG - Intronic
1140155952 16:72426935-72426957 ATGCATATACACACATATGTAGG + Intergenic
1140225125 16:73070956-73070978 ACACACACACACACACATCTGGG + Intergenic
1140567231 16:76058398-76058420 ACACACACACACACAAACCATGG - Intergenic
1140609951 16:76586052-76586074 ACACACACACACACATATTGTGG - Intronic
1141030366 16:80582425-80582447 ACACACACACACACACACCAAGG + Intergenic
1142075786 16:88116975-88116997 ACACACACACACACACACCAGGG + Intronic
1142867840 17:2801590-2801612 ACACACACACACACATACCCTGG - Intronic
1143255681 17:5556146-5556168 ACACACACACACACACATGAAGG + Intronic
1143603725 17:7968098-7968120 ACACACACACACACATATTTTGG + Intergenic
1144069509 17:11655347-11655369 ACACACACACACACACACCATGG - Intronic
1144125037 17:12195383-12195405 ACACCTACACACACATACCTAGG - Intergenic
1144335698 17:14267266-14267288 GCGCACACACACACATGACAAGG - Intergenic
1144510777 17:15874122-15874144 ACACACACACACACACACCATGG + Intergenic
1145261901 17:21359565-21359587 ACACATACACACACACATGCAGG - Intergenic
1145376494 17:22354089-22354111 ACACACACACACACACATAAAGG + Intergenic
1146321708 17:31851917-31851939 ACAAACACACACACATTTCAAGG + Exonic
1146574954 17:33982834-33982856 ACACATACACACATATATTGAGG - Intronic
1146644171 17:34565616-34565638 ACGTAGACACACACAGACCAAGG - Intergenic
1146737945 17:35255436-35255458 ACGCATACACACACATATCATGG - Intronic
1146915328 17:36674701-36674723 ACACACACACACACACACCATGG + Intergenic
1146979811 17:37150110-37150132 ACACACACACACAAATTTCATGG + Intronic
1147229483 17:39006913-39006935 ACACACACACACACACACCAGGG + Intergenic
1147698931 17:42379465-42379487 ACGCACACACACAGATGTGAGGG + Intronic
1148253343 17:46105879-46105901 ACACACACACACACAGAGCAAGG + Intronic
1148595617 17:48852862-48852884 ACACATGCACACACACACCATGG - Intronic
1149034792 17:52121686-52121708 ACACACACACACACACACCAGGG + Intronic
1149045817 17:52244183-52244205 ACACATACACGTACATACCAGGG + Intergenic
1149048439 17:52275464-52275486 ACACATACACACACACATCCGGG - Intergenic
1149075444 17:52592618-52592640 ACACACACACACAAATAACATGG - Intergenic
1149940759 17:60863250-60863272 AGGCATACACAAATATTTCAAGG - Intronic
1150152832 17:62824582-62824604 ACACACACACACACATATAGAGG - Intergenic
1150489235 17:65562975-65562997 ACACACACACACACACATAAAGG + Intronic
1150528906 17:65956418-65956440 ACACACACACACACACACCATGG + Intronic
1150766522 17:68006621-68006643 ACACACACACACACACACCACGG + Intergenic
1150975508 17:70081799-70081821 ACACACACACACACAGAGCATGG - Intronic
1151116574 17:71742388-71742410 ACACACACACACACACACCATGG + Intergenic
1151480062 17:74365101-74365123 ACACACACACACACATATATTGG + Intergenic
1151788231 17:76287072-76287094 ACACACACACACACACATGATGG + Intronic
1153350813 18:4079319-4079341 ACACACACACACACACACCATGG + Intronic
1153472031 18:5457549-5457571 ACACACACACACAGATCTCAGGG + Intronic
1154419918 18:14219241-14219263 AAACATACACACACTTATTAAGG + Intergenic
1154988716 18:21579826-21579848 ACACACACACACACACAGCAGGG + Intronic
1155881961 18:31160865-31160887 ACACATACACATACATATATAGG - Intronic
1156058581 18:33044040-33044062 ACACACACACACACATATGCTGG - Intronic
1156261007 18:35445022-35445044 ACACACACACACACACACCATGG - Intronic
1156385420 18:36600295-36600317 ACACATACACACACACATTGTGG + Intronic
1156563296 18:38154144-38154166 ACACACACACACACACATCCAGG - Intergenic
1156581225 18:38378413-38378435 ACACACACACACACATATGCTGG - Intergenic
1156722511 18:40087449-40087471 ACACACACACACACACATCAGGG - Intergenic
1156790470 18:40966838-40966860 ACACACACACACACACACCATGG - Intergenic
1157013972 18:43687153-43687175 ACACACACACACACACACCATGG + Intergenic
1157065060 18:44339983-44340005 ACACACACACACACACACCATGG - Intergenic
1157312704 18:46564120-46564142 ACGCACACACGCACACATGAGGG + Intronic
1157436557 18:47674984-47675006 AGGCATACACACAAAGGTCAGGG - Intergenic
1157508016 18:48245106-48245128 ACACACACACACACACACCATGG + Intronic
1157922001 18:51722764-51722786 ACACACACACACACATATTTTGG - Intergenic
1158003097 18:52642104-52642126 ACACATACACACATATACGATGG + Intronic
1158037279 18:53048482-53048504 ACACACACACACACAAACCATGG - Intronic
1158238189 18:55343862-55343884 ACGCGTGCACACACACATCCGGG + Intronic
1158300324 18:56044683-56044705 ACACACACACACACACATTAAGG - Intergenic
1158518625 18:58151618-58151640 ACACACACACACACATATCCAGG - Intronic
1158647749 18:59263029-59263051 ACACACACACACACACACCATGG - Intergenic
1158822129 18:61172444-61172466 ACACACACACACATATATCATGG + Intergenic
1158968019 18:62640073-62640095 ACACACACACACACACACCATGG + Intergenic
1159027566 18:63199948-63199970 ACGCACACACACACACACGAAGG + Intronic
1159027982 18:63203698-63203720 ACACATACACACACATAATGGGG + Intronic
1159070373 18:63616290-63616312 ATATATACACACACATATCTAGG + Intergenic
1159136565 18:64343675-64343697 ACACACACACACACATATATAGG + Intergenic
1159148233 18:64482644-64482666 ACACACACACACACACATCATGG - Intergenic
1159191731 18:65054376-65054398 ACACACACACACACGTATCTTGG + Intergenic
1159252403 18:65896719-65896741 ACACATACACACACATCTTAAGG + Intergenic
1159265879 18:66078043-66078065 ACACACAAACACACATATTATGG - Intergenic
1159589447 18:70317415-70317437 ACACACACACACACACACCATGG - Intronic
1159612413 18:70540558-70540580 ACACATATACACACACACCATGG - Intergenic
1159686533 18:71428127-71428149 ACACACACACACACACACCATGG - Intergenic
1159686546 18:71428350-71428372 ACACACACACACACACACCATGG - Intergenic
1159686560 18:71428554-71428576 ACACACACACACACACACCATGG - Intergenic
1159853079 18:73549961-73549983 ACACACACACACACAAATGATGG + Intergenic
1159887859 18:73926643-73926665 ACACACACACACACACACCAAGG - Intergenic
1160126411 18:76176575-76176597 ACACACACAGACACACATCATGG - Intergenic
1160180289 18:76628743-76628765 ACACACACACACACACACCATGG - Intergenic
1160486190 18:79295112-79295134 ACACACACACACACACAGCAAGG + Intronic
1160517835 18:79488245-79488267 CCGCAAACACACACACACCAGGG - Intronic
1160523406 18:79521816-79521838 ACACACAGACACACACATCAGGG - Intronic
1161967756 19:7557877-7557899 ACACGTCCACACACACATCAGGG + Intronic
1162005765 19:7777949-7777971 ACACACACACACACAGGTCAGGG + Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162553718 19:11373557-11373579 ACACACACACACACACACCATGG - Intergenic
1162711973 19:12602114-12602136 ACACACACACACACATATATGGG + Intronic
1162791774 19:13066718-13066740 ACACATGCACACACACATCCTGG - Intronic
1163137340 19:15322022-15322044 ATACACACACACACAAATCAAGG + Intronic
1163271887 19:16259441-16259463 ACACACACACACACACAACAGGG + Intergenic
1163781121 19:19249038-19249060 ACACACACACACACAAATGAAGG - Intronic
1164069755 19:21756496-21756518 ACACACACACACAAATATCGAGG + Intronic
1164124140 19:22295029-22295051 ACACACACACACAAATATCTAGG - Intronic
1164422877 19:28112586-28112608 ACACACACACACACACACCATGG + Intergenic
1164516359 19:28939706-28939728 ACACACACACACACACACCATGG + Intergenic
1164702303 19:30294542-30294564 ACACACACACACACATATTGGGG - Intronic
1164872968 19:31662042-31662064 ACACACACACACACATATAATGG + Intergenic
1165467440 19:35983406-35983428 ACACACACACACACATATCGGGG + Intergenic
1165537158 19:36458255-36458277 ACACATATACACACACATAATGG + Intronic
1165992304 19:39823603-39823625 ACACACACACACACACATCCTGG + Intergenic
1166617657 19:44265393-44265415 ACACACACACACACACACCACGG + Intronic
1167112463 19:47470371-47470393 ACACACACACACACACACCAGGG + Intronic
1167150034 19:47702965-47702987 ACACACACACACACAGGTCACGG - Exonic
1167467972 19:49660096-49660118 ACACACACACACACACGTCAGGG + Intronic
1167617472 19:50543331-50543353 ACACACACACACACACACCAGGG - Intronic
1167662810 19:50805808-50805830 ACACACACACACACATATTATGG + Intergenic
1167671682 19:50857217-50857239 CCTCATACCCACACACATCAGGG - Intronic
1167936916 19:52916519-52916541 ACATATACACACACATATATAGG - Intergenic
1168178858 19:54645865-54645887 ACACACACACACACACACCATGG + Intronic
1168387064 19:55972786-55972808 ACACACACACACACACACCATGG - Intronic
1168467156 19:56612407-56612429 ATACATACACACACATACCATGG + Intronic
1202641497 1_KI270706v1_random:94593-94615 AAACATACACACACTTATTAAGG - Intergenic
924976254 2:178555-178577 ACACACACACACACACACCATGG + Intergenic
925156594 2:1652923-1652945 ACACACACACACACAGAGCACGG - Intronic
925465036 2:4099560-4099582 ACACATACACACACATACAGAGG + Intergenic
925620223 2:5784944-5784966 ACACACACACACACATTTTATGG - Intergenic
925681899 2:6431338-6431360 ACACACACACATATATATCATGG + Intergenic
925706523 2:6689295-6689317 ACACACACACACACACACCATGG - Intergenic
925729484 2:6908079-6908101 ACACACACACACACAAAACATGG + Intergenic
925768905 2:7263517-7263539 ACACACACACACACACATAATGG + Intergenic
926458760 2:13101483-13101505 ACACACACACACACACACCAAGG - Intergenic
926823063 2:16874748-16874770 ACACACACACACACACATCATGG + Intergenic
926966446 2:18418961-18418983 ACACACACACACACACACCAAGG - Intergenic
927011226 2:18906620-18906642 ACACACACACACACACATCTTGG - Intergenic
927080324 2:19621993-19622015 ACACACACACACACACACCATGG + Intergenic
927140823 2:20129686-20129708 ACACACACACACACACATGAGGG - Intergenic
927388621 2:22566351-22566373 ACTCACACACACACATATATGGG + Intergenic
927653311 2:24925222-24925244 ACTCATACACACAAATGTGAAGG - Intergenic
928050187 2:27985052-27985074 ACACACACACACACACATCATGG - Intronic
928498179 2:31857270-31857292 ACACACACACACACATATCAGGG + Intergenic
928711100 2:34006342-34006364 ACACACACACACACACACCATGG - Intergenic
929004285 2:37380402-37380424 ACACACAAACACACACATCATGG - Intergenic
929237582 2:39622974-39622996 ACACACACACACACACACCAGGG + Intergenic
929244995 2:39691879-39691901 AAGCATACACACATATATAATGG + Intronic
929370253 2:41214687-41214709 ACACACACACACACACACCATGG - Intergenic
929446399 2:42004744-42004766 ACACACACACACACACATAATGG - Intergenic
929592279 2:43155071-43155093 ACACACACACACACATACAATGG + Intergenic
929639734 2:43565766-43565788 ACACATATACACACATATACAGG + Intronic
929730154 2:44480994-44481016 ACACACACACACACATAATATGG - Intronic
929896865 2:45968251-45968273 ACACACACACACACACACCATGG + Intronic
930153602 2:48082489-48082511 ACACATACACACATATCTCAGGG + Intergenic
930287316 2:49447040-49447062 ACACATACACACACACACAATGG + Intergenic
930316790 2:49806522-49806544 ACACACACACACACACACCATGG + Intergenic
930399984 2:50872109-50872131 ATGCATACACACACATAAAGGGG - Intronic
930436377 2:51348697-51348719 ACGCACACACACACACCTCATGG + Intergenic
930450000 2:51523713-51523735 ACACACACACACACATACAAAGG - Intergenic
930475227 2:51873606-51873628 ACACAGACACACACACACCAAGG + Intergenic
930558723 2:52932379-52932401 ACACACACACACACATATAGAGG + Intergenic
930650989 2:53965107-53965129 ACACACACACACACGAATCATGG + Intronic
930712556 2:54562689-54562711 ACACACACACACACAAAGCAGGG - Intronic
930777163 2:55184581-55184603 ACATTTACACACACATATGATGG + Intronic
930968745 2:57367835-57367857 AAACATACACACACATAAGAAGG + Intergenic
930984165 2:57564582-57564604 ACACACACACACCCCTATCATGG - Intergenic
931078986 2:58747720-58747742 ATATATACACACACATATTAGGG - Intergenic
931369177 2:61646353-61646375 ACACACACACACACACATAATGG + Intergenic
931835170 2:66091589-66091611 ACACACACACACACACACCATGG + Intergenic
931861611 2:66360539-66360561 ACACACACACACATATACCATGG - Intergenic
931890835 2:66670257-66670279 CCACATACACACACATGTCCTGG + Intergenic
932073104 2:68640613-68640635 ACGCACACACATACACATGAAGG + Intergenic
932459251 2:71871913-71871935 ACACACACACACACACTTCATGG + Intergenic
933309254 2:80639508-80639530 ACACACACACACACACATCAAGG - Intronic
933433040 2:82209351-82209373 ACACACACACACACATACCGTGG - Intergenic
933442450 2:82330396-82330418 ACACACACACACACACATCATGG - Intergenic
933489289 2:82965088-82965110 ACACACACACACACACATCATGG + Intergenic
933490597 2:82981818-82981840 ACACACACACACATATATAAAGG + Intergenic
933518113 2:83331761-83331783 ACACACACACACACACATCAGGG - Intergenic
933539218 2:83617515-83617537 ACACACAGACACACATATCCTGG - Intergenic
933549154 2:83752832-83752854 ATGCACAAACACACATACCAGGG - Intergenic
933554688 2:83817421-83817443 ACACACACACACACACACCATGG - Intergenic
933817236 2:86077841-86077863 ACACACACACACACACACCATGG + Exonic
934110908 2:88741418-88741440 ACACATACACACACACACCATGG - Intronic
934155234 2:89193151-89193173 ACACACACACACACACACCATGG + Intergenic
934325516 2:92010550-92010572 ACACGCACACACACATATTATGG - Intergenic
934497320 2:94818011-94818033 AAACATACACACACTTATTAAGG - Intergenic
935152890 2:100454191-100454213 ACACATACACACACACACCTTGG - Intergenic
935378632 2:102426062-102426084 ACACATACACATGCATATAAAGG + Intronic
935381842 2:102460701-102460723 ACACACACACACACACACCATGG + Intergenic
935440130 2:103083707-103083729 ACACATACACACACATACACAGG + Intergenic
935534132 2:104273533-104273555 ACGCATTCACACACATACACAGG + Intergenic
935808229 2:106770078-106770100 ACGGATTCACACACATACCTTGG - Intergenic
936149299 2:110004398-110004420 ACACACACACACAAATACCAAGG - Intergenic
936195381 2:110366971-110366993 ACACACACACACAAATACCAAGG + Intergenic
936510473 2:113141192-113141214 AAGCACACAAACACATAGCATGG - Intergenic
936705222 2:115064563-115064585 ACCCCTACACACACATATTTCGG + Intronic
937009121 2:118545835-118545857 ACACATACAAATGCATATCAGGG + Intergenic
937099976 2:119261151-119261173 ACACACACACACACACACCAGGG + Intronic
937149766 2:119678508-119678530 ACACACACACACACACATCCCGG - Intergenic
937149775 2:119678600-119678622 ACACACACACACACATACCCTGG - Intergenic
937173645 2:119903571-119903593 ACACACACACACACCTTTCAGGG + Intronic
937553305 2:123122280-123122302 ACGCATACACACACACACCATGG + Intergenic
937700261 2:124856071-124856093 ACACACACACACACACACCATGG - Intronic
937761990 2:125615850-125615872 ACACACACACATACATACCATGG + Intergenic
938700096 2:133869736-133869758 ACACACACACACACACACCATGG + Intergenic
939059256 2:137400309-137400331 ATGCAAACACACAAAAATCATGG - Intronic
939274346 2:139981055-139981077 ATGCATACACACACATATAATGG - Intergenic
939333499 2:140794507-140794529 ACACACACACACATATTTCAAGG + Intronic
939512081 2:143119765-143119787 ACACATACACACACAAATGATGG - Intronic
939560333 2:143724046-143724068 ACACACACACACACACATGAAGG - Intronic
939633849 2:144557569-144557591 ACACACACACACACACACCATGG - Intergenic
939944221 2:148389182-148389204 ACACACACACACACACACCACGG - Intronic
939988301 2:148853935-148853957 ACACACACACACACACACCATGG - Intergenic
940064673 2:149613985-149614007 ACACACACACACACATACAAGGG - Intergenic
940112823 2:150172679-150172701 ACACACACACGCACATATCTAGG + Intergenic
940193399 2:151066257-151066279 ATGCATACACACACATCTTGAGG + Intergenic
940282516 2:152002279-152002301 ACATATACACACACATGTGATGG + Intronic
940400339 2:153241640-153241662 ACACATACACACACAGAACTTGG - Intergenic
940549088 2:155129136-155129158 AGACACACACAGACATATCATGG + Intergenic
940549522 2:155135411-155135433 ACACACACACACACCTATCAGGG + Intergenic
940581202 2:155583658-155583680 ACACACACACACACACACCATGG - Intergenic
940615375 2:156042664-156042686 ACACACACACACACATATCTAGG + Intergenic
940724607 2:157322258-157322280 ACACACACACACACACCTCAAGG + Intronic
940808274 2:158212734-158212756 ACACATACATACACATAACTGGG + Intronic
940856341 2:158731191-158731213 ACACATACACACACACATTCTGG - Intergenic
941051988 2:160745444-160745466 ACGCATACACACACACCTGCTGG - Intergenic
941549941 2:166902589-166902611 ACACACACACACACAAATCATGG - Intronic
941631144 2:167885479-167885501 ATACACACACACACATATGAAGG - Intergenic
942223527 2:173794432-173794454 ACACACACACACACATATCTTGG + Intergenic
942354635 2:175096412-175096434 ACACATATACACACATATGTAGG - Intronic
942573687 2:177339761-177339783 ACACATACACACACATACACTGG - Intronic
942744008 2:179211637-179211659 ACACACACACAAACACATCATGG + Intronic
942888200 2:180954720-180954742 ACACACACACACACACATAAGGG - Intergenic
942960395 2:181823476-181823498 ATACACACACACACATATCTTGG - Intergenic
943136608 2:183921180-183921202 ACACACACACACACATCTCTAGG + Intergenic
943222298 2:185125127-185125149 ACACACACACACACATTTGATGG - Intergenic
943246496 2:185458417-185458439 ATGCATAGACACACACATCTGGG - Intergenic
943262089 2:185679016-185679038 ACACACACACACACACATCTTGG + Intergenic
943549890 2:189325504-189325526 ACACATACACACACACATTCAGG + Intergenic
943818194 2:192282999-192283021 ACACACACACACACACACCATGG - Intergenic
943818198 2:192283185-192283207 ACACACACACACACACACCATGG + Intergenic
943870310 2:192987815-192987837 ACACACACACACACATATCTAGG - Intergenic
944085808 2:195846942-195846964 ACACACACACACACATATATGGG - Intronic
944091921 2:195921377-195921399 ACACACACACACACACACCATGG + Intronic
944145861 2:196506547-196506569 ACACATACACACTTATTTCATGG + Intronic
944199667 2:197092443-197092465 ACACATTCACAGACATTTCATGG + Intronic
944388286 2:199189030-199189052 ACACACACACACACACATAAAGG + Intergenic
944395343 2:199260255-199260277 ACACACACACACACATTGCAAGG + Intergenic
944400757 2:199323497-199323519 ACACACACACACATATATAAAGG + Intronic
944647261 2:201792276-201792298 ACACATACACACACACAGGATGG - Intronic
944836660 2:203587116-203587138 ACACACACACACTCACATCAAGG + Intergenic
945543245 2:211115641-211115663 ACACACACACACACATATATAGG + Intergenic
945739504 2:213643030-213643052 ACACACACACATACATATAAAGG - Intronic
945815766 2:214603366-214603388 ACACACACACACACACACCAGGG + Intergenic
945911067 2:215649841-215649863 ACACACACACACACACATCATGG - Intergenic
946075401 2:217069750-217069772 ACACATACCCATACATACCATGG - Intergenic
946154008 2:217795201-217795223 ACGCAGACACACATATACCCAGG - Intergenic
946646333 2:221839073-221839095 ACACACACACACACATATACAGG + Intergenic
946656720 2:221956219-221956241 ACACACACACACACATATTTTGG - Intergenic
946769322 2:223072261-223072283 ACACACACACACACACACCATGG - Intronic
947461526 2:230308021-230308043 ACACACACACACACACACCATGG + Intronic
947641886 2:231711494-231711516 ACACATACACACACATATATAGG - Intronic
947803491 2:232948140-232948162 ACACACACACACACATCTCCAGG - Intronic
947826691 2:233110521-233110543 ATGCACACACACACAAAGCAGGG - Intronic
947916640 2:233836520-233836542 ACGCACACACACACATAACATGG + Intronic
948087274 2:235262026-235262048 ACGGAAACACACACAAAACAAGG - Intergenic
948094999 2:235326428-235326450 ACACACACACACACACAACATGG + Intergenic
948188324 2:236038812-236038834 ACACACACACACACATACAAAGG - Intronic
948424810 2:237880483-237880505 ACACATACGCACATATATCTTGG - Intronic
1168813318 20:720302-720324 ACACATACACACACACACCCTGG + Intergenic
1168977488 20:1978613-1978635 ACACACACACACACATATTCAGG - Intergenic
1169083323 20:2811116-2811138 ACACACACACACACACACCATGG - Intergenic
1169171758 20:3471056-3471078 ACACATACACACACACCGCACGG - Exonic
1169374132 20:5052752-5052774 ACACACACACACACAAATAAAGG - Intergenic
1169407448 20:5334318-5334340 ACACACACACACACACACCATGG - Intergenic
1169644214 20:7791105-7791127 ACACACATACACACATATAAGGG + Intergenic
1170147644 20:13194536-13194558 ACACACACACACACATTTCTTGG - Intergenic
1170200466 20:13738068-13738090 ACACATTCACTCACATAACAGGG + Intronic
1170339865 20:15312816-15312838 ATATATACACACACATATAATGG - Intronic
1170435764 20:16327085-16327107 ACACACACACACACACACCATGG + Intronic
1170444373 20:16410369-16410391 ATACATACACACACATATACAGG + Intronic
1170535397 20:17335853-17335875 ACACACACACACACACACCATGG - Intronic
1170726425 20:18931493-18931515 ACACACACACACACACACCATGG - Intergenic
1171139249 20:22726886-22726908 ACACATACACACACACATACAGG - Intergenic
1171358069 20:24565925-24565947 ACACACACACACACAAATAATGG - Intronic
1171799842 20:29601840-29601862 ACACACACACACACACATAAAGG + Intergenic
1171983149 20:31640979-31641001 ACACACACACACACACATCTTGG + Intronic
1172272259 20:33661297-33661319 ACACACACACACACGCATCAGGG + Intronic
1172330518 20:34073172-34073194 ACACATACATTCACATATCCAGG - Intronic
1173005351 20:39135793-39135815 ACACACACACACACATAGAAAGG - Intergenic
1173130947 20:40392786-40392808 ACACATACACACACATAGGTAGG - Intergenic
1173191358 20:40878700-40878722 ACACACACACACACACACCATGG + Intergenic
1173908814 20:46648951-46648973 ACACACACACACACACATAAAGG + Intronic
1174047928 20:47747019-47747041 ACACACACACACACATAAAAAGG + Intronic
1174713428 20:52731147-52731169 ACACACACACACACACATCCTGG - Intergenic
1174857052 20:54056239-54056261 ACACACACACACACACACCATGG + Intronic
1175436492 20:58954789-58954811 ACACACACACACGCATACCATGG + Intergenic
1175666480 20:60864458-60864480 ACACACACACACACAGACCAAGG + Intergenic
1176388692 21:6152339-6152361 ACAGATACACACACACGTCAGGG + Intergenic
1176610381 21:8877993-8878015 AAACATACACACACTTATTAAGG + Intergenic
1176853375 21:13940077-13940099 AAACATACACACACTTATTAAGG - Intergenic
1176978979 21:15357327-15357349 ACACACACACACACACACCATGG + Intergenic
1176988992 21:15471670-15471692 ACACACACACACACATTCCAAGG + Intergenic
1177274106 21:18884520-18884542 ACACACACACACACACACCATGG - Intergenic
1177399717 21:20587207-20587229 ACACACACACACATATATCCAGG + Intergenic
1177399799 21:20587997-20588019 ACACACACACACACATACCCAGG + Intergenic
1177399856 21:20588387-20588409 ACACACACACACACACACCAGGG + Intergenic
1177552240 21:22639343-22639365 ACACACACACACACAAATCCAGG + Intergenic
1177708620 21:24741143-24741165 ACACACACACACACACACCATGG - Intergenic
1177874987 21:26620903-26620925 ACGCATGCACACACACCTCCTGG - Intergenic
1178164308 21:29954733-29954755 ACACAAACACACACACATCCTGG - Intergenic
1178923156 21:36753156-36753178 ACGCACGCACACACATATGCGGG + Exonic
1179229920 21:39492439-39492461 ACACACACACACACACACCAAGG - Intronic
1179734780 21:43385909-43385931 ACAGATACACACACACGTCAGGG - Intergenic
1179766599 21:43578342-43578364 ACACACACACACACATCTCTAGG - Intronic
1179779869 21:43692703-43692725 ACGCACACACACATATATACTGG - Intronic
1180360454 22:11887281-11887303 AAACATACACACACTTATTAAGG + Intergenic
1180585020 22:16880329-16880351 ACGCACACACACACACATTGTGG - Intergenic
1180735586 22:18014129-18014151 ACACACACACACACATTTCTTGG + Intronic
1180917964 22:19502502-19502524 CCACATACACACACATACAAAGG + Intronic
1181366800 22:22382776-22382798 ATGTATACATACACATACCAGGG - Intergenic
1181373161 22:22433925-22433947 ATGTATACATACACATACCATGG - Intergenic
1181788789 22:25246993-25247015 ACGCATGCACACACAGATACAGG + Intergenic
1181983403 22:26782312-26782334 ACGCACACACACACACACCTTGG - Intergenic
1182120295 22:27782062-27782084 ACCATTACTCACACATATCAGGG + Intronic
1182153536 22:28048199-28048221 ACTCATTCACCCACATATCCTGG + Intronic
1182749132 22:32627730-32627752 ACACACACACACACATATGCAGG + Intronic
1182885184 22:33767774-33767796 ACACAAACACACACATATATGGG + Intronic
1183153974 22:36060119-36060141 ACACACACACACATATATGATGG + Intergenic
1184162124 22:42703052-42703074 ACACACACACACACACAGCAGGG - Intronic
1184368180 22:44065838-44065860 ATGCACACACACACACACCATGG - Intronic
1184442861 22:44529074-44529096 ACACACACACACACACGTCAGGG + Intergenic
1184820612 22:46906772-46906794 ACACACACACACACAGTTCAGGG - Intronic
1185121173 22:48972334-48972356 ACACACACACACACACACCATGG + Intergenic
1185164713 22:49254440-49254462 ACACACACACACACACATAAAGG + Intergenic
1185385351 22:50529337-50529359 ACGCGTACCCCCACATACCAGGG - Exonic
949108429 3:228487-228509 ACACACACACACACACAGCAGGG + Intronic
949188675 3:1224687-1224709 ACACAAACACACACATATTACGG + Intronic
949641401 3:6039054-6039076 ACACACACACACACATTTAAAGG + Intergenic
949676835 3:6464378-6464400 ACGCACACACACACACATTTTGG + Intergenic
949678221 3:6482457-6482479 ACACACACACACAAATATAAAGG + Intergenic
949772155 3:7590745-7590767 CAGCCTACAGACACATATCATGG + Intronic
950117023 3:10457631-10457653 ACACAGACACTCACACATCATGG - Intronic
950342054 3:12256224-12256246 ACACATACACACACACACCATGG - Intergenic
951167918 3:19505087-19505109 ACACACACACACACACACCATGG + Intronic
951571544 3:24068654-24068676 ACACATACACACACAGAAAAAGG + Intergenic
951823494 3:26841081-26841103 ACACACACACACACAAATCGGGG - Intergenic
952227853 3:31397397-31397419 ACACACACACACACACATCATGG + Intergenic
952320512 3:32273309-32273331 ACACATACATACACATATCTTGG - Intronic
952499614 3:33948441-33948463 ACGCACACACACACATGTGTGGG + Intergenic
952592806 3:34977735-34977757 AGGTATACACACACACACCATGG - Intergenic
952714415 3:36464807-36464829 ACACACACACACACACACCATGG - Intronic
953197463 3:40747702-40747724 ACACACACACACACACACCAGGG - Intergenic
953234276 3:41092622-41092644 ACACACACACACGCATATAATGG - Intergenic
953835638 3:46340797-46340819 ACACACACACACACACACCATGG + Intergenic
955120128 3:56049809-56049831 ACACACACACACATATATGATGG - Intronic
955429261 3:58825541-58825563 ACACACACACACACACAACATGG + Intronic
955450326 3:59059193-59059215 ACACACACACACACATACCATGG - Intergenic
955844866 3:63151913-63151935 ACACATACACACACAAGTCATGG - Intergenic
955863841 3:63360885-63360907 ACGCAAACACACACACATCATGG - Intronic
956005141 3:64770676-64770698 ACACACACACACACACACCAGGG - Intergenic
956123928 3:65993755-65993777 ACTCACACACACACATAGCTTGG + Intronic
956377393 3:68629442-68629464 ACATATATACACACATACCATGG - Intergenic
956676767 3:71741200-71741222 ACACACACACACACACATCCTGG + Intronic
956950727 3:74279423-74279445 ACAAACACACACACATATGATGG + Intronic
956995189 3:74818964-74818986 ACGCACACACACACACACAATGG - Intergenic
957198394 3:77100156-77100178 ACACACACACACAAAAATCATGG - Intronic
957278621 3:78121523-78121545 ACACACACACACACATATATAGG - Intergenic
957428099 3:80065947-80065969 ACACACACACACACACACCACGG - Intergenic
957656664 3:83086963-83086985 ACGTATACATACACACATAAAGG - Intergenic
957691236 3:83573105-83573127 ACACACACACACACACACCATGG + Intergenic
957711639 3:83867522-83867544 ACACACACACACACACACCAGGG + Intergenic
958587038 3:96100743-96100765 ACACACACACACACACACCATGG - Intergenic
958853105 3:99352643-99352665 CCACATACACACGCAGATCAAGG - Intergenic
958979123 3:100699698-100699720 ACACACACACACACACACCATGG + Intergenic
959365006 3:105446635-105446657 ACACACACACACACACATAATGG + Intronic
959377123 3:105601124-105601146 ACACACACACACACTTATAAAGG + Intergenic
959727798 3:109563630-109563652 ACGTATAAACACATAGATCAAGG - Intergenic
959867559 3:111288555-111288577 ACACACACACACACACACCATGG - Intergenic
959900643 3:111657767-111657789 ACATATACACACACATATTGTGG - Intronic
960338188 3:116444341-116444363 ACACACACACACACATATCAAGG - Intronic
960460313 3:117926159-117926181 ACACACACACACACACACCATGG + Intergenic
960468098 3:118023949-118023971 ACACACACACACACACACCATGG - Intergenic
960549236 3:118955250-118955272 ACACATACACACACACACCATGG + Intronic
960721709 3:120630864-120630886 ACACACACACACACAGATAATGG + Intronic
961021506 3:123511363-123511385 ACACATACACACACACATTATGG + Intronic
961212778 3:125138876-125138898 ACACACACACACACTTAGCAGGG + Intronic
961474693 3:127139376-127139398 ACTCATACACTCACAAAACACGG - Intergenic
961848698 3:129793173-129793195 ACACACACACACACACACCATGG + Intronic
962144517 3:132825972-132825994 ACACACACACACACATACCATGG - Intergenic
962262511 3:133922578-133922600 ATGTATACACACACACAACATGG - Intergenic
962315358 3:134355996-134356018 AAACATACAGACACACATCATGG + Exonic
962323635 3:134413345-134413367 ACACACACACACACAAATAATGG + Intergenic
962502906 3:136013153-136013175 ACACACACACACACACACCATGG - Intronic
962555123 3:136541568-136541590 ACACACACACACACACACCAGGG + Intronic
963338373 3:144003352-144003374 ACACACACACACACAGATGAGGG - Intronic
963536468 3:146535251-146535273 ACACACACACACACATATACAGG + Intronic
963668779 3:148225155-148225177 ACATATACACACACGTAACAGGG - Intergenic
963695038 3:148555908-148555930 ACACACACACACACAGAGCAAGG - Intergenic
963760458 3:149283115-149283137 ACACACACACACACACATCTTGG - Intergenic
963982247 3:151551687-151551709 ACACACACACACACATCTGAAGG + Intergenic
964006119 3:151831399-151831421 ACACACACACACACACACCATGG + Intergenic
964017791 3:151968592-151968614 ACACACACACACACACACCATGG + Intergenic
964133701 3:153319316-153319338 ACACACACACACACACACCAAGG + Intergenic
964297094 3:155245663-155245685 ACACACACACACACACATTATGG - Intergenic
964407218 3:156361447-156361469 ATATATACACACACATATCAAGG - Intronic
964471506 3:157061757-157061779 ACACACACACACACACACCATGG + Intergenic
964663787 3:159150602-159150624 ACACACACACACACATATTCTGG + Intronic
964794789 3:160485173-160485195 ACACAAACACACACATCTGAGGG + Intronic
964985294 3:162731371-162731393 ACACACACACACACATATCATGG - Intergenic
965132696 3:164722315-164722337 ACACACACACACACATGCCATGG - Intergenic
965228071 3:166017345-166017367 ACACACACACACACAAACCATGG - Intergenic
965250499 3:166337392-166337414 ATACACACACACACACATCATGG - Intergenic
965284395 3:166799635-166799657 ACACATACACACACATATATAGG - Intergenic
965340741 3:167488176-167488198 ACACACACACACACACACCATGG + Intronic
965374603 3:167907559-167907581 ACTAATACACAGACATATCCAGG + Intergenic
965477257 3:169172400-169172422 ACACACACACACACATACAAGGG - Intronic
965727623 3:171735888-171735910 ATGCATACACGCACATATGTTGG - Intronic
965869098 3:173245030-173245052 ACACACACACACACACACCATGG - Intergenic
965896764 3:173586469-173586491 ACACATACACACACAAATCCAGG - Intronic
966607403 3:181834915-181834937 ACACACACACACATATATCAAGG - Intergenic
967173397 3:186841891-186841913 ACACACACACACACATACCAAGG + Intergenic
967243680 3:187465981-187466003 ACACAAACACACACACATCTTGG - Intergenic
967344628 3:188440942-188440964 ACACACACACACACATATTAAGG - Intronic
967344632 3:188441019-188441041 ACACACACACACACATATTAAGG - Intronic
967449620 3:189609439-189609461 ACGTATATAAACACATGTCATGG + Intergenic
967690180 3:192464495-192464517 ACACACACACACACACACCATGG - Intronic
967967828 3:194975889-194975911 ACACACACACACACATATCTGGG + Intergenic
968245912 3:197147454-197147476 ACACACACACACACACACCATGG + Intronic
1202737063 3_GL000221v1_random:12778-12800 AAACATACACACACTTATTAAGG + Intergenic
968776899 4:2547581-2547603 ACACACACACACACATACTAAGG - Intronic
968807015 4:2780572-2780594 ACACATACACACATATATCTTGG + Intergenic
968933076 4:3593818-3593840 ACACATACACAAACACACCAAGG - Intergenic
969030064 4:4204705-4204727 ACACACACACACACAGATGAAGG - Intronic
969565174 4:7973070-7973092 ACACACACACACACACAGCAAGG - Intronic
970153299 4:13114397-13114419 ACACACACACACACACACCATGG + Intergenic
970203760 4:13635093-13635115 ACACAGACACACACATGTTAGGG - Intergenic
970335007 4:15028372-15028394 ACACATACAAACACATGTTAAGG + Intronic
970371010 4:15406481-15406503 ACGCATACACAAACAACACAAGG + Intronic
970386878 4:15564977-15564999 ACACATACACACAAATATGTAGG - Intronic
971035405 4:22687549-22687571 ACACGTACACACACACAACACGG + Intergenic
971086223 4:23278744-23278766 ACACAGACACACACACACCATGG + Intergenic
971163865 4:24161996-24162018 ACACACACACACACACACCATGG + Intergenic
971238015 4:24861267-24861289 ACACACACACACACACACCATGG + Intronic
971511974 4:27437736-27437758 ACAGATACATACACACATCAAGG - Intergenic
971550627 4:27951514-27951536 ACACACACACACACACAACATGG + Intergenic
971615885 4:28790126-28790148 ACACACACACACAAATATCAAGG + Intergenic
971650007 4:29259346-29259368 ACACACACACACACATATGTGGG + Intergenic
971692830 4:29859431-29859453 ACACACACACACACATATCTTGG - Intergenic
971735374 4:30443042-30443064 ACACACACACACACAAAACAAGG - Intergenic
971779950 4:31020396-31020418 ACACATACACACACATAGCAAGG - Intronic
971832103 4:31708075-31708097 ACCCATTCACACACATATATGGG - Intergenic
971913631 4:32829307-32829329 ACACATGCAAACACACATCATGG + Intergenic
972103350 4:35449228-35449250 ACACATATACACACATACCATGG - Intergenic
972853738 4:43081250-43081272 ACGCGCACACACACATATCTTGG + Intergenic
972860788 4:43167306-43167328 ATACACACACACACATACCATGG - Intergenic
973203163 4:47528454-47528476 ACACACACACACACACACCATGG - Intronic
973245936 4:48011415-48011437 ACACACACACACACACATCTTGG + Intronic
973385007 4:49505120-49505142 AAACATACACACACTTATTAAGG - Intergenic
973540842 4:51934014-51934036 ACACACACACACACACATCCAGG + Intergenic
973743952 4:53945573-53945595 ACACACACACACACACACCATGG - Intronic
974240496 4:59239415-59239437 ATACACACACACACACATCATGG + Intergenic
974287217 4:59883948-59883970 ATGCACACACACACATATATTGG + Intergenic
974348789 4:60717686-60717708 ACACACACACATACATATGATGG + Intergenic
974431727 4:61806346-61806368 ACACATACACACACACACCTTGG - Intronic
974490061 4:62553172-62553194 ACGCATACAGAGAGATATAATGG - Intergenic
974737931 4:65963471-65963493 ACACACACACACACACACCATGG - Intergenic
974786734 4:66627149-66627171 ACGCACACACACATATATAGAGG - Intergenic
974790239 4:66679559-66679581 ACATACACACACACATATCATGG + Intergenic
974900995 4:67997943-67997965 TCACATATACACTCATATCAAGG + Intergenic
974935644 4:68406855-68406877 ACACATACACACACACATCTTGG - Intergenic
975053106 4:69891247-69891269 ACACACACACACACACACCATGG - Intergenic
975053122 4:69891596-69891618 ACACACACACACACACACCATGG + Intergenic
975315653 4:72950017-72950039 ACACACACACACACACACCATGG - Intergenic
976354456 4:84100642-84100664 ACACATACACACACAAAAGAGGG - Intergenic
977005547 4:91565019-91565041 ACACACACACACACAACTCAAGG - Intronic
977172900 4:93784658-93784680 ACACACACACACACACACCACGG + Intergenic
977547919 4:98407475-98407497 ACACACACACACACACAACATGG + Intronic
977705749 4:100068301-100068323 ACACAGACACAACCATATCAGGG + Intergenic
977904758 4:102464291-102464313 ACACACACACACACACACCATGG + Intergenic
978037219 4:104010034-104010056 ACACACACACACACACACCAGGG + Intergenic
978159640 4:105530181-105530203 ACCCAAACACACACATACCCAGG - Intergenic
978323981 4:107530404-107530426 ACACACACACACACACACCATGG + Intergenic
978671580 4:111253976-111253998 ACACACACACACACACATAATGG + Intergenic
978727779 4:111990288-111990310 ACACACACACACACACAGCAAGG + Intergenic
979006890 4:115310300-115310322 ACACACACACACACATATATAGG + Intergenic
979043115 4:115825112-115825134 ACACACACACACACACACCATGG - Intergenic
979098999 4:116591166-116591188 ACACACACACACACACACCATGG - Intergenic
979809253 4:125014683-125014705 ACACACACACACACATATAAAGG - Intergenic
979887530 4:126048051-126048073 ACACACACACACACACACCACGG + Intergenic
980267653 4:130539721-130539743 ACACACACACACACATTTGAAGG - Intergenic
980544271 4:134237684-134237706 ACACACACACACACACACCACGG - Intergenic
980679304 4:136136431-136136453 ACACACACACACACAAAGCATGG - Intergenic
980697172 4:136374465-136374487 ACACACACACACACAAATCCTGG + Intergenic
980743344 4:136980762-136980784 ACACATACACATGCATATCAAGG + Intergenic
980830324 4:138123769-138123791 ACGCAAACACACACAGGTCAGGG + Intergenic
980840551 4:138255810-138255832 ACACACACACACACATATTCTGG - Intergenic
980845257 4:138316467-138316489 ACACACACACACACACACCATGG - Intergenic
981224518 4:142277691-142277713 ACACACACACACACACACCATGG + Intronic
981424481 4:144587564-144587586 ACACACACACACACAGATAATGG - Intergenic
982419110 4:155173039-155173061 ATATATACACACACATACCATGG - Intergenic
982475538 4:155845287-155845309 ACACATACACACACACATCTTGG - Intronic
982830238 4:160050419-160050441 ACACACACACACACACATAATGG + Intergenic
982851681 4:160325430-160325452 ACACACACACACACACATAAAGG + Intergenic
982983512 4:162172428-162172450 ACACACACACACATATATGACGG - Intergenic
983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG + Intergenic
983175178 4:164579864-164579886 ACACACATACACACATATAAGGG + Intergenic
983432083 4:167663370-167663392 ACACACACACACACATATGGTGG + Intergenic
983777623 4:171627992-171628014 ACACACACACACACAGGTCATGG + Intergenic
983887426 4:172996172-172996194 ACACACACACACACACACCATGG + Intronic
983909330 4:173219329-173219351 ACACACACACACACACACCATGG - Intronic
983909331 4:173219352-173219374 ATACATACACATACATACCACGG + Intronic
984325363 4:178243209-178243231 ACACACACACACACACACCATGG - Intergenic
984894223 4:184522351-184522373 TCACATACACATACATAGCAGGG + Intergenic
985188224 4:187341706-187341728 ACACACACACACACACACCATGG + Intergenic
985382666 4:189412052-189412074 ACACATACACACACACAACATGG + Intergenic
1202768869 4_GL000008v2_random:180455-180477 AAACATACACACACTTATTAAGG - Intergenic
985928925 5:3040538-3040560 ACACACACACACACACATCATGG - Intergenic
986270525 5:6226886-6226908 ACAGATACACATACATATCCTGG + Intergenic
986365936 5:7031658-7031680 ACACACACACACACACATCTTGG + Intergenic
986632825 5:9791204-9791226 ACACACACACACACGGATCATGG + Intergenic
986987694 5:13517483-13517505 ACACACACACACACATATATGGG - Intergenic
987029902 5:13966196-13966218 ACACATACACACACACACCATGG - Intergenic
987042260 5:14074118-14074140 ACACATGCACACACACAACACGG + Intergenic
987105882 5:14638601-14638623 ACACACACACACACTCATCATGG - Intergenic
987125188 5:14805367-14805389 ACACATACACACATATATATAGG - Intronic
987337853 5:16912832-16912854 ACACACACACACACACACCATGG + Intronic
987453741 5:18118483-18118505 ACACACACACACACACATCTTGG - Intergenic
987477101 5:18403922-18403944 ACACACACACACACACACCATGG - Intergenic
987505126 5:18759225-18759247 ACACATACACACACACACAATGG - Intergenic
987613503 5:20241394-20241416 ACACATACACACTCACACCATGG - Intronic
987679389 5:21116113-21116135 ACACATGCACACACACATCTTGG + Intergenic
987889809 5:23863074-23863096 ACACATACACACACACACTAAGG + Intergenic
987913073 5:24175160-24175182 ACACACACACACACATATACAGG + Intronic
988031740 5:25771663-25771685 ACGCACACACACACACACAAAGG + Intergenic
988159374 5:27500251-27500273 ACACATACACACATATATATAGG - Intergenic
988703971 5:33705262-33705284 ACACACACACACACACACCATGG - Intronic
988904256 5:35769984-35770006 ACACACACACACACACATTATGG - Intronic
988936982 5:36093822-36093844 ACGCATACGCACACAAAGCATGG + Intergenic
988966120 5:36419753-36419775 ACACACACACACACAGATCTGGG + Intergenic
989659310 5:43781823-43781845 ACACACACACACACACACCATGG + Intergenic
989994628 5:50813800-50813822 ACATATACACACACATTCCAGGG - Intronic
990018212 5:51092679-51092701 ACATATACACACACATATAATGG - Intergenic
990232760 5:53732524-53732546 ATACACACACACACATATCTGGG - Intergenic
990542657 5:56790035-56790057 ACACACACACACACACACCATGG + Intergenic
990813138 5:59751570-59751592 ACACACACACACACACACCAGGG - Intronic
990816911 5:59795899-59795921 ATGCAGACACACACATATGCAGG + Intronic
990833980 5:59994284-59994306 ACACACACACACACATCTTAAGG - Intronic
991469363 5:66951591-66951613 ACACACACACACACATATCATGG - Intronic
991496897 5:67235760-67235782 ACACACACACACACGTATGAGGG + Intergenic
991575402 5:68098343-68098365 ACACACACACACACACATGAAGG - Intergenic
991712413 5:69420549-69420571 AAACATACACACACAAATGAGGG - Intronic
991899669 5:71447050-71447072 ACACACGCACACACACATCAAGG - Intergenic
991985279 5:72278767-72278789 ACACATACACATATATATCAGGG - Intronic
992599383 5:78382772-78382794 ACACACACACACACACACCATGG - Intronic
992630268 5:78673172-78673194 ACACACACACACACACACCATGG - Intronic
992956927 5:81919512-81919534 ACACACACACACACACACCATGG - Intergenic
993058387 5:83009370-83009392 ACACACACACACATATATAAAGG + Intergenic
993152808 5:84182293-84182315 ACACACACACACACAAATCCAGG + Intronic
993180202 5:84542832-84542854 ACGCACACACACACACATTGAGG - Intergenic
993607163 5:90005994-90006016 ACACACACACACACACACCATGG + Intergenic
994079523 5:95691394-95691416 ACACATACACACATATATGTTGG + Intronic
994109795 5:95988364-95988386 ACGCACACACACACACATACCGG - Intergenic
994193162 5:96891411-96891433 ACATATACACACACATATACAGG + Intronic
994266643 5:97724076-97724098 ACACACACACACACACCTCACGG + Intergenic
994339013 5:98603427-98603449 ATATATACACACACATATCATGG + Intergenic
994765069 5:103905197-103905219 ACACACACACACACACACCATGG + Intergenic
994823671 5:104684820-104684842 ACACACACACACACACACCATGG + Intergenic
995178142 5:109202444-109202466 ATACACACACACACAAATCAGGG + Intergenic
995280192 5:110326266-110326288 ACACACACACACACACATCAAGG + Intronic
995375333 5:111467954-111467976 ACACACACACACACACACCATGG + Intronic
995406147 5:111798730-111798752 ACACACACACACACACACCATGG - Intronic
995895240 5:117003675-117003697 ACACACACACACACACACCATGG - Intergenic
996097055 5:119410141-119410163 TCACATACACACAAATCTCAAGG - Intergenic
996124925 5:119713512-119713534 ACACACACACACACATATATAGG - Intergenic
996225831 5:120995338-120995360 ACACACACACACACATATGAAGG + Intergenic
996547039 5:124690939-124690961 ACACACACACACACACATAATGG + Intronic
996661903 5:126013909-126013931 ATGCATACACACACTCATAAGGG + Intergenic
996668085 5:126084103-126084125 ACACACACACACACACACCATGG + Intergenic
996856192 5:128010053-128010075 ACACACACACACACATCTAATGG - Intergenic
997003584 5:129791891-129791913 ACACACACACACACACACCATGG - Intergenic
997436759 5:133881307-133881329 ACACATACACACACAGCTCTAGG + Intergenic
997533441 5:134597086-134597108 ACACACACACACACAAACCAGGG + Intergenic
997677982 5:135728880-135728902 ACACATACACACACACCCCAAGG + Intergenic
997744174 5:136284286-136284308 GTGCACATACACACATATCATGG - Intronic
997780205 5:136649948-136649970 ACACACACACACACACACCATGG - Intergenic
997949982 5:138234760-138234782 ACACACACACACAAATATCCAGG + Intergenic
998150661 5:139755630-139755652 ACACACACACACACACAGCAGGG - Intergenic
998327389 5:141293651-141293673 ACGCACACACACACAAATGGAGG + Intergenic
999916094 5:156262894-156262916 ACACACACACACACACACCATGG - Intronic
1000333913 5:160227813-160227835 ACACACACACACACACGTCATGG - Intronic
1000397282 5:160789062-160789084 ATGCATGCACATAAATATCAAGG - Intronic
1000402281 5:160842814-160842836 ACACACACACACAAAAATCAGGG + Intronic
1000612938 5:163395218-163395240 ACACACACACACACACACCATGG + Intergenic
1000770334 5:165345586-165345608 ACACACACACACACACACCATGG + Intergenic
1000958281 5:167568642-167568664 ACACACACACACACACACCATGG - Intronic
1000983794 5:167845265-167845287 ACACACACACACACACAACACGG + Intronic
1000991979 5:167920545-167920567 ACACACACACACAAATAGCATGG + Intronic
1001230230 5:169980581-169980603 ACACACACACACACATATGCAGG + Exonic
1001371955 5:171213542-171213564 ACACATACACACACACAAAAGGG - Intronic
1001675408 5:173508441-173508463 ACAGACACACACACATATCTTGG + Intergenic
1002060844 5:176625096-176625118 ATGCCTGCACACACATGTCATGG + Intronic
1002952382 6:1827157-1827179 ACACACACACACACATATCCAGG + Intronic
1003530419 6:6932802-6932824 ACCCATACACACACATACGCAGG + Intergenic
1003658270 6:8034975-8034997 ACACATATACACACACACCATGG + Intronic
1003762321 6:9193742-9193764 ACACATACACACACACAATAAGG + Intergenic
1004102125 6:12624178-12624200 AAACATACACACACATACAATGG + Intergenic
1004152102 6:13131229-13131251 ACACACACACACACACACCATGG + Intronic
1004458748 6:15816392-15816414 ACACACACACACACACATAATGG + Intergenic
1004546934 6:16606860-16606882 ACACACACACACACAACTCATGG - Intronic
1004646612 6:17568357-17568379 ACACACACACACACACATCTTGG + Intergenic
1004679096 6:17875009-17875031 ACACACACACACACACAGCATGG + Intronic
1004709615 6:18156429-18156451 ACGTATACACACATAACTCAAGG + Intronic
1004728229 6:18331827-18331849 ACACACACACACACACACCATGG + Intergenic
1004848717 6:19674261-19674283 ATGCATACACACATATATTTTGG + Intergenic
1004913562 6:20310138-20310160 ACACACACACACACACACCATGG + Intergenic
1005107804 6:22244319-22244341 ATATATACACACACATACCATGG + Intergenic
1005160096 6:22849535-22849557 ACACACACACACACATATACAGG + Intergenic
1005231512 6:23707192-23707214 ACACACACACACAAATATTATGG - Intergenic
1005255236 6:23995710-23995732 ACACACACACACACACACCATGG + Intergenic
1005262260 6:24073532-24073554 ACACACACACACACATAGCATGG - Intergenic
1005655005 6:27927034-27927056 ACACATACACACACACAGCTAGG - Intergenic
1006670373 6:35726568-35726590 ACACACACACACACAGCTCAAGG + Intronic
1007388056 6:41532532-41532554 ACGCATACACACACATGGCGAGG - Intergenic
1007486204 6:42182433-42182455 ACACACACACACACACATCCAGG - Intergenic
1007538734 6:42621324-42621346 AGACAGACACACACATATAAAGG - Intronic
1008309622 6:49950556-49950578 ACACATTCACACACATATACAGG + Intergenic
1008325519 6:50176276-50176298 ACACACACACACACATATACTGG - Intergenic
1008454465 6:51693134-51693156 ATTCATACACACACATAGAAAGG + Intronic
1008783237 6:55133391-55133413 ACACACACACACACACATCAAGG + Intronic
1009244219 6:61215224-61215246 ACACACACACACACAAAACAAGG + Intergenic
1009454184 6:63835353-63835375 ACACACACACACACATACAATGG + Intronic
1009636607 6:66273617-66273639 ATACACACACACACATATTACGG + Intergenic
1009712552 6:67344393-67344415 ACACACACACACACACACCATGG - Intergenic
1009834286 6:68978451-68978473 ATGCATACATACACAAATCTAGG + Intronic
1010160965 6:72854734-72854756 ACACACACACACACACACCATGG + Intronic
1010160966 6:72854751-72854773 ACACACACACACACAAACCATGG - Intronic
1010274531 6:73953731-73953753 ACACATACATATACATACCATGG - Intergenic
1011021629 6:82819945-82819967 ACACACACACACACAAATCATGG + Intergenic
1011242902 6:85290975-85290997 ACACACACACACACACACCATGG + Intergenic
1011286450 6:85729555-85729577 ACACACACACACACACACCATGG - Intergenic
1011321547 6:86099294-86099316 ACACACACACACACACACCATGG - Intergenic
1011325278 6:86143763-86143785 ACACATGCATACACATATAAAGG - Intergenic
1011489210 6:87873358-87873380 ACACACACACACACAAAACAAGG - Intergenic
1011911442 6:92445320-92445342 ACACACACACACACATATAAAGG + Intergenic
1012036333 6:94145636-94145658 ACACACACACACACACATAACGG - Intergenic
1012111730 6:95243739-95243761 ACTCATATGCACACATTTCATGG + Intergenic
1012169019 6:95995283-95995305 ACACACACACACACACACCATGG + Intergenic
1012202882 6:96427505-96427527 ACACACACACACACACACCATGG - Intergenic
1012237029 6:96831001-96831023 ACACATATACACACAGCTCAAGG + Intronic
1012588988 6:100956167-100956189 ACACACACACACACAGAGCAAGG - Intergenic
1012650359 6:101744487-101744509 ACACACACACACACACACCATGG - Intronic
1012724756 6:102796533-102796555 ACACACACACACACATATATAGG - Intergenic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1012946727 6:105474242-105474264 ACACACACACACACAAATCGTGG - Intergenic
1013176659 6:107683621-107683643 ATTCATACACACACAAATCCAGG + Intergenic
1013285349 6:108676578-108676600 ACACATACACATAAATCTCACGG + Intronic
1013438033 6:110132970-110132992 ACACACACACACACACACCATGG + Intronic
1013597975 6:111678101-111678123 ACACACACACACACATATTATGG - Intronic
1013937869 6:115620018-115620040 ACACACACACACACAAAACAGGG + Intergenic
1014110356 6:117613749-117613771 ACACACACACACACACATCTTGG - Intergenic
1014119204 6:117703525-117703547 ACACAGAAACACACAGATCATGG - Intronic
1014190471 6:118489995-118490017 ACGCACACACACACACAAAATGG + Intronic
1014350528 6:120338146-120338168 ACATATACACACACACACCATGG - Intergenic
1014588049 6:123225540-123225562 ACACATACACACACACAGAATGG + Intronic
1014600023 6:123400201-123400223 ACACATATACAAACATATAAAGG + Intronic
1014734109 6:125071477-125071499 ACACACACACACACATATGTAGG - Intronic
1015336522 6:132045442-132045464 ACACACACACACACATACCATGG + Intergenic
1015449812 6:133353295-133353317 ACACATACACATACACAGCATGG - Intronic
1015469674 6:133589903-133589925 ACACACACACACACATACCTAGG + Intergenic
1015643321 6:135362099-135362121 ACACCTACACACACACACCATGG - Intronic
1015745506 6:136505244-136505266 ACACACACACACACATTACATGG - Intronic
1016180615 6:141143172-141143194 ACACACACACACACACACCATGG - Intergenic
1016496619 6:144669952-144669974 ACACACACACACACACACCATGG - Intronic
1016980165 6:149846503-149846525 ACGCCTCCACTCACATACCATGG - Intronic
1017279049 6:152604153-152604175 ACACACACACACACATATAAAGG - Intronic
1017583579 6:155895064-155895086 ACACACACACAGACACATCATGG - Intergenic
1017841993 6:158229956-158229978 GCGCACACACACACGGATCAGGG - Intergenic
1017861218 6:158398958-158398980 ACACATACACACACAAATCCAGG - Intronic
1018145630 6:160884668-160884690 ACACATACACACTCACATCTTGG - Intergenic
1018440716 6:163810143-163810165 ACACACACACACATATCTCAAGG - Intergenic
1018487017 6:164250818-164250840 ACACACACACACACATATATGGG - Intergenic
1018776183 6:167018376-167018398 ACACACACACACACATACCATGG - Intronic
1018837301 6:167494629-167494651 CCTCACACACACACACATCAGGG - Intergenic
1018837375 6:167495510-167495532 ACACACACACACACACATCTGGG + Intergenic
1018991894 6:168680350-168680372 ACACACACACACACACACCATGG + Intergenic
1019000802 6:168749442-168749464 ACACACACACACACACACCATGG - Intergenic
1019122602 6:169814663-169814685 ACACACACACACACAGAGCATGG - Intergenic
1019789923 7:3004588-3004610 ACACACACACACACATATATAGG + Intronic
1019841884 7:3454381-3454403 ACACACACACACACAAATCTTGG - Intronic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1020340650 7:7105995-7106017 ACACATACATACACACATCTTGG - Intergenic
1020714493 7:11653441-11653463 ACACACACACACACATATCTGGG - Intronic
1020796408 7:12683016-12683038 ACACATACACACACATACACAGG + Intergenic
1020924031 7:14301699-14301721 ACACATACACACACATTTGAAGG + Intronic
1020945866 7:14605381-14605403 ACACACACACACACATATATAGG - Intronic
1020973538 7:14978340-14978362 ACACATACACACACACATACAGG + Intergenic
1020992146 7:15212276-15212298 ACACACACACACAAATAGCATGG + Intronic
1021381916 7:19978120-19978142 ACACACACACACACACATAAAGG + Intergenic
1021400090 7:20200018-20200040 ACACACACACACACACATAATGG - Intronic
1021437322 7:20634233-20634255 ACACACACACACACACAACATGG - Intronic
1021753703 7:23830587-23830609 ACACACACACACACACAACATGG - Intronic
1022109123 7:27217268-27217290 ACACACACACACACTTATCCTGG - Intergenic
1022621274 7:31986952-31986974 ACACATACACACACAAAACTAGG + Intronic
1022954081 7:35365566-35365588 AAGCACAAACACACATATTAGGG - Intergenic
1023159183 7:37281019-37281041 ATATATACACACACATATGATGG + Intronic
1023537447 7:41228380-41228402 ACACACACACACACACACCATGG - Intergenic
1023557835 7:41441679-41441701 ACACATACACACACAGAAGAAGG + Intergenic
1023608634 7:41952690-41952712 ACACACACACACGCATATCCAGG + Intergenic
1023657165 7:42435142-42435164 ACACACACACACACACACCATGG - Intergenic
1023720354 7:43087264-43087286 ACACAGACACACACACATCATGG + Intergenic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1024199739 7:47094163-47094185 ACACACACACACACATAACACGG - Intergenic
1024438239 7:49384042-49384064 ACACACACACACACAGCTCAGGG - Intergenic
1024665110 7:51538300-51538322 ACACACACACATACATACCATGG - Intergenic
1024681187 7:51690375-51690397 GGGCATACACACACACATTATGG - Intergenic
1024710461 7:52009632-52009654 ACACACACACACACACACCATGG - Intergenic
1024720780 7:52135657-52135679 ACAGATACACACACATAAAATGG + Intergenic
1024966628 7:55028026-55028048 ACACACACACACACATATGGAGG + Intronic
1025292668 7:57744737-57744759 ACACACACACACACACATAAAGG - Intergenic
1025953092 7:66161385-66161407 ACACATACACACACACAATATGG + Intergenic
1026501915 7:70950108-70950130 ACACACACACACACACACCATGG + Intergenic
1026671567 7:72395363-72395385 ACACACACACACACATATCCAGG + Intronic
1026772008 7:73208258-73208280 ACACACACACACACACATAAAGG + Intergenic
1026886747 7:73954095-73954117 ATGCACACACACACAGCTCAGGG + Intergenic
1027012877 7:74761654-74761676 ACACACACACACACACATAAAGG + Intergenic
1027075164 7:75184398-75184420 ACACACACACACACACATAAAGG - Intergenic
1027493936 7:78863936-78863958 ATGCATACTGACACATTTCAGGG - Intronic
1027629518 7:80585266-80585288 ACACACACACACACAATTCAGGG - Intronic
1027650213 7:80857169-80857191 ACACATATACACATATAACAAGG - Intronic
1027676679 7:81167820-81167842 ACACACACACACATATATAATGG + Intergenic
1027878219 7:83799262-83799284 ATAAATACACACACACATCATGG + Intergenic
1028218265 7:88162116-88162138 ACACACACACACACACACCATGG + Intronic
1028240257 7:88411028-88411050 ACACACACAAACACATTTCAAGG - Intergenic
1028570374 7:92279886-92279908 ACACATACACACACACATCAGGG + Intronic
1028670237 7:93393791-93393813 ACACACACACACACACAACATGG - Intergenic
1028672890 7:93424348-93424370 AACCATACACAAAAATATCAAGG - Intergenic
1028996220 7:97103225-97103247 ACACACACACACACACACCATGG + Intergenic
1030127693 7:106169925-106169947 ACACACACACACACATATTTAGG + Intergenic
1030238687 7:107294874-107294896 ACACACACACACACAAATCCAGG - Intronic
1030780110 7:113590330-113590352 ACACACACTCACACATATCAGGG - Intergenic
1030820454 7:114086268-114086290 ACACACACACACACAGATCCGGG + Intergenic
1030937471 7:115603027-115603049 ACCCATACATACCCATAACATGG - Intergenic
1031155130 7:118101025-118101047 ACGCACACACACACACACCATGG - Intergenic
1031273719 7:119689734-119689756 ACACACACACACACATATATAGG + Intergenic
1031352752 7:120755364-120755386 ACACATACACACACAAAACAGGG - Intergenic
1031434360 7:121713852-121713874 ACGCATACACACACACAGCTAGG - Intergenic
1031480731 7:122275484-122275506 ACACACACACACACACATCCAGG - Intergenic
1031875733 7:127138685-127138707 ACACATACACACATATGCCAAGG + Intronic
1032000862 7:128264659-128264681 ACGCACACACACACACACCCTGG + Intergenic
1032012341 7:128354990-128355012 ACACATACACAAACAGATGATGG - Intronic
1032182910 7:129696439-129696461 ACACATACACACACACAGAAAGG - Intronic
1032350583 7:131159350-131159372 ACACAGACACACACATACAATGG + Intronic
1032360569 7:131251088-131251110 ACACACACACACACACATCTGGG - Intronic
1032387881 7:131537118-131537140 ACGCATACATACATATATACAGG - Intronic
1032514577 7:132497136-132497158 ACACACACATACACATATCCTGG + Intronic
1032566071 7:132946163-132946185 ACACACACACACATATATAAAGG - Intronic
1032796508 7:135281463-135281485 ACTGATCCACACACATCTCAAGG - Intergenic
1032978031 7:137248301-137248323 ACACACACACACACATTCCATGG - Intronic
1032987424 7:137354080-137354102 AGACACACACACACATATCTAGG + Intergenic
1033288341 7:140061453-140061475 ACACACACACACACAAAACAGGG + Intronic
1034059301 7:148071489-148071511 ACACATACACACACAAAATATGG + Intronic
1034240765 7:149609079-149609101 ACGCAGACAGATACAGATCATGG + Intergenic
1034384157 7:150724665-150724687 ACACACACACACACACACCAAGG + Intronic
1034568583 7:151935812-151935834 ACACACACACACACACAACAGGG - Intergenic
1035028157 7:155840323-155840345 ACACACACACACACCTAGCAAGG + Intergenic
1035478959 7:159166314-159166336 ACACATACACACACACCACATGG - Intergenic
1035655187 8:1300194-1300216 ACACAGACACACACGTATAACGG - Intergenic
1035909337 8:3548684-3548706 ACACACACACACACACACCATGG + Intronic
1036126358 8:6066572-6066594 ACACACACACATACACATCATGG - Intergenic
1036423008 8:8615447-8615469 ACGCACACACACACAAATGATGG + Intergenic
1036944529 8:13082298-13082320 ACACACACACACACACATCAGGG - Intergenic
1037155091 8:15689817-15689839 ACACACACACACACACACCATGG - Intronic
1037307847 8:17524440-17524462 ACACACACACACACACACCATGG + Intronic
1037358574 8:18049203-18049225 ACACACACACACACATATGATGG + Intergenic
1037379523 8:18269677-18269699 ACACACACACACACACCTCATGG - Intergenic
1037479798 8:19293796-19293818 ACACATACACACACAAATCAAGG - Intergenic
1037501816 8:19493890-19493912 ACACACACACACACACATCTAGG + Intronic
1038058762 8:23887858-23887880 ACACATACACACACATACAGAGG - Intergenic
1038346743 8:26740017-26740039 AGGCATACACACACCAAACATGG + Intergenic
1038677569 8:29637284-29637306 ACATACACACACACATACCATGG + Intergenic
1038863849 8:31416793-31416815 ACACATACACACACAGTGCAGGG - Intergenic
1038920589 8:32079177-32079199 ACACATACACGCACATACAAGGG + Intronic
1039091364 8:33833188-33833210 ACACACACACACACACACCATGG + Intergenic
1039243789 8:35585519-35585541 ACACACACACACACATATTATGG - Intronic
1039354393 8:36799317-36799339 ACACACACACAGCCATATCATGG - Intronic
1039376426 8:37038835-37038857 ACATATACACACACATATCATGG - Intergenic
1039431645 8:37529566-37529588 ACACACACACACACATTTGAAGG + Intergenic
1039667980 8:39557230-39557252 ACACACACACATACATATAAAGG - Intergenic
1039682332 8:39753833-39753855 ACACACACACACACAAAACAAGG + Intronic
1039772300 8:40699604-40699626 ACACACACACACACACACCATGG + Intronic
1040525710 8:48222770-48222792 ACACACACACACACACACCATGG - Intergenic
1040552920 8:48452653-48452675 ACACACACACACACACACCATGG + Intergenic
1040759346 8:50819970-50819992 ACGCATGCACACACACACCCAGG - Intergenic
1040809856 8:51440061-51440083 ACACACACACACACACACCATGG + Intronic
1040988572 8:53323924-53323946 ATGCATACACACAAATATAAAGG + Intergenic
1041114384 8:54520482-54520504 ACACACACACACACAGGTCAGGG - Intergenic
1041257073 8:55988287-55988309 ACACACACACACACACACCAGGG - Intronic
1041523001 8:58775444-58775466 ACACACACACACACACATAATGG - Intergenic
1041580392 8:59452266-59452288 ACACATAGACACACATATGCAGG + Intergenic
1041896705 8:62933012-62933034 ACACACACACACACACACCAGGG + Intronic
1042188416 8:66160352-66160374 ACACACACACACACACACCATGG - Intronic
1043074736 8:75683764-75683786 ACACACACACACACACACCATGG - Intergenic
1043164947 8:76891928-76891950 ACACACACACACACACACCATGG + Intergenic
1043348937 8:79335869-79335891 ACACACACACACACATACAATGG + Intergenic
1043614473 8:82108548-82108570 ACACACACACACACACAGCAGGG + Intergenic
1044367035 8:91359869-91359891 ACACACACACACACATATCTTGG - Intronic
1044424414 8:92034820-92034842 ACACACACACACACACACCATGG + Intronic
1044487515 8:92769973-92769995 ACACACACACACATATATAAAGG + Intergenic
1044516880 8:93149323-93149345 ACACACACACACACATATACAGG + Intronic
1044953637 8:97457508-97457530 ACACACACACACACACACCATGG + Intergenic
1045052187 8:98337442-98337464 ACACACACACACACATTTCTGGG + Intergenic
1045184324 8:99821150-99821172 ACACACACACACACACACCATGG + Intronic
1045612202 8:103858745-103858767 ACACACACACACACATATATGGG + Intronic
1045878388 8:107009777-107009799 ACACATATACACACACACCATGG + Intergenic
1045963119 8:107992187-107992209 ACACACACACACACACACCATGG + Intronic
1046025088 8:108712702-108712724 ACGCACACACATATATAGCATGG - Intronic
1046143484 8:110125581-110125603 ACACATACACACACACATACAGG - Intergenic
1046147363 8:110178425-110178447 TCGCACACACTTACATATCAAGG - Intergenic
1046238218 8:111455245-111455267 ACACATACACACACATACAATGG + Intergenic
1046339476 8:112833673-112833695 ACACATACACACATATATATTGG - Intronic
1046583542 8:116123178-116123200 ACACACACACACACACATCAGGG - Intergenic
1046717988 8:117587918-117587940 ACACACACACACACACACCAGGG + Intergenic
1046742003 8:117839403-117839425 ACATATACACATACATATAATGG - Intronic
1046788330 8:118292362-118292384 ACACACACACACACATATTCCGG + Intronic
1046927910 8:119812714-119812736 ACACACACACACACACACCATGG - Intronic
1046956196 8:120065145-120065167 ACTCATACACACACATTTGAAGG + Intronic
1046956725 8:120069733-120069755 ACACACACACACATATATAAGGG - Intronic
1047183531 8:122611953-122611975 AAGCACAGACACAGATATCAGGG - Intergenic
1047511476 8:125519285-125519307 ACACACACACACACACATCCTGG + Intergenic
1047865672 8:129021705-129021727 ACTAATACATACACATTTCAAGG + Intergenic
1047879043 8:129172244-129172266 ACACACTCACACACATTTCATGG - Intergenic
1048415350 8:134222237-134222259 ACACACACACACACACACCATGG + Intergenic
1048501765 8:134983015-134983037 ACACACACACACACACAACAAGG + Intergenic
1048704424 8:137135623-137135645 ACACACACACACACACATTAGGG - Intergenic
1048754535 8:137722465-137722487 ATGCACACACACATATATCAGGG - Intergenic
1048787523 8:138066184-138066206 ATATATACACATACATATCAAGG - Intergenic
1048823633 8:138401998-138402020 ACACAGACACACACACACCAGGG - Intronic
1049520718 8:143088613-143088635 ACACAAACAAACACATACCAGGG + Intergenic
1050391748 9:5150865-5150887 ACACACACACACACACATCATGG + Intronic
1050543765 9:6692290-6692312 ACACATACACACACACATCTTGG + Intergenic
1050789645 9:9450091-9450113 ACACACACACACACACACCATGG - Intronic
1050882890 9:10725910-10725932 ACACACACACACACAGAACAAGG + Intergenic
1050934497 9:11378113-11378135 ACACACACACACACAGAACAAGG + Intergenic
1050962648 9:11755808-11755830 ACACACACACACTCATATGAAGG - Intergenic
1051012613 9:12436816-12436838 ACACACACACACACACACCATGG - Intergenic
1051105370 9:13573163-13573185 ACACATACACACACACACAATGG - Intergenic
1051202112 9:14638174-14638196 ACACATAGACACACAGACCAAGG + Intronic
1051360457 9:16277390-16277412 ACACACACACACACAAAACAGGG + Intergenic
1051540369 9:18209075-18209097 ACACACACAGACACATATCTTGG - Intergenic
1052016520 9:23474681-23474703 AGGCCTCCACACACATATTAAGG - Intergenic
1052121141 9:24717816-24717838 ATACACACACACACACATCATGG - Intergenic
1052157617 9:25213603-25213625 ACACACACACACACAAATCCAGG + Intergenic
1052191435 9:25668503-25668525 ACACACACACACACAAATGAGGG - Intergenic
1052408105 9:28088224-28088246 ACACACACACACACATATAATGG + Intronic
1052424084 9:28281481-28281503 ACACACACACACACATATAAGGG + Intronic
1052425890 9:28303956-28303978 ACACATACACACACATACACAGG - Intronic
1052532878 9:29709999-29710021 ACACACACACATACATACCATGG - Intergenic
1052675140 9:31612379-31612401 ACACACACACACACATATCTTGG + Intergenic
1052961328 9:34299799-34299821 ACACACACACACACACATCTTGG - Intronic
1053171653 9:35891321-35891343 ACACACACACACACACATCCAGG + Intergenic
1053366492 9:37526064-37526086 ACACATACACACACTTCTCCAGG - Intronic
1053693959 9:40617968-40617990 ACACACACACACACACATTATGG - Intergenic
1053940951 9:43248397-43248419 ACACACACACACACACATTATGG - Intergenic
1054141403 9:61534247-61534269 ATCCACACACACACAAATCACGG - Intergenic
1054192172 9:61992300-61992322 ATACACACACACACAAATCACGG + Intergenic
1054270876 9:63022168-63022190 ACACACACACACACACATTATGG + Intergenic
1054305204 9:63417192-63417214 ACACACACACACACACATTATGG - Intergenic
1054360829 9:64115160-64115182 AAACATACACACACTTATTAAGG + Intergenic
1054403951 9:64741172-64741194 ACACACACACACACACATTATGG - Intergenic
1054437572 9:65226682-65226704 ACACACACACACACACATTATGG - Intergenic
1054457055 9:65438159-65438181 ACACATACACAAACACACCAAGG + Intergenic
1054461103 9:65464899-65464921 ATCCACACACACACAAATCACGG - Intergenic
1054492831 9:65795299-65795321 ACACACACACACACACATTATGG + Intergenic
1054835418 9:69671617-69671639 ACGCGTACACACACATATACAGG + Intronic
1055156764 9:73072358-73072380 ACACACACACACACACACCATGG + Intronic
1055345608 9:75334146-75334168 ACACACACACACACACATCATGG + Intergenic
1055764641 9:79649286-79649308 ACACACACACACACACAACAAGG + Intronic
1055766175 9:79666156-79666178 ACACACACACACACAGATGAAGG - Intronic
1055847018 9:80577788-80577810 ACACACACACACACACACCATGG + Intergenic
1055866879 9:80825119-80825141 ACACACACACACACACACCATGG - Intergenic
1055880351 9:80993949-80993971 ACACACACACACACACAACAGGG + Intergenic
1055880353 9:80993999-80994021 ACACACACACACACACAACAGGG + Intergenic
1056022147 9:82450062-82450084 ATGCATGCACACACATATTCTGG + Intergenic
1056305673 9:85288646-85288668 ACACACACACACACATAATATGG - Intergenic
1056308129 9:85311543-85311565 ACACATACACACATACATTAGGG - Intergenic
1056690256 9:88802301-88802323 ACACACACACACACATGTTATGG + Intergenic
1056784338 9:89579331-89579353 AAGCAAACACACACAAACCATGG + Intergenic
1056885893 9:90443412-90443434 ACACATACACACACACTTCTGGG - Intergenic
1056888291 9:90465439-90465461 ACACACACACACACACATCAAGG + Intergenic
1057043764 9:91867649-91867671 ACACACACACACACAGCTCATGG - Intronic
1057283327 9:93727901-93727923 ACGCATGCACACACACATGCAGG - Intergenic
1058211976 9:102180611-102180633 ACACACACACACACACACCATGG - Intergenic
1058571332 9:106348516-106348538 ACACACACACACACACACCAGGG + Intergenic
1058832171 9:108828630-108828652 ACACACACACACACACACCATGG + Intergenic
1059033190 9:110723253-110723275 ACACACACACATACATACCATGG + Intronic
1059088602 9:111332395-111332417 ATACATACACACACACACCATGG + Intergenic
1059248592 9:112868122-112868144 ACACATACACACTGATTTCATGG - Intronic
1059501635 9:114759183-114759205 ACACACACACACACACAACACGG - Intergenic
1059597687 9:115740523-115740545 ACACACACACACACACATCATGG + Intergenic
1059644367 9:116250006-116250028 ACACACACACACACATATGCAGG - Intronic
1059683225 9:116606388-116606410 ACACATACACACACACTTTATGG - Intronic
1059828739 9:118066610-118066632 ACACACACACACACACACCATGG + Intergenic
1059908615 9:119017720-119017742 ACACAAACACACACATATGCCGG + Intergenic
1060613286 9:124988075-124988097 ACACATACACACACGCTTCAGGG + Intronic
1060863761 9:126978436-126978458 ACGCACACACACACACACCCTGG - Intronic
1061157297 9:128871775-128871797 ACACATACACATACATATTCAGG + Intronic
1061325345 9:129860731-129860753 ACACAGACACACACAAATCAAGG + Intronic
1061427379 9:130507793-130507815 ACACACACACACACATATATGGG - Intergenic
1061706849 9:132459600-132459622 ATACATACACACACATATACAGG - Intronic
1203705787 Un_KI270742v1:43226-43248 AAACATACACACACTTATTAAGG + Intergenic
1185692832 X:2170460-2170482 ACACACACACACACACATCATGG - Intergenic
1185807374 X:3070934-3070956 ACACACACACACACACACCATGG - Intronic
1185827129 X:3262226-3262248 ACACACACACACACACACCATGG - Intergenic
1186068660 X:5793785-5793807 ACACACACACACACATATATGGG - Intergenic
1186197347 X:7122208-7122230 ACACACACACACACATATATGGG - Intronic
1186209796 X:7238117-7238139 ACACACACACACACACACCATGG - Intronic
1186483226 X:9912136-9912158 ACACACACACACACACATAAAGG + Intronic
1186483236 X:9912235-9912257 ACACACACACACACACATAAAGG + Intronic
1186576617 X:10773322-10773344 ACACATGCACACACACATAATGG - Intronic
1186582896 X:10840077-10840099 ACACACACACACACACACCATGG + Intergenic
1187288597 X:17930700-17930722 ACACAAACACACACACACCATGG + Intergenic
1187329688 X:18326174-18326196 ATGCATACACACATATGTAATGG - Intronic
1187343150 X:18439386-18439408 ACACACACACACACCTATTATGG - Intronic
1187478575 X:19634027-19634049 ACACACACACACACACACCAGGG - Intronic
1187589304 X:20698991-20699013 ACACATACACACACACACCATGG + Intergenic
1187616217 X:20996272-20996294 ACACATACACACACACATCTTGG - Intergenic
1187632508 X:21190283-21190305 ACACACACACACACACACCATGG + Intergenic
1187816268 X:23235494-23235516 ACACATACACACACACATCTTGG - Intergenic
1187974385 X:24690837-24690859 ACACACACACACACACACCATGG - Intergenic
1187991864 X:24882680-24882702 ACACACACACACACACACCATGG - Intronic
1188250831 X:27892303-27892325 ACACACACACACACACATCGGGG - Intergenic
1188368706 X:29342105-29342127 ACACACACACACACAAAACAAGG - Intronic
1188500353 X:30818887-30818909 ACACACACACACACACACCATGG - Intergenic
1188676549 X:32948132-32948154 ACACACACACACACACACCAGGG + Intronic
1188779417 X:34262462-34262484 ACACATACTCAAACATATAAGGG - Intergenic
1188942657 X:36260072-36260094 ACACACACACACACACACCATGG - Intronic
1189146764 X:38663183-38663205 ACACACACACACACACACCATGG + Intronic
1189607050 X:42689924-42689946 ACACACACACACACACACCATGG - Intergenic
1190132091 X:47757588-47757610 ACACACACACACACAGATCCTGG + Intergenic
1190357161 X:49616725-49616747 ACACACACACACACACACCATGG + Intergenic
1190896885 X:54628208-54628230 ACACACACACACACACACCACGG - Intergenic
1190956479 X:55199972-55199994 ACACATACACATACACATCTTGG + Intronic
1191011490 X:55763813-55763835 ACGCATACACACATATACACAGG + Intergenic
1191079833 X:56498050-56498072 ATGGAAACACACACACATCAGGG - Intergenic
1191678332 X:63815180-63815202 ACACAAACACACACACATCATGG + Intergenic
1191789861 X:64958374-64958396 ACACACACACACACATATACAGG - Intronic
1191876070 X:65797891-65797913 ACACATACAAACACATAAGAGGG + Intergenic
1192296631 X:69856250-69856272 ACACACACACACACACACCATGG - Intronic
1192301065 X:69903605-69903627 ACACACACACACACATATCTTGG + Intronic
1192582474 X:72296053-72296075 ACGCATGCACACACAAAGGACGG - Intronic
1192622898 X:72697439-72697461 ACACATATACACACACATCTTGG - Intronic
1192671624 X:73149844-73149866 ACACACACACACACACACCATGG - Intergenic
1193095014 X:77538249-77538271 ACACACACACACACACACCATGG + Intronic
1193303494 X:79921391-79921413 ACACACACACACACACACCATGG - Intergenic
1193356986 X:80531566-80531588 ACACACACACACACATATATAGG - Intergenic
1193402467 X:81062294-81062316 ACACACACACTCACACATCATGG - Intergenic
1193474798 X:81949911-81949933 ACACACACACACACACATCTTGG - Intergenic
1193595981 X:83445800-83445822 ACACACACACACACACACCAAGG - Intergenic
1193636823 X:83961240-83961262 ACACACACACACACACACCATGG + Intergenic
1193775757 X:85639952-85639974 ACACACACACACACATATTTAGG + Intergenic
1193867457 X:86753080-86753102 ACCCCGACACACACAAATCATGG + Intronic
1193982389 X:88198969-88198991 ATGCACACACACACACACCATGG + Intergenic
1193984664 X:88225892-88225914 ACACACACACACACAAATAATGG - Intergenic
1194003781 X:88465252-88465274 ACGTACACACACACACATCTTGG - Intergenic
1194025075 X:88740975-88740997 ACTCATGCACACACACATGAAGG - Intergenic
1194200225 X:90945335-90945357 ACCCATACACACACACATCTTGG - Intergenic
1194535184 X:95097158-95097180 ACACACACACACACACACCATGG + Intergenic
1194548383 X:95267330-95267352 ACACACACACACACATATATAGG - Intergenic
1194578959 X:95647540-95647562 ACACATACACACACAAATGGGGG - Intergenic
1194967805 X:100309164-100309186 ACACACACACACACACACCATGG + Intronic
1195413248 X:104592138-104592160 ACACACACACACACATATACGGG - Intronic
1195583947 X:106541363-106541385 ACACACACACACACATATTTGGG - Intergenic
1195588974 X:106601972-106601994 ACACACACACACACACTTCATGG + Intergenic
1195876564 X:109548568-109548590 ACACATACACCCACATATATAGG - Intergenic
1196060951 X:111407824-111407846 ACACACACACACACATATCTAGG + Intronic
1196405872 X:115362032-115362054 ACACATACACACACCTATATGGG - Intergenic
1196410985 X:115418325-115418347 ACCCATACACACTCCTTTCATGG + Intergenic
1196599303 X:117584000-117584022 ACACACACACACACACACCATGG - Intergenic
1196643039 X:118085792-118085814 ACACACACACACACACACCATGG - Intronic
1196659170 X:118252169-118252191 ACACACACACACACACACCAAGG + Intergenic
1196861963 X:120037150-120037172 ACACACACACACACACATCGTGG - Intergenic
1197230470 X:123998464-123998486 ACACATACACACACACGGCAGGG - Intronic
1197481090 X:126986639-126986661 ACACATACATACACACATCTTGG - Intergenic
1197541963 X:127775130-127775152 ACACATACACACACAGAATACGG + Intergenic
1197568599 X:128120237-128120259 ACACATACACACGCACATCTTGG + Intergenic
1197571704 X:128157675-128157697 ACACATACACACACACAACATGG - Intergenic
1197884394 X:131203306-131203328 ACGCATGCACACACATTTGTAGG - Intergenic
1198419090 X:136451263-136451285 ACACACACACACACATATTTTGG + Intergenic
1198452150 X:136777770-136777792 ACACACACACACACACACCATGG + Intronic
1198495541 X:137188605-137188627 ACACATACACACACACACAAGGG - Intergenic
1198526127 X:137502875-137502897 ATGCATACACACACATAGGCGGG - Intergenic
1198559386 X:137832263-137832285 ATATATACACACACACATCATGG - Intergenic
1198670635 X:139076455-139076477 ACACACACACACACAAAACAGGG + Intronic
1198766631 X:140086711-140086733 ACTACTACACACACATATAATGG + Intergenic
1198848141 X:140935577-140935599 ACACACACACACACATCCCACGG - Intergenic
1199361377 X:146923055-146923077 AAACATACACACACATAACTAGG - Intergenic
1199739310 X:150718074-150718096 ACACACACACACACATAGCTGGG + Intronic
1199764867 X:150934195-150934217 ACACACACACACACATAATATGG - Intergenic
1199820691 X:151442670-151442692 ACACACACACACACACATAAAGG - Intergenic
1199869028 X:151879784-151879806 ACACACACACACACACATCTTGG - Intergenic
1200365126 X:155654682-155654704 ACACACACACACACACACCATGG - Intronic
1200546219 Y:4521736-4521758 ACCCATACACAGACACATCTTGG - Intergenic
1200682979 Y:6234999-6235021 ACACAGACACACACAAATAAAGG - Intergenic
1200921655 Y:8618644-8618666 ACACATACACAAACATACAAAGG - Intergenic
1201049654 Y:9919383-9919405 ACACAGACACACACAAATAAAGG + Intergenic
1201251787 Y:12066122-12066144 ACACATACACACACACACCATGG + Intergenic
1201319451 Y:12681950-12681972 ATGCATACACACACACATCCTGG - Intergenic
1202056312 Y:20835158-20835180 ATACACACACACACATATCATGG + Intergenic