ID: 1146738226

View in Genome Browser
Species Human (GRCh38)
Location 17:35258110-35258132
Sequence AGTTGAGGAGCTGAGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146738226_1146738229 25 Left 1146738226 17:35258110-35258132 CCAGCAGACTCAGCTCCTCAACT 0: 1
1: 0
2: 1
3: 21
4: 305
Right 1146738229 17:35258158-35258180 AAATCTGACCTCAAGCTATGTGG 0: 1
1: 0
2: 1
3: 12
4: 129
1146738226_1146738230 26 Left 1146738226 17:35258110-35258132 CCAGCAGACTCAGCTCCTCAACT 0: 1
1: 0
2: 1
3: 21
4: 305
Right 1146738230 17:35258159-35258181 AATCTGACCTCAAGCTATGTGGG 0: 1
1: 0
2: 1
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146738226 Original CRISPR AGTTGAGGAGCTGAGTCTGC TGG (reversed) Intronic
900462655 1:2808960-2808982 TGTGGAGGAGCTGGGGCTGCCGG + Intergenic
900526587 1:3132321-3132343 AGCAGAGGAGCGGAGCCTGCTGG + Intronic
900642333 1:3693734-3693756 GGAGGAGGAGCTGAGGCTGCAGG - Intronic
901246553 1:7736408-7736430 AGATGATGAGCCGAGCCTGCTGG + Exonic
901529165 1:9842891-9842913 AGATGCGGGGCTGAGGCTGCTGG - Intergenic
902234186 1:15047291-15047313 AGTGGGGGAGCTGGGCCTGCAGG - Intronic
902668413 1:17955082-17955104 TGCTGAGTAGCTGGGTCTGCAGG + Intergenic
902836103 1:19047703-19047725 ATCTGAGGGGCTGAGTCTCCAGG + Intergenic
904927705 1:34061580-34061602 AGATGAGGAGCTGAGGCTCAGGG - Intronic
905251563 1:36652206-36652228 ATTGCAGGAGGTGAGTCTGCAGG + Intergenic
905672204 1:39799205-39799227 AGTGGAGGAGCTGCGACTCCAGG - Intergenic
905674756 1:39817602-39817624 AGTGGAGGAGCTGCGGCTACGGG + Intergenic
907454072 1:54564106-54564128 AGCTGAGTAGCTGAGACTACAGG - Intronic
907728829 1:57046083-57046105 AGTTGAGAATCTGAATCAGCTGG + Intronic
908165189 1:61450552-61450574 TGATGAGGAGCTGGGCCTGCAGG + Intronic
908387053 1:63652804-63652826 AGTTGAGGAGGGGAGACTCCAGG - Intronic
909981854 1:82112606-82112628 AGTGGACCAGGTGAGTCTGCCGG - Intergenic
912480935 1:109981736-109981758 AGTAGAGGTGCTGAGTCAGGTGG + Intergenic
913173507 1:116253602-116253624 AGTTCAGGGGCTGCATCTGCTGG - Intergenic
913314483 1:117538587-117538609 AGTTGAGGAACTCAGTGTCCTGG - Intergenic
914432644 1:147632827-147632849 GGTTGAGGAGGTGAGGCTCCTGG + Intronic
914728729 1:150351607-150351629 ACTTGAGAAGCTGAGACTGGAGG - Intronic
914877709 1:151524730-151524752 AGAGGAGCAGCTGAGGCTGCGGG + Exonic
915963613 1:160287160-160287182 ACCTGAGTAGCTGGGTCTGCAGG + Intergenic
917677705 1:177336122-177336144 AGGGGAGGAGCCCAGTCTGCTGG - Intergenic
918524578 1:185451663-185451685 AATTGAGAAGCTGAGTGTGGAGG - Intergenic
920075164 1:203330796-203330818 AGGAAAGGAGCAGAGTCTGCTGG - Intergenic
920827030 1:209431903-209431925 AGTTGGGGAGGTGGGTCTGTGGG - Intergenic
921217987 1:212952828-212952850 AGCTGAGCATCTGAGCCTGCAGG + Intronic
921984543 1:221298114-221298136 AGTTGAGTAGCTGGGACTACAGG + Intergenic
1063951572 10:11227829-11227851 AGGAGAGGAGATGAGTTTGCAGG - Intronic
1064911478 10:20406390-20406412 AATTGAAGATCTGAGTGTGCAGG + Intergenic
1065399220 10:25277437-25277459 AGTTGAGTAGCTGACTTTGGGGG + Intronic
1065754536 10:28919139-28919161 AGGTGAGGGGCTGTGTGTGCAGG - Intergenic
1066282350 10:33930192-33930214 TGTTGAGGGGCTGAGTCTGGTGG + Intergenic
1067156033 10:43782113-43782135 AATTTAGGGGCTGAGTCAGCTGG - Intergenic
1069020252 10:63478855-63478877 AGTTGTGAAGCTGAGGCTGGAGG + Intergenic
1069786418 10:70990946-70990968 GTTTGAGGAGATGAGCCTGCAGG + Intergenic
1069891502 10:71655323-71655345 TGTTGAGGATCTGAGTGGGCAGG - Intronic
1070433316 10:76362929-76362951 TGTGGAGGAGCTCTGTCTGCTGG - Intronic
1071671547 10:87613621-87613643 AGTTGGGAAGCTGAGGCTGGAGG + Intergenic
1072085860 10:92078449-92078471 AGATGAGGACCTGAGGCTTCTGG + Intronic
1075345051 10:121675804-121675826 ACTTGAGTAGCTGAGACTACAGG - Intergenic
1077907637 11:6546441-6546463 AGTGGCAGAGCTGACTCTGCTGG + Exonic
1078788833 11:14523557-14523579 AGCTGAGGAGCTGAGTATGGTGG - Intronic
1080781134 11:35431040-35431062 AGATGAGGGGCCGAGTCTGCAGG + Intergenic
1081460271 11:43266384-43266406 TCTTGAGTAGCTGAGGCTGCAGG - Intergenic
1084634847 11:70384928-70384950 AGTTGGTGAGCTGAGGCTGAAGG + Intergenic
1085255673 11:75171378-75171400 TCTTGAGTAGCTGAGACTGCAGG + Intronic
1085447759 11:76612074-76612096 ACTTGAGGAGCTGAGGCAGGAGG - Intergenic
1086163547 11:83750379-83750401 AGTTAAAGAGCAGAGTCTTCTGG + Intronic
1087443102 11:98209649-98209671 AATTGAGTAGCTGAGACTACAGG + Intergenic
1087934326 11:104014385-104014407 ACTTGGGGAGCTGAGGCTGGAGG + Intronic
1088299689 11:108343701-108343723 ACTTGAGAGGCTGAGTCTGGGGG + Intronic
1088462993 11:110102485-110102507 AGATGAGGAGTTGTGTCTTCTGG + Intronic
1088695551 11:112362868-112362890 AGTTGAGAAGGTGTGTCTGCCGG - Intergenic
1088971783 11:114780374-114780396 AGAGGAGGAGCTGTGCCTGCAGG + Intergenic
1089249694 11:117149206-117149228 TGCTGAGTAGCTGAGACTGCAGG + Intronic
1090101675 11:123804295-123804317 TGTTGAGCAGCTGAGACTACAGG + Intergenic
1091211301 11:133863881-133863903 AGTAGAGTAGCTGGGACTGCAGG - Intergenic
1091592309 12:1851000-1851022 AGCTGAGTAGCTGGGACTGCAGG + Intronic
1092172139 12:6380558-6380580 AGTTGAGTAGCTGGGACTACAGG - Intronic
1092692438 12:11129029-11129051 AGTTGAGAAGCTGAGGCAGGAGG - Intronic
1096012402 12:48231064-48231086 TCTTGAGTAGCTGAGTCTGCAGG - Intergenic
1099860368 12:88218425-88218447 AGGTGAGGAGGAGAGTCTGAAGG - Intergenic
1100185980 12:92140599-92140621 AGTTAAGCAGCTGGGTCGGCTGG + Exonic
1100544437 12:95587868-95587890 TCTTGAGTAGCTGAGACTGCAGG - Intergenic
1101259439 12:103013520-103013542 GGGTGGGGAGCTGAGTCTGGAGG + Intergenic
1101429579 12:104615802-104615824 TTTTGAGTAGCTGAGACTGCAGG - Intronic
1101608433 12:106268208-106268230 AGTAGAGTAGCTGGGACTGCAGG - Intronic
1102675014 12:114651668-114651690 ACTTGAGAAGCTGAGGCTGGAGG + Intergenic
1102837562 12:116079645-116079667 ACTTGAGGAGCTGAGGCAGGAGG - Intronic
1103959170 12:124597337-124597359 AGTTGAGGAGCTGCTTCTGGGGG + Intergenic
1104464821 12:128981840-128981862 AGTTGAGGAGCTGAGGCTTGGGG + Intronic
1105468244 13:20667502-20667524 AGTTGGGGAGCTTAAGCTGCAGG + Intronic
1106908091 13:34430500-34430522 AGATGAGGAGCTGAGGCATCTGG + Intergenic
1107381988 13:39866628-39866650 AGTTGGGGAGCTGACTCTTCAGG - Intergenic
1107954173 13:45494646-45494668 TCTTGAGGAGCTGAGACTACAGG + Intronic
1109866324 13:68269918-68269940 AGTGGAGTATGTGAGTCTGCAGG + Intergenic
1110727680 13:78844009-78844031 TGGTGATGAGCTGAGTTTGCTGG - Intergenic
1112335230 13:98509713-98509735 ACATGGGGAGCTCAGTCTGCTGG - Intronic
1113031526 13:105998393-105998415 AGCAGAGGAGCGGAGCCTGCAGG - Intergenic
1114317627 14:21523036-21523058 GGTAGAGGAGCTGAGCCTGCAGG - Exonic
1114343387 14:21769044-21769066 AGGTAGGTAGCTGAGTCTGCAGG - Intergenic
1114597189 14:23923427-23923449 ACTTGAGTAGCTGAGACTACAGG - Intergenic
1115257897 14:31421967-31421989 AGGTAAGTAGCTGAGACTGCAGG + Intronic
1115267723 14:31518185-31518207 AGTAGAGTAGCTGGGTCTACAGG + Intronic
1115975903 14:38996600-38996622 ACTTGACGTGCTGAGTCTTCCGG - Intergenic
1117704078 14:58444982-58445004 ACTTGAGAGGCTGAGACTGCCGG + Intronic
1118028606 14:61797130-61797152 TCTTGAGTAGCTGAGTCTACAGG + Intergenic
1118115280 14:62769089-62769111 AGTTGAAAAACTGAGGCTGCAGG + Intronic
1118650551 14:67888467-67888489 TCTTGAGTAGCTGAGACTGCAGG - Intronic
1118870208 14:69735089-69735111 ACTTGAGTAGCTGAGACTACAGG + Intronic
1119370224 14:74133979-74134001 AGTTGAGGTCATGACTCTGCAGG - Intronic
1120282822 14:82460583-82460605 ACTTGGGAAGCTGAGTCTGGAGG + Intergenic
1121465791 14:94114871-94114893 ATTGGAGGAGGTGAGTCTGTGGG + Exonic
1122449844 14:101796840-101796862 ACTTGAGGAGCAGAGGCAGCAGG - Intronic
1122672932 14:103385768-103385790 AGTGGCGGAGCCGAGCCTGCGGG - Exonic
1123023326 14:105412192-105412214 AGCCAAGGAGCTGAGTCTCCAGG - Exonic
1202911165 14_GL000194v1_random:117783-117805 AGTTGAGTAGCTGGGACTACAGG - Intergenic
1123862583 15:24484229-24484251 CGCTGAGGAGCTGGGACTGCAGG + Intergenic
1125854911 15:42939436-42939458 ATATGAGGAGCTGGATCTGCCGG - Intergenic
1125875448 15:43140278-43140300 ATATGAGGAGCTGGATCTGCCGG - Intronic
1126096261 15:45093106-45093128 AGTTAAAGAGCTGAGTATGGAGG + Exonic
1128672320 15:69583427-69583449 AGTTGATGTGCAGATTCTGCAGG - Intergenic
1130412271 15:83656724-83656746 ATTTGAGAAGCTATGTCTGCAGG - Intronic
1131617117 15:94028203-94028225 CTTTGAGGAGCTAAGTCTTCTGG + Intergenic
1131788299 15:95936613-95936635 AGTTGTGGAGCTGAGTATTGGGG - Intergenic
1132056424 15:98653289-98653311 AGTTTAGGAGCTGAGTCTGAAGG + Intronic
1132338360 15:101063170-101063192 GGTTAAAGAGCTGAGTCTGCAGG - Intronic
1132700332 16:1219567-1219589 GGAAGAGGAGCTGAGGCTGCAGG - Intronic
1132725975 16:1338499-1338521 AGTGGACGACCTGAGGCTGCGGG + Intronic
1135426822 16:22344838-22344860 AGTTGAATAGCTGGGACTGCAGG - Intergenic
1135587250 16:23680251-23680273 AGGTGAGTTGCTGAGCCTGCAGG + Exonic
1136065801 16:27757515-27757537 AGGTCAGGAGCTGGGTCAGCAGG - Intronic
1136189307 16:28606346-28606368 GGTTGAGGAGTTGGCTCTGCAGG - Intronic
1136477803 16:30524398-30524420 AATGGAGGAGCTGAGGATGCTGG - Exonic
1137275898 16:46933250-46933272 GGTTGAGGGGCTGAGCGTGCTGG + Intergenic
1137700637 16:50495475-50495497 AGAAGAGGAGCTGAGGGTGCAGG + Intergenic
1137975971 16:53032517-53032539 AGTTGGGGGGCTGAGACAGCAGG - Intergenic
1137985021 16:53099949-53099971 AGGTGGGGAGTTGAGTCAGCTGG + Intronic
1138463961 16:57173308-57173330 AGTTGAGGAACTGAGACTCAGGG - Intronic
1139020150 16:62738875-62738897 AGTTGGGGAGCTGGGCCTACTGG - Intergenic
1140435020 16:74939868-74939890 AGCTGAGTAGCTGGGACTGCAGG - Intronic
1141737106 16:85861050-85861072 GGTTGGGGAGCAGAGGCTGCAGG + Intergenic
1142255794 16:89013293-89013315 AGTTTTGGAGCTGGGGCTGCAGG + Intergenic
1142422083 16:89977732-89977754 CGTTCAGAAGCTGACTCTGCAGG + Intergenic
1143616123 17:8050874-8050896 AGTTAAAGAGCTGACTATGCAGG + Intergenic
1145369497 17:22297425-22297447 ATATGCAGAGCTGAGTCTGCAGG + Intergenic
1146738226 17:35258110-35258132 AGTTGAGGAGCTGAGTCTGCTGG - Intronic
1147739606 17:42663518-42663540 AGTTGAGGGGCTGGGTGTGGTGG + Intronic
1148482373 17:47968444-47968466 AGCTGAGTAGCTGGGACTGCAGG + Intronic
1148827847 17:50407342-50407364 AGTAGAGTAGCTGAGACTACAGG - Intergenic
1150628367 17:66858429-66858451 AGTTGAGGAGCTGGGGCTATCGG - Intronic
1152285172 17:79408356-79408378 AGATGAGGAGGTGAGTCCACGGG + Intronic
1152692837 17:81728259-81728281 AGTTGAGTATCTGGGACTGCAGG + Intergenic
1156329156 18:36102807-36102829 AGTTGAGTAGCTGGGACTACAGG + Intergenic
1156444792 18:37228154-37228176 AGATGAGGAGCTGGTTCTTCTGG + Intronic
1157576006 18:48743948-48743970 CGTTGAGGGGCTAAGTCTCCTGG + Intronic
1157605429 18:48923200-48923222 AGAGGAGGAGCTGGGGCTGCAGG - Intronic
1161040851 19:2110093-2110115 CGTTGAAGAGCCGACTCTGCAGG - Intronic
1161897017 19:7090037-7090059 GGTAGAGGAGGTGAATCTGCTGG + Intergenic
1162365617 19:10247311-10247333 AGTTCAGGAGGGGAGTCTACAGG - Intergenic
1162592199 19:11599230-11599252 AGTGGAGGAGCTGGGTGTCCTGG + Intronic
1162862101 19:13513989-13514011 AGCTGAGTAGCTGAGACTACAGG + Intronic
1163497162 19:17653305-17653327 ATTTCAGGAGCTGAGTGTGGTGG - Intronic
1163535912 19:17876316-17876338 AGTTGAGAGGCTGAGGCTGGAGG + Intronic
1164263004 19:23584969-23584991 AGTAGAGTAGCTGGGACTGCAGG - Intronic
1165347525 19:35258145-35258167 AGTTGAGAAGCACAGACTGCTGG + Intronic
1166116389 19:40657793-40657815 TCTTGAGTAGCTGAGACTGCAGG + Intergenic
1166971670 19:46572864-46572886 ACAGGAGGAGATGAGTCTGCTGG + Intronic
1167340981 19:48915905-48915927 ACCTGAGTAGCTGAGACTGCAGG + Intronic
1167399135 19:49253280-49253302 AGATGGCGAGCTGAGTCTCCAGG + Intergenic
1167430495 19:49451484-49451506 ATTTGAGGAGCTGCTGCTGCAGG - Exonic
1167712669 19:51122042-51122064 AGCTGAGGAGCTTAGACTGAGGG - Intergenic
1167804671 19:51772625-51772647 TCTTGAGTAGCTGAGACTGCAGG + Intronic
925678002 2:6386541-6386563 AGTTGGGGAATTGAGGCTGCTGG - Intergenic
926020943 2:9495241-9495263 AGTTGTGGAGCTTTGGCTGCAGG - Intronic
926791306 2:16574694-16574716 ACATGTGGTGCTGAGTCTGCAGG + Intronic
929624819 2:43395878-43395900 AGTTGAGTAGCTGGGACTACAGG + Intronic
929683851 2:44017593-44017615 AGTTGAGGGGCTGAGGCGGGAGG + Intergenic
931515477 2:63048518-63048540 AGGTCAGGTGCTGAGGCTGCAGG + Intergenic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
937276219 2:120685773-120685795 GCTTGAGAAGCTGAGGCTGCAGG - Intergenic
937994866 2:127685638-127685660 AGTTGTGGAGCTGAGAGTACAGG + Intergenic
938605425 2:132887768-132887790 TCTTGAGTAGCTGAGACTGCAGG + Intronic
940179298 2:150914235-150914257 CTTTGAGGTGCTGAGTCTGGGGG + Intergenic
940682140 2:156800226-156800248 ATTTGAGGAGCTGAGTGTTTGGG - Intergenic
940767471 2:157805930-157805952 ACTTGAGGGGCTGAGGCAGCAGG - Intronic
940957425 2:159743797-159743819 ACTTGAGGGGCTGAGGCTGGAGG + Intronic
941889171 2:170560369-170560391 ACTTGGGGATCTGAGTCTGTGGG - Intronic
942210133 2:173661730-173661752 AGTTCAGGAGGAGAGTCTGGGGG + Intergenic
945603390 2:211895364-211895386 ACTTGGGAAGCTGAGTCTGAAGG - Intronic
945663131 2:212710495-212710517 AGTGGAGGAGCTGACTGTGCAGG + Intergenic
946334519 2:219028320-219028342 AGGTGAGGTGCTGAGGCTTCAGG + Exonic
947061448 2:226171154-226171176 AGTGGCTGAGCTGAGTCTGTAGG + Intergenic
947138223 2:226996026-226996048 AGCTGAGGAGCTGAGGCGCCGGG - Exonic
947294870 2:228619204-228619226 AGTTGACTTGCTGAGTCTTCTGG + Intergenic
947442944 2:230139368-230139390 ACTTGGGGGGCTGAGTCTGGAGG - Intergenic
1169351174 20:4869173-4869195 CCTTGAGTAGCTGAGACTGCAGG - Intronic
1169567274 20:6868930-6868952 ATTTTAGGAGCTAAGACTGCAGG + Intergenic
1171132447 20:22666123-22666145 ATGTGAGGAGCAGAGTCTCCAGG + Intergenic
1171284171 20:23924030-23924052 AGATGAGGAGATGGGTCAGCTGG + Intergenic
1172029389 20:31970974-31970996 ACTTGAAGAGCTGAGACTCCAGG + Intronic
1172135135 20:32681559-32681581 GGTAGAGGAGCTGACTCAGCCGG - Intergenic
1173742350 20:45409945-45409967 TTTGGAGGAGCTGAGCCTGCCGG + Exonic
1174062578 20:47843221-47843243 ACTGGAGGAGCTGAGGCTGCGGG - Intergenic
1174073057 20:47912277-47912299 ACTGGAGGAGCTGAGGCTGTGGG + Intergenic
1174766772 20:53261956-53261978 AGATGAGGAGCAGAATCTGGTGG + Intronic
1175071316 20:56336333-56336355 TCTTGAGTAGCTGGGTCTGCAGG - Intergenic
1175447684 20:59035480-59035502 AGTTGAGGACCAGATCCTGCAGG - Intronic
1176388302 21:6150662-6150684 AGCTGAGGGGCTGGCTCTGCTGG + Intergenic
1176962984 21:15180687-15180709 AGCTGAGTAGCTGGGACTGCAGG + Intergenic
1179015718 21:37593091-37593113 TCTTGAGTAGCTGAGTCTACAGG + Intergenic
1179502193 21:41816780-41816802 AGTTGTGCAGCTGTGTGTGCAGG - Intronic
1179548149 21:42125787-42125809 AGTGGAGGGGCTGAGGGTGCAGG + Intronic
1179735170 21:43387586-43387608 AGCTGAGGGGCTGGCTCTGCTGG - Intergenic
1180691760 22:17722355-17722377 AGTTGAGTAGATGAGACTACAGG + Intronic
1181065111 22:20301972-20301994 ACTTGAGTAGCTGGGTCTACAGG + Intergenic
1181997634 22:26895381-26895403 AGTAGTGGAGCTGAGACTCCAGG - Intergenic
1183023199 22:35043823-35043845 GGCTGAGGAGCTGAGTGGGCGGG - Intergenic
1183074948 22:35421002-35421024 ACCTGAGGAGCTGGGTCTACAGG - Intronic
1183165062 22:36141274-36141296 TGCTGAGGAGCTGAGGCGGCAGG - Exonic
1183999578 22:41663226-41663248 TGCTGAGTAGCTGAGACTGCAGG + Intronic
1184030435 22:41891206-41891228 AGTTGAGGAGCTGAGCAGGGAGG - Intronic
1184393668 22:44219922-44219944 TGGTGAGGGGCTGAGTGTGCTGG + Intergenic
1184647406 22:45903627-45903649 ACCTGAGGAGCTGACCCTGCTGG - Intergenic
951919352 3:27837051-27837073 AGTTGACTTGCTGAGTCTGCTGG - Intergenic
954958439 3:54542639-54542661 AGTAGACTTGCTGAGTCTGCCGG - Intronic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
955284420 3:57625025-57625047 ACCTGAGTAGCTGAGACTGCAGG + Intergenic
955910997 3:63860160-63860182 AGATGAGTAGCTGAGACTACAGG + Intronic
957957427 3:87206102-87206124 AGTTGAGCAGGTGGGTCTGAGGG + Intergenic
962417477 3:135196350-135196372 TGTTGATGAGCTGAGCTTGCAGG + Intronic
962828698 3:139121151-139121173 AGTTAAGGAGCTCACTCTCCAGG - Intronic
964380323 3:156092169-156092191 AGATGAGAAACTGAGTCTGTGGG - Intronic
966275298 3:178158566-178158588 AGTTGGGAAGCTGAGTCAGGAGG - Intergenic
967336674 3:188351873-188351895 AGTAGAAGAGCTCAGTCTTCTGG - Intronic
970221305 4:13814801-13814823 ACTTAAGGAGCTGAGACTGCAGG + Intergenic
971080146 4:23200828-23200850 AGTTTTGGATCTGAGTTTGCTGG - Intergenic
973264448 4:48197613-48197635 AGATGGGGAGCTGAGGCTGAGGG + Intronic
974853431 4:67430641-67430663 AGCTGACTAGCTGAGTCTTCTGG + Intergenic
975670183 4:76772711-76772733 ATATGAGGTGCTGTGTCTGCTGG + Intronic
975868014 4:78745726-78745748 AGTTGAGGTGCTGAATTTGGAGG + Intergenic
979069819 4:116187823-116187845 AATAGAAGAGCAGAGTCTGCAGG - Intergenic
979918135 4:126465166-126465188 AGTAGACTAGCTGAGTCTTCTGG - Intergenic
980122278 4:128740303-128740325 ACTTGGGGAGCTGAGGCAGCAGG + Intergenic
981805277 4:148708046-148708068 AGTTGAGTAGCTGGGACTACAGG + Intergenic
982437345 4:155394404-155394426 TCTTGAGTAGCTGAGACTGCAGG + Intergenic
982660861 4:158205154-158205176 TGTTGAGTAGCTGGGACTGCAGG - Intronic
982740879 4:159055599-159055621 AATTGAGGAGCTGAGGCTGGAGG + Intergenic
983058122 4:163123503-163123525 ACTTGAGTAGCTGAGACTACAGG + Intronic
983180751 4:164645736-164645758 TCTTGAGGAGCTAAGACTGCAGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
986278406 5:6302175-6302197 TGTTGTGCAGCTGGGTCTGCGGG - Intergenic
986880290 5:12161611-12161633 AGCTGTGGAGGTGAGACTGCTGG + Intergenic
988752092 5:34198108-34198130 AGCTGAGTAGCTGAGACTACAGG - Intergenic
991251302 5:64564661-64564683 ATTTTAGGAGGTAAGTCTGCAGG - Intronic
991739857 5:69658924-69658946 AGCTGAGTAGCTGAGACTACAGG - Intergenic
991757642 5:69894253-69894275 AGCTGAGTAGCTGAGACTACAGG + Intergenic
991791432 5:70238665-70238687 AGCTGAGTAGCTGAGACTACAGG - Intergenic
991819320 5:70535049-70535071 AGCTGAGTAGCTGAGACTACAGG - Intergenic
991837045 5:70770135-70770157 AGCTGAGTAGCTGAGACTACAGG + Intergenic
991883881 5:71239007-71239029 AGCTGAGTAGCTGAGACTACAGG - Intergenic
993217849 5:85048646-85048668 AGTTGCGTGGCTCAGTCTGCTGG - Intergenic
993783706 5:92101892-92101914 AGTAGAGTAGCTGAGACTACAGG - Intergenic
994066755 5:95552310-95552332 AGTTGAGTAGCTCAGTTTGGAGG - Intronic
995457245 5:112365319-112365341 TCTTGAGTAGCTGAGTCTCCAGG + Intronic
997161984 5:131618512-131618534 TCCTGAGTAGCTGAGTCTGCAGG - Intronic
998657011 5:144192667-144192689 AGTTGAAGAGCTGTGAATGCTGG + Intronic
1000986765 5:167869062-167869084 AGTGGAAGGGCTCAGTCTGCTGG + Intronic
1001759705 5:174197277-174197299 AGTGGAGGAGCTGAGATTGGAGG - Intronic
1002437314 5:179239532-179239554 AGATGAGGTGCAGATTCTGCTGG + Intronic
1002680047 5:180954631-180954653 AGTCGATGAGCTGAGTCTGGAGG + Intergenic
1002872898 6:1183405-1183427 ACTGGAGGAGCCGAGTGTGCAGG + Intergenic
1003879567 6:10467742-10467764 TCTTGAGTAGCTGGGTCTGCAGG - Intergenic
1005550254 6:26904822-26904844 AGCTGAGTAGCTGAGACTACAGG - Intergenic
1005666803 6:28065852-28065874 ATTTGATGAGCTGAGACAGCAGG - Intergenic
1006652935 6:35566456-35566478 AGTGGGGGAGCTGAGCCTCCAGG - Intergenic
1007058385 6:38912174-38912196 ACTTGAGGGGCTGAGTATGGTGG + Intronic
1007192359 6:40030437-40030459 AGTTGACTTGCTGAGTCTTCTGG + Intergenic
1007756775 6:44104557-44104579 AGATGAGGAACTGGGTCTGGAGG + Intergenic
1010404916 6:75493797-75493819 TGTTGAGGAGCTGAGCTCGCGGG + Intergenic
1010925048 6:81734858-81734880 AGATGAGGAGCTGAGCATGAGGG + Intronic
1011683526 6:89805416-89805438 ACCTGAGGAGCTGAGACTACAGG - Intronic
1011700711 6:89951700-89951722 TGTTCAGGAGCTGGGTCTGCAGG + Exonic
1013084118 6:106841013-106841035 AGATGAGGAGGTGGGTCTGGGGG + Intergenic
1013654571 6:112232224-112232246 AATTAAGGAGCTGAGTGTTCAGG - Intronic
1014461178 6:121697591-121697613 CGTTGAGTAGCTGGGACTGCAGG - Intergenic
1015140779 6:129929051-129929073 ACTGGAGAGGCTGAGTCTGCCGG - Intergenic
1016654900 6:146507519-146507541 TGTTGGGGAGCTGAATCTGTGGG + Intergenic
1017356322 6:153513473-153513495 AGTTGACTTGCTGAGTCTTCTGG - Intergenic
1017555265 6:155558258-155558280 AATTGGGGAGCTAAGTTTGCAGG - Intergenic
1019260986 7:81895-81917 AGATGAGGAACTGAGGATGCAGG + Intergenic
1019437201 7:1028343-1028365 TGTGGAGGCGCTGAGGCTGCTGG - Intronic
1019761827 7:2818637-2818659 ACTTGAGGAGCTGGGACTACAGG - Intronic
1021071542 7:16248213-16248235 ACTTGAGTAGCTGAGGCTACAGG - Intronic
1023990061 7:45123563-45123585 AGATCAGGAGCTGAGCCTGTGGG - Intergenic
1024092991 7:45962740-45962762 AGCTGAGTAGCTGAGACTACAGG + Intergenic
1024970693 7:55067041-55067063 AGGTGAGGAGCCGAGGATGCAGG - Intronic
1026511468 7:71030913-71030935 AGTTAAGGGGCTGAGTGTGGTGG + Intergenic
1026760800 7:73124332-73124354 AGTTCAGCAGCAGAGTCTCCAGG + Intergenic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1027037143 7:74933127-74933149 AGTTCAGCAGCAGAGTCTCCAGG + Intergenic
1027086420 7:75268324-75268346 AGTTCAGCAGCAGAGTCTCCAGG - Intergenic
1027278349 7:76586064-76586086 AGTTGAGGAGCTGGAATTGCAGG - Intergenic
1027561760 7:79739755-79739777 AGTTGGGCTGCTGAGTCTGGTGG + Intergenic
1029032707 7:97485691-97485713 AGTTGAAGAGGTGAGTTAGCAGG + Intergenic
1032145021 7:129371507-129371529 AGCTGAGGAGCAGAGGCTCCAGG - Intronic
1033154730 7:138947133-138947155 AGTTGAGCAGCTGAGTTTCTTGG + Intronic
1033166325 7:139041527-139041549 AGTTCAGGTGCAGAGTCTGCAGG - Intergenic
1034451728 7:151140810-151140832 ATTTGTGGGGCTTAGTCTGCCGG - Intronic
1035196642 7:157227260-157227282 AGGGGAGGAGCTGAGTTTGTGGG + Intronic
1035734180 8:1875497-1875519 AGCTGAGTTGCTGAGACTGCTGG + Intronic
1036022985 8:4869309-4869331 AGTGGAGGAGTTGTGTCTGTAGG + Intronic
1036221990 8:6929000-6929022 GGCTGAGGACCTGAGTCTGGGGG + Intergenic
1037527563 8:19741598-19741620 AGTCGGGGAGCTGATCCTGCTGG + Intronic
1037871533 8:22501916-22501938 AGTTAAGAAGCTGAGACTGAAGG + Intronic
1037907485 8:22724077-22724099 AATTGGGGAGCTGAGAGTGCAGG + Intronic
1038077295 8:24090843-24090865 AGTTGAGTAGCTGGGACTACAGG - Intergenic
1038677404 8:29635794-29635816 AGGTGAGGAGCTGCCTCTACCGG + Intergenic
1038888174 8:31689035-31689057 ATTTGAAGATGTGAGTCTGCTGG - Intronic
1039067105 8:33618291-33618313 AGTTGAGTAGCTGGGACTACAGG - Intergenic
1039888549 8:41669418-41669440 ACTTGAGTAGCTGGGACTGCAGG + Intronic
1042478457 8:69276846-69276868 AGTGGATAAGCTGGGTCTGCAGG - Intergenic
1042583361 8:70306768-70306790 ACTTGAGGGGCTGAGGCTGGAGG + Intronic
1042917219 8:73887428-73887450 TCTTGAGGAGCTGAGACTACAGG + Intergenic
1043449138 8:80349265-80349287 AGTAGAGTAGCTGGGTCTACAGG + Intergenic
1043607201 8:82016038-82016060 AGATGAAGAGCAGTGTCTGCAGG + Intergenic
1043939068 8:86175921-86175943 AGTAGTGGAGCTGAATCAGCAGG + Intergenic
1047007517 8:120636114-120636136 TGTTGAGGGGCTGAGTCTGGTGG + Intronic
1047206811 8:122809102-122809124 ACTTCAGGGGCTGAGTCTCCCGG - Intronic
1047324016 8:123819280-123819302 AGGGAAGGAGCAGAGTCTGCAGG + Intergenic
1049177749 8:141204851-141204873 AGTTGAGTAGCTGGGACTGAAGG - Intergenic
1055325111 9:75120648-75120670 AATGGAGGAGCTAAGTCTGTAGG - Intronic
1056758344 9:89396820-89396842 AGTTGAGGCACTCTGTCTGCAGG + Exonic
1056840733 9:89996397-89996419 AGTGGTGGAGCAGAGTCTGCTGG + Intergenic
1059527860 9:115008774-115008796 TGGTCAGGAGCTGAGGCTGCAGG + Intergenic
1061998322 9:134200707-134200729 TGTTGAGTAGCTGAGACTACAGG - Intergenic
1203741137 Un_GL000218v1:1823-1845 ATTTGAGACGCTGAGTCTGGAGG + Intergenic
1187419664 X:19122882-19122904 AGGTGAGCCGCTGAGTCTGGAGG - Intergenic
1188801392 X:34535278-34535300 ACTTGGGAAGCTGAGTCTGGAGG + Intergenic
1189776669 X:44476155-44476177 ATCTGAGGAGCTGAATCTGCTGG - Intergenic
1192190189 X:68986398-68986420 AGGTGGGTAGCTGAGTGTGCAGG - Intergenic
1192584364 X:72307694-72307716 CGTTGAAGAGCTGAGGCTGGGGG + Intergenic
1195363917 X:104109670-104109692 AGTGGAGGCACTGAGACTGCAGG - Intronic
1198707418 X:139463786-139463808 AGTTGGGGAGTTGAGTGTGTGGG - Intergenic
1201375913 Y:13318881-13318903 AGTCGAGTAGCTGAGACTACAGG - Intronic