ID: 1146738980

View in Genome Browser
Species Human (GRCh38)
Location 17:35264594-35264616
Sequence CTGGGGGGTCATGAAGTTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146738980_1146738991 22 Left 1146738980 17:35264594-35264616 CCTATAACTTCATGACCCCCCAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1146738991 17:35264639-35264661 CCCTCGTGATAGTCTTGCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 101
1146738980_1146738989 21 Left 1146738980 17:35264594-35264616 CCTATAACTTCATGACCCCCCAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1146738989 17:35264638-35264660 TCCCTCGTGATAGTCTTGCTTGG 0: 1
1: 1
2: 2
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146738980 Original CRISPR CTGGGGGGTCATGAAGTTAT AGG (reversed) Exonic
901804357 1:11728814-11728836 GTGGCGGGTCATGAAGCTCTGGG + Intergenic
902034234 1:13445169-13445191 CAGGCTGGTCATGAACTTATGGG + Intergenic
902154871 1:14477128-14477150 GTGGGAGGTCATTAAATTATGGG + Intergenic
910408621 1:86915604-86915626 TTGGGGGCTCATGAAGGGATAGG + Intronic
911490598 1:98561235-98561257 CGAGGGGGTTATGAAGTCATGGG + Intergenic
923455524 1:234162109-234162131 CAGGAGGGTCAAGAACTTATGGG - Intronic
1062853762 10:768449-768471 CTGAGGGGTCATTGAGTTTTTGG - Intergenic
1064773884 10:18753767-18753789 GTGGGGGAGCCTGAAGTTATAGG + Intergenic
1065814621 10:29472827-29472849 CTGGGGGATCATGTAGCTTTAGG + Intronic
1067824384 10:49559369-49559391 CTGGGTGGCCATGAAGGTAGGGG + Intergenic
1071208056 10:83306740-83306762 CAAGGGGGTCATGGAGTTTTAGG + Intergenic
1071722773 10:88163984-88164006 CTGGGGGTTCAGGAAGATCTGGG - Intergenic
1075427865 10:122355910-122355932 CTGGGGGGTGAGGAAGGTCTGGG + Intergenic
1075729740 10:124629043-124629065 CTGGGTGTTAATGTAGTTATAGG + Intronic
1076001183 10:126914219-126914241 CTGGGGGGTCCTGAAGGGACAGG + Intronic
1076451966 10:130562158-130562180 CTGGGGGGTCATGCACTCCTGGG + Intergenic
1084044934 11:66563030-66563052 CTCGGGGGTGATGTAGTTCTGGG - Exonic
1089848318 11:121476096-121476118 GTGGGGGGTTATCAAATTATGGG + Intronic
1090366058 11:126206638-126206660 CTGTGAGGTCATGAGGTCATGGG - Intronic
1090818099 11:130315774-130315796 CCGGGGGGTTTTGAAGTTCTTGG + Intergenic
1095878284 12:47105393-47105415 CTGAGGGTTCATGAAGATATTGG + Intronic
1096560125 12:52430115-52430137 CTGGGAGGCCATGAAGTGAATGG - Intronic
1097900945 12:64873377-64873399 ATGGGAGGTCATGAATTTAAAGG + Intronic
1097916807 12:65029595-65029617 TTGGGAGGTCATGAATTTATAGG + Intergenic
1098467334 12:70802659-70802681 ATCTGGGGTCATGAAGCTATTGG + Intronic
1101034769 12:100694555-100694577 CAGGTGGGTCATGAACTTCTGGG + Intergenic
1105733599 13:23245275-23245297 TTGAGGGTTCATGAAATTATAGG - Intronic
1113800534 13:113084219-113084241 CTGGGGGTTCAGGAGGTTCTAGG - Intronic
1116010943 14:39351567-39351589 TTGGGAGGTGATTAAGTTATGGG + Intronic
1116036036 14:39627912-39627934 CTTGAGGATCAGGAAGTTATGGG + Intergenic
1117707222 14:58482844-58482866 CTGGCTGGTCTTGAAGTTCTGGG + Intronic
1118843299 14:69528259-69528281 CTGGGAGGTCATGAAGGACTGGG - Exonic
1121839750 14:97123271-97123293 GTGGGTGCTGATGAAGTTATGGG + Intergenic
1122349335 14:101078396-101078418 CTGGGGGCTCTGGAAATTATGGG - Intergenic
1124249721 15:28098946-28098968 CTGGTGGGCCATGAGGTCATGGG - Intronic
1124937657 15:34187487-34187509 CTGGGTGGCCATGTTGTTATGGG - Intronic
1128061059 15:64736413-64736435 CTGGAAGGTCATGAAGATAATGG + Intergenic
1130697491 15:86145206-86145228 CTGGGTGGACATGAATTTTTGGG + Intronic
1131076464 15:89498228-89498250 CAGGGTGGTCTTGAACTTATGGG + Intergenic
1131724375 15:95205889-95205911 GTGGGAGGTCATTAAATTATGGG + Intergenic
1133313565 16:4867619-4867641 CTGAGGGGGAAAGAAGTTATTGG + Intronic
1133502245 16:6377409-6377431 CTGGGGGGCCATGGATTTCTGGG + Intronic
1137735395 16:50719736-50719758 CTGGGGGAAAATGAAGTTGTGGG + Intronic
1139084073 16:63562640-63562662 CTGGTGGATCATGAAGGTGTTGG + Intergenic
1142745974 17:1958409-1958431 CAGGGGAGGAATGAAGTTATTGG - Intronic
1146738980 17:35264594-35264616 CTGGGGGGTCATGAAGTTATAGG - Exonic
1151405085 17:73881042-73881064 CTGGATGGTCATGAACTTAGGGG + Intergenic
1161474532 19:4476923-4476945 CTGGGGGGGCATGAATTTGGCGG + Intronic
1162888724 19:13716425-13716447 TTGGGAGGTGATAAAGTTATGGG - Intergenic
1163103865 19:15112398-15112420 CTGTGGGGTCATGCGGTTGTAGG - Exonic
1165902428 19:39175005-39175027 CTGGGTGGTCATGGAGTTCCTGG + Exonic
1166076729 19:40417868-40417890 CTGGGGAGTCATGAAGTAAAAGG - Intergenic
1167109385 19:47450041-47450063 CTGAGGGGTCATGGAGTAAGTGG + Intronic
932236110 2:70122363-70122385 TTGGAGGATGATGAAGTTATGGG - Intergenic
937518066 2:122678437-122678459 TTGGGGTGTCATGCAGTTGTAGG + Intergenic
937820460 2:126304394-126304416 CTGGGTGATAATGAAGTTATGGG + Intergenic
938079431 2:128361782-128361804 CTGGAGGGTCATGCAGGTAGGGG + Intergenic
939899732 2:147837618-147837640 GTGAGGGGTAAAGAAGTTATGGG - Intergenic
942381748 2:175398966-175398988 CAGGGGAGTCATGAGGATATTGG - Intergenic
944918924 2:204390252-204390274 CTGTGGGCTGATGAAGTTAAGGG - Intergenic
945609806 2:211985911-211985933 CTGGGTGGACATGAAATTTTGGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
948121997 2:235537446-235537468 CTGGGGAGTCATGAGGATGTGGG + Intronic
948398113 2:237662359-237662381 CTGGGTGGACATGAACTTTTGGG + Intronic
948668384 2:239550763-239550785 TTGGGAGGTGATGAAGTCATGGG - Intergenic
1173782915 20:45771568-45771590 CCGTGGGGGCATGATGTTATTGG - Intronic
1179606863 21:42522225-42522247 TTGGGTGGACATGAAATTATGGG + Intronic
1184133869 22:42534619-42534641 CTGGGGGGTGATGAAGTTTTAGG - Intergenic
1184282190 22:43443521-43443543 CTGGTGGGGTATGAAGTTAGGGG + Intronic
1184282539 22:43446411-43446433 CTGAGGGGACATGAAGGGATGGG + Intronic
952835490 3:37598544-37598566 CAGGGGGGTCAGGAAGATCTTGG + Intronic
955117121 3:56016853-56016875 CTCTGGGGTAATGAAGTAATTGG - Intronic
955803631 3:62710928-62710950 CTGGGGGATCCTGAAGGAATAGG - Intronic
964364476 3:155934586-155934608 CTGGGTGGGCATGAAGTTTTGGG + Intronic
972180399 4:36457798-36457820 CTGGGAGGTAATTAAATTATGGG - Intergenic
975713914 4:77187611-77187633 TTGGGGGGTGATGAGGTTACTGG + Intronic
975719608 4:77236950-77236972 CTGGGTGGTCATGAAGGCAAGGG + Intronic
976463175 4:85336625-85336647 CTTGGGGGGCATGAATTTAGGGG - Intergenic
977556488 4:98492095-98492117 CTGAGGGGTCATGGAGTGAAAGG - Intronic
980125115 4:128766651-128766673 AGGGGGGGTCATGAAGTCAGTGG + Intergenic
982396214 4:154918514-154918536 GTGGAGGGTCATGAAGTGCTCGG + Intergenic
983594060 4:169446512-169446534 CTGGGTGGTCTTGATGTTATGGG - Intronic
983983511 4:174028625-174028647 TTTGGGAGTCATGAAGTTGTAGG + Intergenic
985602649 5:843254-843276 CTGTGGGGCCATGTAGTTGTGGG - Intronic
986053465 5:4112147-4112169 CTGGGAGGTCATTAAGTCATGGG - Intergenic
991001149 5:61784332-61784354 CTGATGGGTCATGAAGTAAAGGG + Intergenic
995318394 5:110802679-110802701 TTGGGGGGATATGAAATTATTGG + Intergenic
995469951 5:112490800-112490822 CTTGGTGGACATGAAGTTACAGG - Intergenic
996672669 5:126136233-126136255 TTGGGAGGTGATGAGGTTATAGG + Intergenic
996826107 5:127683118-127683140 CAAGGGTGTCATGAAGTTGTTGG + Intergenic
997658361 5:135571978-135572000 CTGGGGGTTCCTGCAGTTCTGGG - Intronic
998871630 5:146558339-146558361 GTGGGGGGTGATTAAATTATGGG - Intergenic
1003290908 6:4776992-4777014 CCGGGGGGTCCTGAAGTTGCCGG + Intronic
1004080436 6:12387083-12387105 CTAGGGGATCATGAAGAAATGGG - Intergenic
1005612248 6:27537685-27537707 CTTCATGGTCATGAAGTTATTGG + Intergenic
1007069874 6:39028627-39028649 CTGGGTGGACATGAAGTTTTGGG + Intronic
1007173099 6:39878317-39878339 CTGGAAGGGCATGGAGTTATGGG - Intronic
1007364858 6:41384233-41384255 CTGGGTGGACATGAATTTTTGGG + Intergenic
1016709473 6:147153442-147153464 ATGCGTGGACATGAAGTTATTGG - Intergenic
1020665035 7:11030503-11030525 GTGGGGTGTAATGGAGTTATGGG + Intronic
1020834214 7:13128083-13128105 CTGGGTGGACATGAATTTTTTGG + Intergenic
1022099467 7:27160713-27160735 CTGGGCGGTCATCAAGTTCTGGG + Intergenic
1025874141 7:65464266-65464288 CTGGAAGATCATGAATTTATGGG + Intergenic
1037007015 8:13794675-13794697 CTGGGAGGTAATTAAATTATGGG + Intergenic
1037019477 8:13951864-13951886 CTGGGAGGTAATTAAATTATGGG - Intergenic
1038009117 8:23459882-23459904 CTGGGTGGACATGAATTTTTTGG + Intergenic
1038517875 8:28202691-28202713 CCGGGGGGGCATGAAGGGATTGG - Intergenic
1038593032 8:28858127-28858149 CTGTGGGGTCATGAATTTCCTGG - Intronic
1042870090 8:73390442-73390464 TTGGGGGGTGATTAAGTCATGGG + Intergenic
1044030757 8:87233596-87233618 CTGGAGGGTGCTGAAGATATGGG + Intronic
1048695711 8:137025597-137025619 CTTGTGGGTCATGAAGTTCGGGG - Intergenic
1052675003 9:31609875-31609897 CTGAGGTGTAATGAAGGTATTGG - Intergenic
1053138756 9:35668664-35668686 CTTGGGTGTCATCAATTTATAGG + Intronic
1055870247 9:80868645-80868667 CTGGAGTGTCAAGAACTTATGGG - Intergenic
1056376692 9:86020921-86020943 CTTTGTGGTTATGAAGTTATTGG + Exonic
1058668940 9:107344394-107344416 CTGGGGGGCCAGGAATCTATGGG - Intergenic
1058929623 9:109706006-109706028 CTGGGGAGACTTGAAGTTAGAGG - Intronic
1062291800 9:135798654-135798676 CTGGGGGGTGTTGAAGTTCATGG - Intergenic
1194843172 X:98770278-98770300 CTGGGTAGACATGAAGTTTTGGG + Intergenic
1198159002 X:133988381-133988403 CTGGAAGATCATGAATTTATGGG - Intergenic
1201383384 Y:13411699-13411721 CTGGATGGTCATGAACTTCTGGG + Intronic
1201625556 Y:16011144-16011166 CTGAGGTTTCATGAAGTAATTGG + Intergenic