ID: 1146743166

View in Genome Browser
Species Human (GRCh38)
Location 17:35304498-35304520
Sequence AGCTCTCCATGTTAGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146743166_1146743167 15 Left 1146743166 17:35304498-35304520 CCTTTGATCTAACATGGAGAGCT No data
Right 1146743167 17:35304536-35304558 GATCAGACATTAAGTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146743166 Original CRISPR AGCTCTCCATGTTAGATCAA AGG (reversed) Intergenic
No off target data available for this crispr