ID: 1146743297

View in Genome Browser
Species Human (GRCh38)
Location 17:35305369-35305391
Sequence GTGAGGGTGATGGCATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146743297_1146743306 12 Left 1146743297 17:35305369-35305391 CCAGCTCATGCCATCACCCTCAC No data
Right 1146743306 17:35305404-35305426 AAGTTTGACCATTGAAGGCCAGG No data
1146743297_1146743307 18 Left 1146743297 17:35305369-35305391 CCAGCTCATGCCATCACCCTCAC No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743297_1146743310 30 Left 1146743297 17:35305369-35305391 CCAGCTCATGCCATCACCCTCAC No data
Right 1146743310 17:35305422-35305444 CCAGGAAGTGGACTTCCTCCTGG No data
1146743297_1146743305 7 Left 1146743297 17:35305369-35305391 CCAGCTCATGCCATCACCCTCAC No data
Right 1146743305 17:35305399-35305421 TGGGTAAGTTTGACCATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146743297 Original CRISPR GTGAGGGTGATGGCATGAGC TGG (reversed) Intergenic
No off target data available for this crispr