ID: 1146743298

View in Genome Browser
Species Human (GRCh38)
Location 17:35305379-35305401
Sequence CCAGGGCTCTGTGAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 19, 1: 43, 2: 62, 3: 75, 4: 613}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146743298_1146743305 -3 Left 1146743298 17:35305379-35305401 CCATCACCCTCACAGAGCCCTGG 0: 19
1: 43
2: 62
3: 75
4: 613
Right 1146743305 17:35305399-35305421 TGGGTAAGTTTGACCATTGAAGG No data
1146743298_1146743306 2 Left 1146743298 17:35305379-35305401 CCATCACCCTCACAGAGCCCTGG 0: 19
1: 43
2: 62
3: 75
4: 613
Right 1146743306 17:35305404-35305426 AAGTTTGACCATTGAAGGCCAGG No data
1146743298_1146743311 27 Left 1146743298 17:35305379-35305401 CCATCACCCTCACAGAGCCCTGG 0: 19
1: 43
2: 62
3: 75
4: 613
Right 1146743311 17:35305429-35305451 GTGGACTTCCTCCTGGACACTGG No data
1146743298_1146743310 20 Left 1146743298 17:35305379-35305401 CCATCACCCTCACAGAGCCCTGG 0: 19
1: 43
2: 62
3: 75
4: 613
Right 1146743310 17:35305422-35305444 CCAGGAAGTGGACTTCCTCCTGG No data
1146743298_1146743307 8 Left 1146743298 17:35305379-35305401 CCATCACCCTCACAGAGCCCTGG 0: 19
1: 43
2: 62
3: 75
4: 613
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146743298 Original CRISPR CCAGGGCTCTGTGAGGGTGA TGG (reversed) Intergenic
900127307 1:1074263-1074285 CCAGAGCTCTGTGCGGGTGACGG - Exonic
900466814 1:2829790-2829812 CCCGGGGTCTCTGAGGGTGGAGG + Intergenic
901108132 1:6773604-6773626 CCAATGCTTTGTGAGGCTGATGG - Intergenic
901893860 1:12292007-12292029 CCAGCACTCTGGGAGGCTGAGGG + Intronic
902188717 1:14745161-14745183 CCAGGGCACTGGGATGGTGCTGG - Intronic
902401687 1:16161322-16161344 CCAGCACTTTGGGAGGGTGATGG - Intergenic
902756097 1:18550209-18550231 CCAGGGCTCTGGGTTGGTAAGGG - Intergenic
902838294 1:19060309-19060331 CCAGGGATCTGTGGTGGAGAGGG - Intergenic
902865226 1:19273603-19273625 CCAGGCGTCAGTGAGGGTGCTGG + Intergenic
902867338 1:19288236-19288258 CCAGGCGTCAGTGAGGGTGCTGG + Intronic
903122811 1:21227336-21227358 ACAGGGCTCTGTGTGGATAAGGG + Intronic
903223690 1:21883132-21883154 CCAGGGCTCTGAGATGTTGTGGG - Intronic
903810889 1:26034606-26034628 CCAAGGAGCTGTGAGGGAGAGGG + Intronic
903956421 1:27029228-27029250 CCAAGGCTCAGTGAAGGGGAAGG - Intergenic
904091703 1:27949528-27949550 CCAGGACAGTTTGAGGGTGATGG - Intronic
904214345 1:28907445-28907467 CCAGCGCTTTGGGAGGCTGAGGG - Intronic
904385679 1:30140585-30140607 CCAGGCCTGTGTGAGGATGGTGG - Intergenic
904498054 1:30898559-30898581 CCAGGGTTCAGGGAGGGTGGTGG + Intronic
904660030 1:32077160-32077182 CCAGGCCTCTCAGAGGGGGAAGG + Exonic
905529407 1:38664712-38664734 CCAGCACTCTGGGAGGCTGAGGG + Intergenic
905760145 1:40549341-40549363 CCAGTGCTTTGGGAGGCTGAAGG - Intergenic
905892876 1:41528182-41528204 GCAGGGGTGTGTGAAGGTGAGGG - Intronic
905913574 1:41670231-41670253 CCAAGGCTCTGTGAGGGGCAGGG + Intronic
906319579 1:44807919-44807941 TCAGGGCTATGTGCGGGGGAGGG + Intergenic
906507191 1:46388968-46388990 CTGGGGCTCTGTGAGGGTGATGG + Intergenic
906583484 1:46955692-46955714 CCGAGGCACTGTGAGGGTGATGG - Intergenic
907037441 1:51228949-51228971 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
907053365 1:51344550-51344572 CCAGGGCTCTGTGTGCTTGAGGG - Intronic
907269887 1:53284782-53284804 CCTTGGCTCTTTGAGGGTGGAGG - Intronic
907323185 1:53618536-53618558 GCAGGCCTCTGTGAGGGGCAGGG + Intronic
907418687 1:54332055-54332077 CCAGGGCTCAGAAAGGTTGAAGG + Intronic
907505540 1:54915419-54915441 CCAGGGCTCTGTGAGGGTGATGG + Intergenic
907512213 1:54970179-54970201 CCAGAGCCCTGTGAGGGTTGGGG + Intergenic
908200915 1:61794392-61794414 CCAGCGCTTTGGGAGGCTGAGGG - Intronic
908459567 1:64336317-64336339 CCAGTGCTTTGGGAGGCTGAGGG - Intergenic
908540261 1:65115455-65115477 TCAGTGCTTTGGGAGGGTGATGG - Intergenic
908543850 1:65146566-65146588 CCAGGACTCAGAGAAGGTGAGGG - Intergenic
908757741 1:67484593-67484615 CCAGGGCTCTGTGGGGGTGGAGG + Intergenic
908847267 1:68337816-68337838 CCAGAACTCAGTGAGGGTCAGGG - Intergenic
908907133 1:69028964-69028986 CCTGGGACCTGTGAGGGTTAAGG - Intergenic
909856527 1:80539903-80539925 CCAGCGCTTTGGGAGGCTGAGGG - Intergenic
910591092 1:88928685-88928707 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
910802124 1:91157479-91157501 CCTGGTCCCTGTGCGGGTGATGG + Intergenic
910894043 1:92048950-92048972 CCAGTGCTGTGAGAGGCTGAGGG - Intronic
911172699 1:94785723-94785745 CCAGCACTTTGGGAGGGTGAAGG - Intergenic
912346505 1:108968064-108968086 CCAGGACTTTGGGAGGCTGAGGG - Intergenic
912463861 1:109855837-109855859 CTGGAGCTCTGTGAGGGTGATGG + Intergenic
912928925 1:113938657-113938679 CCAGCACTTTGGGAGGGTGAGGG + Intronic
913470406 1:119180516-119180538 CTGGGGCTCTGTGAGGGTGATGG + Intergenic
914918119 1:151830740-151830762 CCTGGGCTCTGCTGGGGTGAGGG + Intronic
915014871 1:152723729-152723751 GCAGGGCTCTGTTGGGGGGAGGG + Intergenic
915106748 1:153539632-153539654 CCAGGGCTCTCTGATGGTGCTGG - Intronic
915401468 1:155625089-155625111 CTGGGGCTCTGTGATGGTGATGG + Intergenic
915494148 1:156269355-156269377 CCAGGACTTTGGGAGGTTGAGGG - Intronic
915585082 1:156840126-156840148 GCGGGGCTGGGTGAGGGTGAGGG + Exonic
915591834 1:156875280-156875302 TCTGGGCTCTGTGGGGGTGGAGG + Intronic
915615484 1:157034415-157034437 CCAGAACTCTGAGAGGCTGAAGG + Intronic
915957551 1:160234705-160234727 CCAGGGTTCTGTAATGGTAATGG - Intronic
916127760 1:161586675-161586697 CCAGGGCTCTGTGTTTGGGAGGG - Intronic
916137679 1:161668479-161668501 CCAGGGCTCTGTGTTTGGGAGGG - Intronic
916189970 1:162168978-162169000 GCATGGCTCTCTGAGGGAGACGG - Intronic
918255926 1:182747147-182747169 CCAGTGCTTTGTGAAGCTGAGGG - Intergenic
919058999 1:192607084-192607106 CCAGCTCTCTGGGAGGCTGAAGG + Intergenic
919437370 1:197578492-197578514 CCAGCACTTTGTGAGGCTGATGG - Intronic
919547639 1:198943396-198943418 CCAGGGGTCCGTGAAAGTGAGGG + Intergenic
919724468 1:200873036-200873058 CCAGGGCTCTGTGGGGGCCATGG - Exonic
920328267 1:205184321-205184343 CCAGCACTTTGGGAGGGTGAGGG + Intronic
921092703 1:211858475-211858497 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
921167504 1:212517442-212517464 GCTGGGCACTGTGAGGGTGCTGG + Intergenic
921274719 1:213507605-213507627 CCAGGGCTCTGAGCGGTGGATGG - Intergenic
922470450 1:225873769-225873791 CCAGGGCTGAGTGAGGATCAAGG - Intronic
922537098 1:226389467-226389489 CCAGAGTTCTGTGAGGCAGATGG - Intronic
922684629 1:227629628-227629650 CTGGGGCTCTGTGAGGGTGATGG + Intronic
922726864 1:227926786-227926808 GCAGGGCCATGTGAGGGTGTGGG - Intronic
923282331 1:232455937-232455959 CTAGGGCTTATTGAGGGTGAAGG + Intronic
923469374 1:234277188-234277210 CCAGGGCTCTGTGTGGCCGGCGG + Intronic
923518646 1:234719276-234719298 CCACGGCTCTGGAAGGGTAAAGG - Intergenic
924448103 1:244152695-244152717 ACAGGGCACTGTGAGAGTGCAGG + Intergenic
924738835 1:246782698-246782720 CCAGGGCTGTGTGAGGGTTGGGG - Intergenic
1062833183 10:619647-619669 CCTGGGGTCTGTGTGGGTGAGGG - Intronic
1063028321 10:2205432-2205454 CCAGGACTGTGTGAGGACGATGG - Intergenic
1063617779 10:7616576-7616598 CCAGTGCTTTGGGAGGCTGAGGG + Intronic
1064394342 10:14969195-14969217 CCAGTGCTTTGGGAGGCTGAGGG + Intronic
1064692377 10:17931205-17931227 CCAGTGCTTTGGGAGGCTGAAGG - Intergenic
1065199555 10:23300062-23300084 CTGGGGCTCTGTGAGGGTGATGG + Intronic
1066503291 10:36015599-36015621 CCAGGGCTATGTCAGTGTGAAGG + Intergenic
1067111725 10:43406159-43406181 CCAGAGCTCAGTGGGGGAGAGGG + Intronic
1068142674 10:53027085-53027107 CTGGGGCTCTGTGAGGTTGATGG + Intergenic
1068791761 10:61037337-61037359 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
1068938559 10:62658686-62658708 CGAGGGATGTGTGAGTGTGAAGG - Intronic
1069587771 10:69620010-69620032 CCAGGGCTCTAGGAGGGGAAGGG + Intergenic
1069779072 10:70943532-70943554 CCAAAGCTTTCTGAGGGTGATGG + Intergenic
1069859734 10:71462917-71462939 CCCAGGCTCTCTGAGGGTGGAGG - Intronic
1070734610 10:78854891-78854913 CCAGGGAGCTGTGAGGATAATGG - Intergenic
1071093919 10:81951510-81951532 CCAGGTGTCTGTGGGGGTGTTGG - Intronic
1071326960 10:84527324-84527346 CGGGGGCTCTGTGAGGGTGATGG + Intergenic
1071420568 10:85493026-85493048 CTAGGGCTCTGAGAGGGGAAGGG - Intergenic
1071537745 10:86449606-86449628 ACAGGGATCTCTGAGGGTGTGGG + Intronic
1072378042 10:94837750-94837772 CCGGGGTTCTGTGAGGGTGATGG + Intronic
1072399866 10:95086922-95086944 CCAGGGGTCTGTCATGGTGGTGG - Intergenic
1072471868 10:95720601-95720623 CCGGGGCTCTGTGAGGGTGATGG + Intronic
1072817792 10:98526795-98526817 CCAGGGCTCACTGGGGTTGAGGG + Intronic
1073299573 10:102462606-102462628 CCAGGGGCCTGGTAGGGTGAAGG + Intronic
1073434645 10:103508786-103508808 CTAGGGCTCTGTGTGCATGAGGG + Intronic
1074495599 10:113977740-113977762 GTAGGCATCTGTGAGGGTGAAGG + Intergenic
1075003204 10:118812855-118812877 ACTTGGCTCAGTGAGGGTGAGGG - Intergenic
1075249347 10:120851542-120851564 CCAGGAATGTGTGAGGGGGAAGG + Intronic
1075799899 10:125147096-125147118 TCAGGGACCTGGGAGGGTGAAGG + Intronic
1076191961 10:128489423-128489445 CCAGGGCACTGTGAGAATGGTGG + Intergenic
1076404837 10:130204873-130204895 ACAGGCCTCCCTGAGGGTGATGG + Intergenic
1076421343 10:130334670-130334692 TCAGGGTTCTGCGAGGGTGAAGG - Intergenic
1076699811 10:132265548-132265570 CCAGGGCTGTGCGGGGCTGATGG - Intronic
1076990692 11:271965-271987 CCAGGGCTGTGGGAAGGGGATGG - Intergenic
1077125613 11:934372-934394 CCAGCACTCTGGGAGGCTGATGG - Intronic
1077167160 11:1148887-1148909 GCAGAGCCCTTTGAGGGTGATGG + Intergenic
1077985778 11:7349590-7349612 CCTGGGCTCTGGGAAGCTGAGGG - Intronic
1078107206 11:8365842-8365864 CCAGGACTCTGTGGGGTGGAAGG - Intergenic
1078824456 11:14915493-14915515 CCAGTGCTTTGGGAGGCTGAAGG + Intronic
1079887209 11:26003500-26003522 CCGGGGCTCTTTGAGGGTGATGG - Intergenic
1079933676 11:26593537-26593559 CCGGGGCTCTGTGAGGGTGATGG + Intronic
1080431763 11:32206085-32206107 CTATGGCTCTGTGAGGATAAGGG + Intergenic
1081070629 11:38605251-38605273 GCATACCTCTGTGAGGGTGATGG - Intergenic
1081124369 11:39304691-39304713 CAAGGTCTCTTTGAGGGAGATGG + Intergenic
1082258869 11:50062433-50062455 CCAGGACTTTGGGAGGCTGAAGG - Intergenic
1082804768 11:57440817-57440839 CCAGGGCTTTGAGAGGCTGATGG - Intergenic
1082849669 11:57753802-57753824 CCAGGACTTTGGGAGGCTGAGGG + Intronic
1082868363 11:57920326-57920348 TCAGGGCCTTGTGAGGGTCAAGG - Intergenic
1083155923 11:60822722-60822744 CCAGAGCTTTGGGAGGCTGAGGG + Intergenic
1083470723 11:62881915-62881937 CCTGAGCTCTCTGAAGGTGAAGG + Exonic
1083489015 11:63001138-63001160 CCTGGGCTATGTGAGGGGCAGGG - Intronic
1083676462 11:64328313-64328335 CCAGCACTTTGTGGGGGTGAAGG + Intergenic
1083957641 11:65994137-65994159 CCAGCACTTTGTGAGGCTGAGGG + Intergenic
1084106286 11:66982978-66983000 CCAGGATTCTGGGAAGGTGAAGG - Intergenic
1084267580 11:68012781-68012803 CCAGGGGACTGTGAGGGAGGTGG + Intronic
1084318455 11:68359517-68359539 ACAGGGGACAGTGAGGGTGATGG + Intronic
1084408340 11:68991734-68991756 CCTGGCACCTGTGAGGGTGATGG + Intergenic
1084552477 11:69854139-69854161 CCAGCACTCTGGGAGGCTGAAGG + Intergenic
1084671954 11:70612134-70612156 CCAGGGGTCTGTGCTGGTGGTGG + Intronic
1084866232 11:72060385-72060407 CCAGTGCTTTGGGAGGCTGAAGG + Intronic
1084952336 11:72673706-72673728 CCAAGGCTATGTGTGTGTGAAGG - Intronic
1084978398 11:72815526-72815548 CCAGGGAGCTGTGAGTCTGAGGG + Intronic
1085051682 11:73383188-73383210 CCAGGGCTGTGGGAGGGGGCAGG + Intronic
1085126159 11:74004120-74004142 CCAGGGCACTGTGAGAGATATGG - Intronic
1085251753 11:75148531-75148553 ACAGGGCTCTGTGAATGTTATGG + Intronic
1085601714 11:77861476-77861498 CCGGGGCTCTGTGAGGGTGATGG + Intronic
1086112775 11:83217588-83217610 CTGGGGCTCTGTGAGGGTGATGG + Intronic
1086441935 11:86836764-86836786 CCAGGGCTCTGTGAGGGTGATGG + Intronic
1086954411 11:92920846-92920868 CCAGGGCTTTTTTTGGGTGAGGG + Intergenic
1087530143 11:99370689-99370711 CCAGGCATGAGTGAGGGTGAAGG + Intronic
1087794192 11:102438299-102438321 CCAGCACTCTGGGAGGCTGAGGG - Intronic
1088317869 11:108525752-108525774 CCAGCTCTCTGTGGGGTTGAGGG + Intronic
1088719142 11:112576520-112576542 CCAAGTCCCTGTGAGGGTGGTGG - Intergenic
1088826715 11:113501484-113501506 CCTGCCCTCTGTGAGGATGAAGG + Intergenic
1088839560 11:113612806-113612828 CCAGTGCTTTGGGAGGCTGAGGG - Intergenic
1088930760 11:114348708-114348730 CTGGGGCTCTGTGAGGGTGATGG + Intergenic
1088952219 11:114583411-114583433 CATTGGCTTTGTGAGGGTGATGG - Intronic
1089680338 11:120115756-120115778 CCTGGGCTCTGGGAAGGGGAGGG - Intronic
1090859127 11:130637568-130637590 CCAGGACTTTGCGAGGCTGAAGG - Intergenic
1091392911 12:136800-136822 CAAGGCCTGTGTGAAGGTGATGG - Intronic
1091635336 12:2192764-2192786 CCAGGGCTCTGTGGAGGAGGGGG - Intronic
1091803113 12:3337325-3337347 CCAGGGATCTTTGAGGCTGTGGG + Intergenic
1092067054 12:5599418-5599440 CAAGGGGTCTGTGGGGTTGAAGG - Intronic
1092232823 12:6786328-6786350 CAAGGCATCTGTGAGGGTGCTGG + Intergenic
1092294120 12:7184708-7184730 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
1092469395 12:8764627-8764649 CCGGGGCTCTGTGAGGTCGATGG + Intronic
1093022909 12:14219579-14219601 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1093348619 12:18070155-18070177 CCGGGGCTCTGGGAGAGTGACGG - Intergenic
1094608977 12:31974737-31974759 CCAGGGGACAGTGAGGGGGACGG + Intronic
1095139030 12:38640005-38640027 CCAGGGCTCTGTGAAGGTGATGG - Intergenic
1095283983 12:40387781-40387803 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1096352019 12:50908418-50908440 CCGGGGTTCTGTGAGGGTGATGG + Intergenic
1096460396 12:51818934-51818956 CCAGGGCTGGGAGAGGGTGAGGG - Intergenic
1096601710 12:52734458-52734480 CCAGGCCTCAGTGTGGGAGATGG - Intergenic
1097168070 12:57096246-57096268 ACAGAGCTCTCTGAGGGTGATGG - Exonic
1098866871 12:75773166-75773188 CCAGGGCTTTTTGCTGGTGAAGG - Intergenic
1098956466 12:76694440-76694462 CCAGGGATCTGTGAGGGTGATGG + Intergenic
1099395501 12:82133213-82133235 CCAGCACTTTGTGAGGGCGAGGG - Intergenic
1099605318 12:84795997-84796019 CTGGGGTTCTGTGAGGGTGATGG - Intergenic
1100495441 12:95120435-95120457 CCAGCACTTTGGGAGGGTGAAGG + Intronic
1100525282 12:95413294-95413316 CCAGCACTTTGGGAGGGTGAGGG + Intergenic
1100530094 12:95454792-95454814 CTGGGGCTCAGTGAGGGTGATGG + Intergenic
1100530340 12:95456265-95456287 CCGGGGCTCAGTGAGGGTGACGG + Intergenic
1100843398 12:98635342-98635364 CCAGCGCTTTGGGAGGCTGAGGG - Intronic
1100854393 12:98746028-98746050 GCAGGGCACCCTGAGGGTGACGG + Intronic
1101092640 12:101303546-101303568 CCAACGCTCTGTGGGGGTGGTGG + Intronic
1101685837 12:107019679-107019701 CCAGTGCTTTGGGAGGTTGAAGG + Intronic
1101824635 12:108210451-108210473 AAAGGGCTCTGTGAGGGAGTGGG - Intronic
1101914078 12:108882896-108882918 CCAGCGCTTTGGGAGGCTGAGGG + Intronic
1102036098 12:109771342-109771364 GCAGGGCTCTGTGAATGGGAGGG - Intergenic
1102585251 12:113918510-113918532 CCAGGGCTCTGCTCTGGTGAAGG - Intronic
1103139433 12:118535779-118535801 CTAGTGCTCTGGGAGGCTGAAGG + Intergenic
1103205153 12:119123239-119123261 CCAGGCCTCTGTGGTGGTGGCGG - Intronic
1103803154 12:123552694-123552716 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1104393163 12:128408423-128408445 CAAGGGCTCTGTGAAGGGGCGGG - Intronic
1104851486 12:131877131-131877153 CTGGGGCTCTGTGAGGGTGATGG + Intergenic
1105291495 13:19056378-19056400 CCAGAGCACTGTGAAGGGGATGG + Intergenic
1105568591 13:21577403-21577425 CCAGGACTTTGGGAGGCTGAGGG + Intronic
1106630560 13:31467688-31467710 GCAGGGCTCATTGAGAGTGACGG + Intergenic
1107705582 13:43100460-43100482 CCAGCACTTTGGGAGGGTGAGGG - Intronic
1107872360 13:44759300-44759322 TCAGGGCCCTGTAAGGGAGAAGG + Intergenic
1108714850 13:53068951-53068973 CCTGGGCTTTGTGAGGGTGGAGG + Intergenic
1108876732 13:55057875-55057897 CAGGGGCTCTGTGAGGGTGATGG - Intergenic
1109005608 13:56871693-56871715 CCAGCACTTTGGGAGGGTGAGGG - Intergenic
1109750471 13:66685169-66685191 CTAGGCCTCTGGGCGGGTGATGG - Intronic
1110876149 13:80512747-80512769 CGGTGGCTCTGTTAGGGTGATGG - Intergenic
1110903873 13:80860991-80861013 CCAGCACTTTGAGAGGGTGAGGG - Intergenic
1111028090 13:82560591-82560613 CCAGCACTCTGGGAGGCTGAGGG - Intergenic
1111806239 13:93042999-93043021 CTGGGGCTCAGTGAGGGTGATGG - Intergenic
1112042631 13:95562320-95562342 CCAGTGCTTTGGGAGGCTGAGGG - Intronic
1112553712 13:100447134-100447156 CCAGCGCTTTGGGAGGTTGAGGG + Intronic
1112802863 13:103131904-103131926 CCAAGGCAATGTGAGGGAGAGGG - Intergenic
1113598543 13:111551642-111551664 CCTGGGTTCTGAGAAGGTGAGGG - Intergenic
1113787620 13:113010759-113010781 GCAGGGCTCAGTGAGGGAGCTGG + Intronic
1113877109 13:113601484-113601506 CCAGAGCCTGGTGAGGGTGAGGG - Intronic
1114384368 14:22240506-22240528 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
1114909394 14:27171389-27171411 CTAGGCCTCTGTGTGTGTGAGGG + Intergenic
1115182217 14:30642337-30642359 CCAGCACTCTGGGAGGCTGAGGG - Intronic
1115251662 14:31355162-31355184 CCAGGACTTTGGGAGGCTGACGG + Intronic
1115650860 14:35402324-35402346 CTAGGGGCCTGGGAGGGTGAAGG + Intronic
1115836811 14:37415128-37415150 CCAGGGGTCTGTAAAGTTGAGGG + Intronic
1115897425 14:38105578-38105600 CCGAGGCTCTGTGAGGGTGATGG - Intergenic
1116472944 14:45306398-45306420 CCAGAGGTCTATGAGGGTCATGG + Intergenic
1116776739 14:49189932-49189954 CCAGAGCTCTGTTGGGGTGAGGG - Intergenic
1117198140 14:53361776-53361798 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1117565905 14:56993065-56993087 GCAGGGGTCTGTGCGAGTGAGGG + Intergenic
1117672488 14:58122925-58122947 CTGGGGCTCTGTGAGGGTGATGG - Intronic
1117706847 14:58478579-58478601 CCAGTGCTTTGGGAGGCTGAGGG - Intronic
1117707688 14:58488730-58488752 CCTGGCATCTGTGAGGGGGAAGG - Exonic
1118640220 14:67785270-67785292 CCTGGGCTCTGAGAGGAGGATGG + Exonic
1118723180 14:68608640-68608662 CCCGGGAACTGTGATGGTGAGGG - Intronic
1119264933 14:73259074-73259096 ACAGGGCTCTGAGTGGGGGACGG - Intronic
1119293385 14:73514020-73514042 CCTGGGCTCTGAGTGAGTGAAGG - Exonic
1119951440 14:78749988-78750010 CCAGGGCTTTTGGAGGCTGAAGG - Intronic
1120695443 14:87639342-87639364 CCAGGGCTCTGAGAGAGCAATGG + Intergenic
1121010265 14:90516178-90516200 CCAGGGCTTTGAGAGGGACAAGG + Intergenic
1121042518 14:90760654-90760676 CCAGGGCTCTGGGCTAGTGAAGG - Intronic
1121848914 14:97201305-97201327 GAAGGGGCCTGTGAGGGTGACGG - Intergenic
1122371911 14:101233653-101233675 GCTGGGGTCTGTGTGGGTGAGGG - Intergenic
1122441667 14:101736342-101736364 CCAGGGCTCTGTGACTTTGAGGG - Intergenic
1122501250 14:102201650-102201672 CCAGTGCTCTGTGGGGATGCAGG - Intronic
1123339473 15:18979744-18979766 CCATCGCTCTGGGAGGCTGAGGG + Intergenic
1123684718 15:22788533-22788555 CCAGTCCTCTGTGAAGGTCATGG + Intronic
1123787199 15:23686192-23686214 CCAGGGCTGTGGAAGGGTGGGGG - Exonic
1124322340 15:28724474-28724496 CCAGTGCTCTCAGAGGCTGAGGG + Intronic
1124523430 15:30426279-30426301 CCAGTGCTCTCAGAGGCTGAGGG + Intergenic
1124535236 15:30539935-30539957 CCAGTGCTCTCAGAGGCTGAGGG - Intergenic
1124763418 15:32467661-32467683 CCAGTGCTCTCAGAGGCTGAGGG + Intergenic
1124775208 15:32581386-32581408 CCAGTGCTCTCAGAGGCTGAGGG - Intergenic
1125596963 15:40893576-40893598 CCACGGCACTGAGAGCGTGAAGG - Intergenic
1125639506 15:41218233-41218255 CCAGCACTTTGGGAGGGTGAGGG + Intronic
1125769292 15:42154315-42154337 CCATGGTGCTGTGAAGGTGAGGG - Exonic
1126164352 15:45641741-45641763 CCAAGGCACTGTGAGGGAGAAGG - Intronic
1126468893 15:48985899-48985921 CCAGGCCACTTTGAGGGTGCTGG + Intergenic
1127074234 15:55310336-55310358 CTGGGGCTCTGTGAGGGTGATGG + Intronic
1127075879 15:55325075-55325097 CCAGCACTTTGGGAGGGTGAGGG + Intronic
1127504084 15:59581420-59581442 ATAGGCTTCTGTGAGGGTGAAGG + Intergenic
1127980408 15:64030641-64030663 CCAGGGCTCAGGGTGGTTGAGGG - Intronic
1128136300 15:65266154-65266176 CCAGGACTTTGGGAGGCTGAGGG - Intronic
1128362571 15:66972697-66972719 CCAGGGCTCTGTGAGGGTGATGG + Intergenic
1128892048 15:71340294-71340316 CCAAGGCTCAGAGAGGTTGAAGG + Intronic
1130046877 15:80452652-80452674 ACAGGGCTCTGTGAGGAGGGAGG + Intronic
1130212577 15:81938656-81938678 CAAGGGCTCTGTGAGGGAGCTGG - Intergenic
1131137154 15:89946170-89946192 CCAGCACTTTGTGAGGCTGATGG + Intergenic
1131276527 15:90986377-90986399 CCAGGACTCTGGGAGGCCGAGGG + Intronic
1131363588 15:91817924-91817946 CAAGGGTCCTGTGGGGGTGAGGG + Intergenic
1131533758 15:93216585-93216607 TTAGGGGTCTGAGAGGGTGAGGG - Intergenic
1131539280 15:93262491-93262513 CAAGTGCTCTGTCATGGTGATGG + Intergenic
1131618423 15:94041216-94041238 GCAGGGCTGTGGGAGTGTGAGGG + Intergenic
1132672577 16:1107837-1107859 CCTGGGGTCTGTGAGGTGGAGGG - Intergenic
1132855860 16:2044273-2044295 CCAGGGCTCCTGGAGGGTGAGGG + Intronic
1132868690 16:2105994-2106016 GTTGGGCTCTGGGAGGGTGATGG + Exonic
1132989662 16:2786275-2786297 CCAGAGCACTGTGAAGGTGCAGG + Intronic
1133058272 16:3158353-3158375 CCCGGGGTCTGTGTGGGAGACGG + Intergenic
1133701915 16:8316825-8316847 GCAGGGCTTTGTGAGGTTCATGG - Intergenic
1133724484 16:8524827-8524849 CTGTGGCTCTGTGAGGGTGCTGG - Intergenic
1133724654 16:8526299-8526321 CTGTGGCTCTGTGAGGGTGCTGG - Intergenic
1133746582 16:8691688-8691710 CCAGCACTTTGTGAGGCTGAGGG - Intronic
1134522895 16:14926665-14926687 GTTGGGCTCTGGGAGGGTGATGG - Intronic
1134549732 16:15133393-15133415 GTTGGGCTCTGGGAGGGTGATGG + Intronic
1134665195 16:16013683-16013705 AGAGTGCTGTGTGAGGGTGAAGG + Intronic
1134710563 16:16325316-16325338 GTTGGGCTCTGGGAGGGTGATGG - Intergenic
1134718733 16:16369604-16369626 GTTGGGCTCTGGGAGGGTGATGG - Intergenic
1134949039 16:18343329-18343351 GTTGGGCTCTGGGAGGGTGATGG + Intergenic
1134956023 16:18382555-18382577 GTTGGGCTCTGGGAGGGTGATGG + Intergenic
1134970877 16:18529863-18529885 CCAGCACTCTGGGAGGCTGACGG + Intronic
1135150172 16:19998631-19998653 ACAGTGCTCTGTCAGGGTAAGGG - Intergenic
1135652503 16:24218517-24218539 CCAAGTCTATGTGAGGGTGTGGG - Exonic
1136417474 16:30112786-30112808 CCATGGAGCTGTGGGGGTGAAGG + Exonic
1136688420 16:32009823-32009845 CCAGTTCTCTGTCAGGGTCAGGG - Intergenic
1136789015 16:32953362-32953384 CCAGTTCTCTGTCAGGGTCAGGG - Intergenic
1136880797 16:33900572-33900594 CCAGTTCTCTGTCAGGGTCAGGG + Intergenic
1137408034 16:48205504-48205526 CGAGGGCTCGGTGGGGGTGCAGG - Exonic
1137555014 16:49465026-49465048 CGAGCGCCCGGTGAGGGTGAGGG + Intergenic
1137984625 16:53097512-53097534 CCAGTGCTTTGGGAGGCTGATGG - Intronic
1138267754 16:55672028-55672050 CCAGGGCAGGTTGAGGGTGAAGG - Exonic
1138337283 16:56263184-56263206 CCAGGGCTATGAGTGGGGGATGG + Intronic
1139902916 16:70342298-70342320 CCAGAGCTCTTTGCGGGAGAAGG - Intronic
1140251444 16:73297933-73297955 CCAGTGCTTTGGGAGGCTGAGGG + Intergenic
1141102457 16:81208164-81208186 CCAGGACTTTGGGAGGCTGAGGG - Intergenic
1141318614 16:82985627-82985649 CCAAGGTTCAGAGAGGGTGAGGG - Intronic
1141739322 16:85880198-85880220 CCATGGCTCTGTGGAGGTGGGGG + Intergenic
1141750516 16:85955093-85955115 CCAGGGAGCAGTGTGGGTGAAGG + Intergenic
1141881698 16:86864504-86864526 CCAGCACTCTGGGAGGGCGATGG - Intergenic
1142126638 16:88413852-88413874 CCAGGGCTGTGTGAGTGTGGTGG + Intergenic
1203091217 16_KI270728v1_random:1214853-1214875 CCAGTTCTCTGTCAGGGTCAGGG - Intergenic
1203144095 16_KI270728v1_random:1788381-1788403 CCAGCACTTTGTGAGGCTGAGGG + Intergenic
1142515933 17:428965-428987 CCAGCACTCTGGGAGGCTGAGGG - Intergenic
1143201972 17:5119575-5119597 CCAGGGTCCTCTGAGGGTCAGGG - Intronic
1143405818 17:6676650-6676672 CCAGGGCTCTGTGAGAGGAGAGG + Intergenic
1143556681 17:7666351-7666373 CCTGGGCTCTTTGAGTGGGAGGG + Intronic
1143612904 17:8030146-8030168 CCAGCACTTTGTGGGGGTGAAGG - Intergenic
1144780633 17:17806742-17806764 CCAGGGCTTTGAGAGAGTGGAGG + Intronic
1144892843 17:18504829-18504851 CCAGTGCTTTGGGAGGATGAGGG - Intergenic
1145103470 17:20095897-20095919 CAGAGGCTCTGAGAGGGTGAGGG + Intronic
1145139372 17:20439462-20439484 CCAGTGCTTTGGGAGGATGAGGG + Intergenic
1145270240 17:21401048-21401070 CCAGGGCTTTGTGAACTTGATGG - Intronic
1145290092 17:21536232-21536254 CCAGGGCTGTGGGATGGGGAGGG + Intronic
1145414878 17:22706736-22706758 CCAGGACTTTGGGAGGCTGAGGG + Intergenic
1145797951 17:27666889-27666911 CCAGGGTTCAGAGAGGCTGAAGG + Intergenic
1146540084 17:33686346-33686368 CCAGGGTACTTTGCGGGTGAGGG + Intronic
1146561796 17:33876635-33876657 TCTGAGCTCTGTGTGGGTGAGGG - Intronic
1146699072 17:34938315-34938337 CCAGCACTCTGGGAGGCTGAAGG + Intronic
1146743298 17:35305379-35305401 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
1146806846 17:35871627-35871649 CCAGGGCTCTGTGACCAGGAAGG - Intronic
1147149408 17:38505542-38505564 CCAGTTCTCTGTCAGGGTCAGGG - Intronic
1147311559 17:39598854-39598876 CCAGGGCTCTGGGGTGGTGAAGG + Intergenic
1147583246 17:41638499-41638521 CCAGGGCCCTGGGAAGGTGGAGG - Intergenic
1148054621 17:44786798-44786820 AGAGGGGTCTGTGGGGGTGAGGG - Intergenic
1148054725 17:44787305-44787327 CCCGGGCACTGTGGGTGTGAAGG - Intergenic
1148563446 17:48619448-48619470 CCCGTGTTCTGTGCGGGTGAGGG + Intronic
1148826973 17:50400923-50400945 CCAGGGCTCTGTGAGGGTGATGG + Intergenic
1149274034 17:55014600-55014622 CCGGGGCTCTGTGAAGGTGATGG + Intronic
1149512069 17:57250922-57250944 CCAGGGCCCTGGGGGGGTGGGGG - Intergenic
1149577758 17:57726328-57726350 CCATGCAGCTGTGAGGGTGAAGG + Intergenic
1149657189 17:58316396-58316418 CTAGGGGGCAGTGAGGGTGAGGG + Intronic
1150070325 17:62144728-62144750 CCAGCACTATGGGAGGGTGAAGG - Intergenic
1150337587 17:64341898-64341920 CCAGCACTTTGGGAGGGTGAGGG + Intronic
1151289538 17:73139575-73139597 CCAGGGCTCTGAGAGTCTGGAGG - Intergenic
1151383878 17:73743461-73743483 ACAGGGCTGTGTGAGGGAGGAGG - Intergenic
1151422264 17:74006253-74006275 CCAGGGTGCTGTGATGCTGAGGG - Intergenic
1151654864 17:75491138-75491160 CCTGGGCTCTGTCACGGTGAGGG + Exonic
1151834517 17:76574160-76574182 CCAGGGGTCAGTGAGAGTCATGG - Intronic
1151924562 17:77185285-77185307 CCAGAGCTCTGTCAGCGTCAGGG - Intronic
1151951940 17:77359541-77359563 CCAGCACTTTGTGAGGCTGAGGG + Intronic
1151972679 17:77466945-77466967 GCTGGGCTCTGTGGGGGTCAGGG + Intronic
1152738999 17:82010976-82010998 CCAGGGCACTGGGTGGGTGCGGG + Intronic
1153401599 18:4688835-4688857 CCGGGGCTTTGTGAGGGTGATGG - Intergenic
1154122142 18:11660722-11660744 CCAGGACACTGTGTGGGTGGCGG + Intergenic
1155053394 18:22166436-22166458 CCAGCCCTCTGTGAGGGTAAGGG + Intergenic
1155376628 18:25165263-25165285 GCAGGGCTCTGTCAGAGTTATGG - Intronic
1155524997 18:26706955-26706977 TCAGGGCTCTGTGCCGGTCAAGG + Intergenic
1155695011 18:28674810-28674832 CCAGGACTCTAGGAGGCTGAGGG - Intergenic
1155754604 18:29474739-29474761 CCAGGGCCTTTTGCGGGTGAGGG + Intergenic
1157299107 18:46466940-46466962 CCAGGGCTTTGGGAGGCTGCTGG + Intergenic
1158403248 18:57139808-57139830 CCTGCCCTCAGTGAGGGTGATGG + Intergenic
1160672617 19:373468-373490 ACCGGGCACTGTGATGGTGAGGG + Exonic
1160782192 19:882841-882863 TCAAGGCTCTGTGACCGTGATGG - Intronic
1160800187 19:964088-964110 CCAGGGCCCTCTGTGGGTGCAGG - Intronic
1161006509 19:1939969-1939991 CCAGCACTTTGTGAGGCTGACGG - Intergenic
1161031104 19:2058118-2058140 CCAGGGCCCTGGGAGGTTGAGGG - Intergenic
1161199486 19:3006470-3006492 CAAGGGCTGTGTGAAGGTGTGGG - Exonic
1161205396 19:3038460-3038482 CCAGCACTCTGTGAAGCTGAGGG - Intronic
1161280283 19:3442036-3442058 CCAGGCCTCTGTGAGCCTCAGGG - Intronic
1161535427 19:4816354-4816376 CCTGGGCTCTGAGGGGGTGCGGG + Exonic
1161607124 19:5221328-5221350 TCAGGGCTCAGTCAGGGTGGGGG - Intronic
1161792828 19:6370910-6370932 CCAGAGCTTTGAGAGGCTGAGGG + Intergenic
1161906663 19:7161931-7161953 CCAGCGCTTTGGGAGGCTGAGGG + Intronic
1162020861 19:7867778-7867800 CCAGGACTTTGGGAGGCTGAGGG + Intergenic
1162094476 19:8302427-8302449 CCAGGGCTGAGTGACGGTGGTGG + Exonic
1162521360 19:11181737-11181759 CCAGGACTTTGGGAGGCTGAAGG + Intronic
1163016631 19:14459792-14459814 CCACAGCTGTGTGAGGGTGAAGG + Intronic
1163018194 19:14469628-14469650 CCAAAGCTCTGGGAGGCTGAGGG - Intronic
1163183145 19:15618056-15618078 CCAGGGCTTTGTGAGGTGGTTGG + Exonic
1163676175 19:18656392-18656414 CCAAGGCTCAGAGAGGGTGGCGG - Intronic
1163809895 19:19424477-19424499 CCAGCGCTTTGGGAGGCTGAGGG - Intronic
1164057402 19:21633343-21633365 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1164173612 19:22748877-22748899 CCGGGGCTCTGTGAGGGTGGTGG - Intergenic
1164711184 19:30358232-30358254 CCGGGGCTCAGAGAGGGTAAGGG + Intronic
1164994153 19:32707371-32707393 CCAGGGCCCTGGGAATGTGAAGG + Intronic
1165441807 19:35832638-35832660 CCAGCACTCTGGGAGGCTGAGGG + Intronic
1165745434 19:38227875-38227897 AAAGGTCTCTGTGGGGGTGAAGG - Intronic
1166347369 19:42175149-42175171 CTGGGGCTCTGGGAGGGGGAGGG - Intronic
1166705781 19:44907257-44907279 GCAGGGCTGTGTGGGGGTGATGG - Intronic
1166780852 19:45342008-45342030 CCGGGGCTCTGTGTGAGTGTGGG + Intronic
1166995795 19:46719195-46719217 CCTGGGATGTGTGAGGGTGGTGG - Intergenic
1167017575 19:46850884-46850906 CCAGGGGTCTGTGCGCGAGAAGG - Exonic
1167133480 19:47602665-47602687 CCAGGACTTTGGGAGGCTGAAGG + Intergenic
1167407744 19:49324889-49324911 CCTGGGCTCTGTGGAGCTGAGGG - Intronic
1167431832 19:49459610-49459632 CCAGGACTCTGCAAGGCTGAGGG + Intronic
1167531953 19:50023428-50023450 CCAGGACTTTGGGAGGCTGAGGG - Intronic
925235281 2:2272362-2272384 CCAGGGCTCAGCGAGGGCGGGGG - Intronic
926864524 2:17343049-17343071 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
927400798 2:22707570-22707592 CTAGGCCTCTGTGACTGTGATGG + Intergenic
927675930 2:25106202-25106224 TCAGGGCTTTGTGAGGGGAAAGG + Intronic
927856323 2:26530046-26530068 CCAGGGCGCTGTGTGGGAGTCGG + Intronic
928103409 2:28452513-28452535 CAAGGGCTCTGTGAGGGAGCAGG + Intergenic
928476507 2:31632535-31632557 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
928677095 2:33660949-33660971 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
928988356 2:37203688-37203710 CCAGGGATCTTTGAAGTTGATGG - Exonic
929564099 2:42974112-42974134 ACAGGGCTCAGAGAGGGAGAGGG + Intergenic
930631603 2:53759883-53759905 CCGGGGCTCTGTGAGGGTGATGG - Intronic
930659284 2:54037655-54037677 CCAGCACTTTGGGAGGGTGAGGG - Intronic
930710725 2:54548891-54548913 CAAGGACTCTGTGAGGGAGGTGG - Intronic
930715763 2:54592881-54592903 CCAAGGCTCAGTGAGGTTAAGGG - Intronic
931360474 2:61573627-61573649 CTAGCACTTTGTGAGGGTGAGGG + Intergenic
931379197 2:61736391-61736413 CCAGCGCTTTGGGAGGCTGAGGG - Intergenic
931395489 2:61884873-61884895 CCAGCACTTTGGGAGGGTGAGGG - Intronic
931763839 2:65437567-65437589 CCAGGGCTCTATGAGGCAGTGGG + Intergenic
931867417 2:66426842-66426864 CCAGGGCTCTGGGTGGCTCAGGG + Intergenic
931987057 2:67752261-67752283 CACCTGCTCTGTGAGGGTGAAGG + Intergenic
932571952 2:72942832-72942854 CCAGGCCTCTGGCAGGGGGAGGG + Exonic
932729571 2:74209117-74209139 CCAGCACTCTGGGAGGCTGAGGG - Intronic
932917727 2:75875857-75875879 CGGGGGCTCTGTGAGGGTGATGG - Intergenic
933175198 2:79166349-79166371 CCAGGGCTCTATGAGGGTGATGG + Intergenic
934672007 2:96220136-96220158 CCCGGGCTCTGTGAGGGTGATGG + Intergenic
935290645 2:101608089-101608111 CCAGTGCTTTGGGAGGCTGAGGG - Intergenic
935706470 2:105861762-105861784 CCAGGACTTTGGGAGGCTGAGGG - Intronic
935748742 2:106212143-106212165 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
936387246 2:112041328-112041350 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
937657136 2:124388927-124388949 CCAGGATTCTGTGAGGCTGTAGG - Intronic
938087997 2:128414084-128414106 CCAGGGCTGTGTTAGGGGGTCGG + Intergenic
938099231 2:128486807-128486829 GCAGTGCTCTGGGAGGGTCAGGG - Intergenic
938305572 2:130252155-130252177 CCTGGGCTCTGGGAGGGTTTCGG - Intergenic
939493596 2:142903644-142903666 CCGGGGCTCTGTGAGGGTGATGG + Intronic
939547832 2:143575430-143575452 CCAGGATTCTGTGAGGGATAAGG + Intronic
939673950 2:145048392-145048414 CCAGCGCTTTGGGAGGCTGAGGG + Intergenic
941404367 2:165070354-165070376 CCAGGACTCAGAGAAGGTGAAGG - Intergenic
941821217 2:169845171-169845193 CCAGCACTCTGGGAGGGTGAGGG + Intronic
942284251 2:174398011-174398033 CCAGGGCTTTGGGAGGCAGAAGG + Intronic
942580372 2:177410763-177410785 CCGGGGCTCTGTGAGGGTGACGG + Intronic
942635916 2:178005398-178005420 CCAGCACTCTGGGAGGCTGAGGG + Intronic
943441355 2:187931843-187931865 CCAGGGCTCCTGGAGGGTAATGG + Intergenic
944039285 2:195336168-195336190 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
944070683 2:195665072-195665094 CCAGCGCTTTGGGAGGCTGAGGG + Intronic
944143392 2:196480762-196480784 GCAGGACTCTGTGATTGTGAGGG - Intronic
944626876 2:201579531-201579553 CCAGGACTTTGGGAGGCTGAGGG - Intronic
945274059 2:207970399-207970421 GCAGGGGTCTGTGATGGTGGGGG + Intronic
946104072 2:217353759-217353781 CAAGGCCTCTGTGAGTGTAAGGG - Intronic
948461819 2:238133330-238133352 ACCGGGCTCTGTGAGGGCGTAGG - Intergenic
948519383 2:238525827-238525849 CCAGTGCTCTGGGAGGCCGAGGG + Intergenic
948684797 2:239663735-239663757 CCCGGGGACTGTGAGGCTGAAGG - Intergenic
948959162 2:241318233-241318255 ACAGGGTTCAGTGAGGCTGAGGG + Exonic
1168741344 20:193892-193914 CCGGGACTCTGTGAGGGTGATGG + Intergenic
1168865109 20:1079765-1079787 CCAGGGCCCTGAGGTGGTGATGG - Intergenic
1169470195 20:5878403-5878425 TCAGGGCTTGGTGAGGGTGAGGG + Intergenic
1170500801 20:16974284-16974306 ACCTGGCTGTGTGAGGGTGATGG - Intergenic
1170782945 20:19441832-19441854 CCAGGGGTCAGTGAGAGGGAGGG - Intronic
1171385134 20:24764758-24764780 CCAGGGCTCTGAGTGGGTGATGG - Intergenic
1171511089 20:25685560-25685582 CCAGGCCCCTGTGCAGGTGAGGG - Exonic
1172264240 20:33597179-33597201 CCAGCACTTTGTGAGGCTGAGGG - Intronic
1173200242 20:40949400-40949422 CCCGGGGTCTCTAAGGGTGATGG + Intergenic
1173309861 20:41887825-41887847 CCAGCCTTCTGTCAGGGTGAGGG + Intergenic
1173646741 20:44638014-44638036 CCATAGCCCTGTGAGGGTTAAGG - Intronic
1173743694 20:45420356-45420378 GCAGGGCTCCGTGAGGGTTCGGG - Exonic
1173896017 20:46551191-46551213 CCAGCACTCTGGGAGGCTGAGGG + Intergenic
1174164679 20:48576523-48576545 CCAGGGCTGGGGTAGGGTGAAGG - Intergenic
1174258654 20:49277810-49277832 ACAAGGCTCTGAGTGGGTGATGG + Intronic
1174258677 20:49277872-49277894 CAGGGGCTCTGAGCGGGTGACGG + Intronic
1174977168 20:55349008-55349030 CCGGGGCTCTGTGAGAGTGATGG - Intergenic
1175221640 20:57420747-57420769 GCTGGGCTCTGGGAGGGTGCAGG + Intergenic
1175445289 20:59015674-59015696 GCTGGGCTGTGAGAGGGTGAGGG - Intergenic
1175481715 20:59315935-59315957 CCAGCACTTTGGGAGGGTGAGGG + Intronic
1175766826 20:61598106-61598128 GCCGGGCACTGTGGGGGTGATGG + Intronic
1175935533 20:62512165-62512187 CCAGGTCTGGGTGAGGGTGGAGG + Intergenic
1175949756 20:62577055-62577077 CCAGGGCTCACTGAGGGTCTGGG - Intergenic
1176091003 20:63318628-63318650 CCCGGGGCCCGTGAGGGTGAGGG - Intronic
1176113714 20:63422131-63422153 CCTGGGCTCTGTGAGTCTGGTGG - Intronic
1177157666 21:17514871-17514893 CCAGGACTCTGGGAGGCTGAGGG - Intronic
1177896317 21:26858866-26858888 CTGGGGCTCTGTGAGGGTGACGG - Intergenic
1178393057 21:32214999-32215021 TCAGGACTCTGTGAGAGGGAGGG + Intergenic
1179248161 21:39650915-39650937 CCACGGCTGAGTGAGGGTGTTGG - Intronic
1179259074 21:39742466-39742488 CTGGGGCTCTGTGAGGGTGATGG + Intergenic
1179609017 21:42537089-42537111 CCAGGGCTCTGAGCGGGGTAGGG - Intronic
1179898434 21:44376493-44376515 CCAGCACTTTGGGAGGGTGATGG - Intronic
1180062504 21:45392876-45392898 CCAGCTCACTGTGAGCGTGAGGG - Intergenic
1180142974 21:45903530-45903552 CCAGTGGTCAGTGAGAGTGAGGG + Intronic
1180184299 21:46131836-46131858 CCAGTGGTCTGTGAGGTTGCAGG + Intronic
1180695417 22:17748768-17748790 TCAGGGCGCTGCGCGGGTGACGG + Intronic
1180845908 22:18982161-18982183 CCAGCACTTTGTGAGGCTGAAGG + Intergenic
1181102633 22:20551656-20551678 CCAAGGCTCTGGGAGGATGGAGG - Intronic
1181362152 22:22345802-22345824 CTAGGCCCCTGTGATGGTGAGGG + Intergenic
1181460647 22:23083962-23083984 ACAGGGCACTGTGAGTGTGGTGG + Intronic
1182358963 22:29735519-29735541 CCAAGGCTCTGTGTGGCTGTGGG - Intronic
1182852023 22:33483456-33483478 CCAGAGGACTGAGAGGGTGATGG + Intronic
1183331407 22:37223986-37224008 CCAAGGCTCTGTGAAGAGGAGGG + Intergenic
1183384215 22:37505759-37505781 ACAGGGCCCAGAGAGGGTGAGGG - Intronic
1183928224 22:41221002-41221024 CCAGGCCTCTGGGATGGGGAGGG - Intronic
1184288359 22:43484578-43484600 CCAGGGCCCTGTGAGGGGAGAGG - Intronic
1184634686 22:45817758-45817780 CCAGGGCCCTGTATGAGTGAAGG + Intronic
1184812505 22:46845968-46845990 CCAGGGCTCTGTGGGAGGGCTGG + Intronic
1184909275 22:47515692-47515714 CCAGGACCCTGTGAGGGTAAAGG - Intergenic
1185016989 22:48350332-48350354 CTGGGGCTCTGAGAGGGTGTAGG - Intergenic
950060006 3:10062948-10062970 CCAGTGCTTTGGGAGGCTGATGG - Intronic
950301367 3:11882172-11882194 CCAGTGCTTTGGGAGGCTGAGGG - Intergenic
950438083 3:12992654-12992676 CCAGTGATCTGTGGTGGTGAGGG - Intronic
950504484 3:13386034-13386056 CAAGGGCTGGGAGAGGGTGAAGG + Intronic
950533562 3:13566944-13566966 CCAGGGCTCAGAGAGGGCCAGGG + Intronic
951200627 3:19872615-19872637 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
951550820 3:23873399-23873421 CCATGGCCCTGGGAGGGTGCAGG + Intronic
951837928 3:27003093-27003115 CTAGGGTTCTGTGAGAGTGATGG - Intergenic
952213314 3:31251213-31251235 ACAGTGCTCAGTGAGGGTAATGG + Intergenic
952922166 3:38293050-38293072 CCAGGGCTCTGTGAGGGTGATGG + Intronic
953288740 3:41640353-41640375 CCTGGGCTCTCGGAGTGTGATGG - Intronic
954030675 3:47817959-47817981 TCAGGGGTCTGTGACTGTGAGGG + Intronic
954361592 3:50125350-50125372 CAGGGGCTCTGTGAGGGGCAGGG + Intergenic
954876069 3:53803929-53803951 CCAGGGCTCTGTGTGGACGGCGG + Intronic
955348832 3:58179707-58179729 CCAGAGCCCTGTGGGTGTGAAGG + Intergenic
955404958 3:58620215-58620237 AGAGAGCTCTGTGAGTGTGATGG + Intronic
955723133 3:61904471-61904493 CCAGGACTTTTTGAGAGTGACGG + Intronic
955732278 3:61999294-61999316 CCAGCGCTTTGGGAGGCTGAGGG - Intronic
955800508 3:62681287-62681309 CCTGGGTTCTGTGATGGAGAGGG - Intronic
955954431 3:64274161-64274183 CCAGCACTTTGTGAGGCTGATGG + Intronic
956437765 3:69250836-69250858 CCAGTACTCTGGGAGGCTGAGGG + Intronic
956456026 3:69421167-69421189 CTGGGGCTGTGTGAGGGTGGAGG - Intronic
956901964 3:73726228-73726250 CTGGGGCTCTGTGAGGGAGGAGG + Intergenic
957000222 3:74876023-74876045 TTGGGGCTCTGTGAGGGTGATGG + Intergenic
957445643 3:80310531-80310553 CCTGGGCTCTGTGAGGGTGATGG - Intergenic
958016197 3:87942424-87942446 CCGGGGCTCTGTGAGGGTGACGG + Intergenic
958075131 3:88666682-88666704 CCAGCACTTTGGGAGGGTGAAGG - Intergenic
959114707 3:102163021-102163043 CCAGGGCCCTCTGAGGAAGAAGG + Intronic
960166758 3:114411220-114411242 CCAGAGCTCTGTGCTGTTGAAGG - Intronic
960277539 3:115744858-115744880 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
960539304 3:118846521-118846543 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
960986759 3:123286024-123286046 CCAGTTCTCTGTGAGGCTGTGGG - Intronic
961345002 3:126258612-126258634 TCAGGGCTCTCAAAGGGTGAAGG + Intergenic
961437329 3:126928391-126928413 AGAGGGCTCTGTGATGGTGGTGG - Intronic
961767348 3:129221559-129221581 CCAGTGCTTTGGGAGGCTGAAGG - Intergenic
962445477 3:135459809-135459831 CCAGGGACCAGGGAGGGTGAGGG + Intergenic
962495504 3:135935693-135935715 CCGGGGCACTGTGAGGGTGATGG - Intergenic
963188012 3:142440074-142440096 CCAGGGCTCTGTGAGGGTGATGG - Intronic
963840242 3:150097444-150097466 TCTGGGCTTTGTGAGGGTGGAGG - Intergenic
963915829 3:150858135-150858157 CCGGGGCTCCGTGAGGGCGATGG - Intergenic
964223431 3:154370649-154370671 CTGGGACTCTGTGTGGGTGATGG - Intronic
964953485 3:162325159-162325181 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
965054737 3:163698116-163698138 CCGGCGCTCTGTGAGAGTGATGG + Intergenic
965333400 3:167405820-167405842 CCAGCACTTTGTGAGGCTGAGGG + Intergenic
965825220 3:172723001-172723023 CTGGGGCTCTCTGAGGGTGAGGG - Intergenic
966353565 3:179056631-179056653 CCGGGGCTCTGTGAGGGTGATGG - Intronic
966396408 3:179508312-179508334 CCATGGATCTGTGTGGGTGGGGG - Intergenic
967623621 3:191662387-191662409 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
967718230 3:192788549-192788571 CAAGGGCTATGTGAGTGTGTTGG - Intergenic
967807795 3:193730764-193730786 CCAGGGCTTTGTGGGGGCCATGG - Intergenic
968119750 3:196117477-196117499 CCAGCACTTTGGGAGGGTGAGGG - Intergenic
968391112 4:193744-193766 CCGGGGCCCAGTGAGGGTGATGG + Intergenic
968516614 4:1018200-1018222 CCAGGGCCCAGGGAGGGTGGAGG - Intronic
968654784 4:1773756-1773778 TCATGGCTCAGTGTGGGTGATGG + Intergenic
968926102 4:3549226-3549248 TCAGGGCTCTTTGAGGGGGAAGG + Intergenic
969184144 4:5463054-5463076 CCCAGGCTCTGTGAGGGTCCTGG - Intronic
969554027 4:7893941-7893963 CCAGGGCTCGCTGAGGCTGTGGG - Intronic
969666211 4:8558790-8558812 CTGAGGCTCAGTGAGGGTGAGGG + Intronic
969877485 4:10146567-10146589 CCAGTGCTTTGGGAGGCTGAGGG + Intergenic
970117691 4:12717864-12717886 TATGGGCTCTGTGAAGGTGATGG - Intergenic
970634434 4:17991883-17991905 ACACCTCTCTGTGAGGGTGAGGG - Intronic
971251479 4:24976345-24976367 CCAGGCCTGTGTCAGGGTGAAGG + Intronic
972556811 4:40189637-40189659 CCAGCACTCTGGGAGGCTGAGGG + Intergenic
972766107 4:42153011-42153033 CCGAGGCTCTGAGAGGTTGAAGG + Intergenic
972781292 4:42288977-42288999 CCAGGGCTCTGTGAGGGTGATGG + Intergenic
974520528 4:62975804-62975826 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
974834422 4:67230469-67230491 CCAGCACTCTGAGAGGCTGAGGG - Intergenic
974927386 4:68316980-68317002 CCAGTGCTTTGGGAGGCTGAGGG + Intronic
974969136 4:68803477-68803499 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
975000762 4:69221806-69221828 CTGGGGCTCTGTGAGGGTGACGG + Intergenic
975004689 4:69270463-69270485 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
975013109 4:69379443-69379465 CCGGGGCTCTGTGAGGGTGATGG - Intronic
975313752 4:72929734-72929756 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
976189903 4:82477813-82477835 CTGGGGCTCTGAGAGGGTGATGG - Intergenic
976429267 4:84944273-84944295 CCAGAACTCTGGGAGGCTGAGGG + Intronic
976759333 4:88531287-88531309 CCAGAACTCTGGGAGGCTGAGGG - Intronic
977617950 4:99106288-99106310 CCGGGCCTCTGTGAGGGTGATGG + Intergenic
977765888 4:100797207-100797229 CAAGTGCTTGGTGAGGGTGATGG + Intronic
978029060 4:103915912-103915934 CCAGCACTTTGTGAGGCTGAAGG - Intergenic
978558267 4:110004265-110004287 CCAAGGTTCTGTGAGGTAGAGGG - Intronic
978586740 4:110282394-110282416 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
978909620 4:114048610-114048632 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
980444269 4:132885932-132885954 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
983666965 4:170193405-170193427 CTGGGTCTCTGTGAGGGTGATGG + Intergenic
984723805 4:183001190-183001212 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
984738007 4:183129329-183129351 CCAGGGCTCTTTGAGACTGAAGG + Intronic
984890355 4:184486511-184486533 CCAGCACTCTGGGAGGCTGAGGG + Intergenic
985106072 4:186501277-186501299 CCAGGGCTCTGCGGGGCTCATGG + Intronic
985387689 4:189464330-189464352 CCAGTGCTATGTGTGAGTGAGGG + Intergenic
985668384 5:1193529-1193551 CCAGGGCTGGGTGTGGGTGGAGG + Intergenic
985868086 5:2531051-2531073 CCTGGGTTCTGTGAAGTTGAGGG - Intergenic
985920815 5:2971352-2971374 CCTGGGCTCTTTGAGAATGATGG - Intergenic
986028235 5:3871065-3871087 CCAGGGCTCTACGTGGGAGAGGG + Intergenic
987318751 5:16748503-16748525 CCAGCGCTTTGGGAGGCTGATGG - Intronic
987361774 5:17113609-17113631 CCAGGGCTCTGTGAGGACAAGGG + Intronic
987503459 5:18742941-18742963 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
987525797 5:19047490-19047512 CCAGGAATCTGTGAGGGCAAGGG + Intergenic
987855550 5:23415274-23415296 CCGGGGCTGTGTGATGGTGGGGG - Intergenic
988447211 5:31300869-31300891 CCAGAGCTTTGGGAGGCTGAGGG + Intronic
988457030 5:31395595-31395617 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
988525088 5:31980159-31980181 CCAGGGTTTTGTGGGGGTGAAGG - Intronic
988957119 5:36331057-36331079 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
989058373 5:37386060-37386082 CCAGGACTTTGGGAGGCTGAGGG - Intronic
989389844 5:40888669-40888691 CCAGGGATAGGTGAGTGTGATGG - Intergenic
990608020 5:57429691-57429713 CGAGGGCTTAGAGAGGGTGAAGG - Intergenic
990892350 5:60662815-60662837 CTGGGGCTCTGTGAGGGTGATGG - Intronic
991275598 5:64842849-64842871 CCAGCACTTTGAGAGGGTGAGGG - Intronic
991631565 5:68661299-68661321 ACAGGGCCCAGTTAGGGTGAAGG - Intergenic
995465709 5:112447845-112447867 CTGGGGCTCTGTGAGGGTGACGG - Intergenic
995862690 5:116658949-116658971 CCTGGGCTCTGCAATGGTGATGG + Intergenic
996124316 5:119707220-119707242 CCAGTGCTTTGGGAGGCTGAGGG + Intergenic
997111367 5:131078619-131078641 CCAGGGGGCTGTGGGAGTGAAGG + Intergenic
999053344 5:148547641-148547663 CCAGCACTCTGGGAGGCTGAAGG + Intronic
999287107 5:150400691-150400713 CCATGGTTCTGTGGTGGTGAGGG + Intergenic
1000477202 5:161725377-161725399 CCAGCACTCTGGGAGGCTGAAGG + Intergenic
1001320961 5:170681053-170681075 CCAGGGTGCTGTGAGGATGTGGG + Intronic
1001645264 5:173276685-173276707 CCGGGGGACTGTCAGGGTGAGGG + Intergenic
1002259663 5:177984568-177984590 CCTCGGCTCCGTGAAGGTGAGGG + Intergenic
1002343942 5:178535311-178535333 CCAGGGCTCTGAGAGCGTCAGGG - Intronic
1002395338 5:178948162-178948184 CCAGCACTCTGGGAGGCTGAGGG - Intronic
1002666584 5:180830065-180830087 AGAGGGCTCTGGCAGGGTGAGGG - Intergenic
1004051580 6:12085708-12085730 GCAGGCCTCTGAGATGGTGAGGG + Intronic
1004236879 6:13882182-13882204 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
1004534901 6:16491132-16491154 CCACTGCTCTGTCTGGGTGATGG - Intronic
1005323600 6:24678911-24678933 CCGGGGCCCTGTGAGGGTGATGG + Intronic
1005595460 6:27374884-27374906 TCGGGGCTCTGTGGGGTTGAGGG - Intronic
1005851695 6:29827891-29827913 CCAGGTCTCGGTCAGGGTCAGGG - Exonic
1006152252 6:31995815-31995837 CCAGGGTTCTGAGGGGGTCAGGG + Intronic
1006158555 6:32028553-32028575 CCAGGGTTCTGAGGGGGTCAGGG + Intronic
1006294725 6:33165083-33165105 CTAGGGCTCTGGGAGGGAGGAGG - Intronic
1006299638 6:33186689-33186711 TCTGGGCTCTGTGAGGCTGTTGG + Exonic
1006778710 6:36617085-36617107 CCAGAGCCCTCTCAGGGTGAGGG - Intergenic
1006920066 6:37621820-37621842 CCTGGGCTCAGTCAGGGAGAGGG + Intergenic
1007450562 6:41938413-41938435 CTGGGGCTCTGTGAGGGTAGGGG - Intronic
1007493911 6:42245856-42245878 CCAGTGCTTTGGGAGGCTGAGGG + Intronic
1007685263 6:43663466-43663488 CCAGTACTCTGGGAGGCTGAGGG - Intronic
1007690157 6:43695655-43695677 CAAGGGCTCTGTCTGGATGAAGG + Intergenic
1007937245 6:45743413-45743435 CTTGGGCTCAGGGAGGGTGATGG + Intergenic
1008570882 6:52815477-52815499 ACACGGCGCTGTGAGGCTGAAGG + Intergenic
1008573784 6:52839557-52839579 ACACGGCGCTGTGAGGCTGAAGG + Intronic
1008578310 6:52882318-52882340 ACACGGCGCTGTGAGGCTGAAGG + Intronic
1008582313 6:52918184-52918206 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
1009544843 6:65008766-65008788 CTGGGGCTCTGTGAGGGTGATGG - Intronic
1010893562 6:81341168-81341190 TCAGGGCTCTGCGAGGATGATGG - Intergenic
1011076834 6:83447189-83447211 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
1011189719 6:84716440-84716462 CTGGGGCTCTGTGAGGGTGATGG + Intronic
1011539796 6:88417359-88417381 CCAGGGCTCTATGAGGGTGATGG + Intergenic
1011648521 6:89483487-89483509 CCCTGGCTCTGTGAGGGCCATGG + Intronic
1011763458 6:90593575-90593597 CCAGCACTCTGGGAGGCTGAGGG - Intergenic
1013022298 6:106232141-106232163 CCAGGGCTCTGTGAGGGTGATGG - Intronic
1013543606 6:111134861-111134883 CCAGGGCTCTGTGAGGGTGATGG - Intronic
1013888779 6:115001192-115001214 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1015865420 6:137722136-137722158 CTGGGACACTGTGAGGGTGATGG + Intergenic
1016343185 6:143084159-143084181 CCGAGGCTCTGTGACGGTGATGG + Intronic
1016444656 6:144119521-144119543 CTGGGGATCTGTGATGGTGATGG + Intergenic
1016858066 6:148692050-148692072 CCAGCGCTTTGGGAGGCTGAGGG - Intergenic
1017462562 6:154665172-154665194 CCAGCACTTTGTGAGGCTGAGGG - Intergenic
1017848955 6:158285895-158285917 CCAGGGCTCTGTTCGGTTGCTGG + Intronic
1018640522 6:165900075-165900097 CCCTTGCCCTGTGAGGGTGATGG + Intronic
1018687582 6:166315953-166315975 CCGGGGCTCTGTGAGGGTAATGG - Intergenic
1018691349 6:166346529-166346551 CTGGGGCTCTGTGTGGGTGATGG + Intergenic
1018761103 6:166895064-166895086 CCGAGGCTCTGTGAGGGTAATGG - Intronic
1019159838 6:170062514-170062536 CAAGGGCTCTGTGAGGCTCCCGG - Intergenic
1019338117 7:494611-494633 CGGGGGATCTGTGAGGGGGACGG + Intergenic
1019418049 7:936187-936209 CCAGCGCTTTGGGAGGCTGAGGG + Intronic
1019620621 7:1990194-1990216 CCAGGGTTCTGTGAGGCTCTGGG - Intronic
1019988585 7:4676546-4676568 CCAGCACTTTGGGAGGGTGAGGG - Intergenic
1020401423 7:7782980-7783002 CCAGTGCTTTGGGAGGCTGAGGG - Intronic
1020479257 7:8637471-8637493 CCAGCGCTTTGGGAGGCTGACGG - Intronic
1020508152 7:9019359-9019381 CCGGGGCTCCATGAGGGTGATGG - Intergenic
1022031086 7:26492467-26492489 CCAGGTCTCTCTGATGGTGTGGG - Intergenic
1022716045 7:32899524-32899546 CCAGGACCCTAAGAGGGTGAAGG + Intergenic
1022816840 7:33922129-33922151 CCAGAATTCTGTGAAGGTGATGG - Intronic
1023439241 7:40169431-40169453 CTGGGGCTCTGTGAGGGTGATGG + Intronic
1023818588 7:43968197-43968219 CCAGGCCTCTCTCAGAGTGAGGG - Intergenic
1023968564 7:44976157-44976179 CCAGGTGGCTGTGTGGGTGATGG - Intronic
1024178473 7:46864086-46864108 CCAGGGCACAGTGAAGGTGGAGG - Intergenic
1026001242 7:66560283-66560305 CCAATGCTCTGGGAGGATGAGGG + Intergenic
1026553087 7:71384514-71384536 CCAGAGCTCTGAGAGTTTGAGGG + Intronic
1027126017 7:75557286-75557308 CCAGGACTTTGGGAGGCTGAGGG - Intronic
1028034228 7:85959489-85959511 CCAGCACTCTGGGAGGCTGAGGG - Intergenic
1028574254 7:92329213-92329235 CCAGCACTCTGGGAGGGCGAGGG - Intronic
1028588521 7:92473831-92473853 CCAGGGCTCTGTGAGGGTGATGG + Intronic
1028602712 7:92619643-92619665 CCTGGGCTCCGTGTAGGTGAGGG - Intronic
1028617613 7:92786932-92786954 CCAGCACTCTGGGAGGCTGAGGG + Intronic
1028814212 7:95125947-95125969 CCAGGGTTCTCTTAGGCTGAAGG - Intronic
1029123635 7:98283611-98283633 GCAGAGCTGTGTGAGTGTGAAGG + Intronic
1029252634 7:99247921-99247943 CCAGGGCTCAGTGAGTGTGCTGG + Intergenic
1029467724 7:100736728-100736750 CCTGGGCTCTGAGAAGGGGATGG + Intronic
1029633599 7:101768897-101768919 CCAGTGCTTTGGGAGGCTGAGGG + Intergenic
1029743637 7:102505162-102505184 CCAGGCCTCTCTCAGAGTGAGGG - Intronic
1029761623 7:102604325-102604347 CCAGGCCTCTCTCAGAGTGAGGG - Intronic
1029804465 7:102981953-102981975 CCAGCACTCTGTGAGGCTGAGGG + Intronic
1029991717 7:104968267-104968289 CCAGCACTCTGGGAGGCTGAGGG - Intergenic
1030337354 7:108341263-108341285 CCGGGGCTCTGTGAGGGTGATGG - Intronic
1030843429 7:114382281-114382303 CTGGGGCTCTGTGAGGGTGATGG + Intronic
1031264618 7:119567626-119567648 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
1031426830 7:121615503-121615525 CCAGAGCTCGTTAAGGGTGATGG - Intergenic
1031471586 7:122174465-122174487 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
1031630625 7:124038699-124038721 CCAGCACTCTGGGAGGTTGAGGG - Intergenic
1032425228 7:131817298-131817320 CCAGAACTTTGTGAGGTTGAGGG + Intergenic
1032426034 7:131822801-131822823 CTGTGGCTCTGTGAGGGTGATGG + Intergenic
1033599368 7:142877644-142877666 TCTGAGCTCTATGAGGGTGAGGG - Exonic
1033895583 7:146065692-146065714 TCAGTGCTCTATGTGGGTGAAGG - Intergenic
1034046055 7:147928839-147928861 CCAGGACTTTGAGAGGCTGAAGG + Intronic
1034249251 7:149675222-149675244 CCGGGGCTCTGTGAGGGTGATGG - Intergenic
1034302926 7:150031974-150031996 CCAGGGCCCTCTAAGAGTGATGG + Intergenic
1035011012 7:155714887-155714909 GCAGGGGACTGTGATGGTGACGG + Intronic
1035193304 7:157191545-157191567 CCAGCACTCTGGGAGGCTGAGGG - Intronic
1035705766 8:1673219-1673241 CCAGTGCTCTGCAAGGCTGAGGG - Intronic
1036242930 8:7094087-7094109 CCAGCACTTTGAGAGGGTGAAGG + Intergenic
1036501495 8:9318849-9318871 AAGGGGCTCAGTGAGGGTGAGGG - Intergenic
1036898892 8:12657349-12657371 CCAGCACTTTGAGAGGGTGAAGG - Intergenic
1038304023 8:26383243-26383265 CCGAGGCTCTGTGAAGGGGATGG + Intronic
1039672144 8:39613191-39613213 AAAGTGCTCTGTCAGGGTGATGG - Intronic
1040484053 8:47853610-47853632 TCTGGGCTCTCTGACGGTGAGGG - Intronic
1040527687 8:48239113-48239135 CTGGGGCTCTGTGAGGGTGATGG + Intergenic
1041663804 8:60423476-60423498 CCAGGGCTCCGTGAAGGTGATGG + Intergenic
1042056179 8:64766823-64766845 CTGGGGCTCCGTGAAGGTGATGG - Intronic
1042220844 8:66472388-66472410 CCAGGCCATTGTGATGGTGATGG - Intronic
1043490031 8:80739966-80739988 CCGGGGTTCTGTGAGGGTGATGG - Intronic
1045143850 8:99316509-99316531 TCAGGGGCCTGTGAGGGTCAAGG + Intronic
1045298154 8:100889944-100889966 CCTGGTCTCTGTTAGGATGAGGG + Intergenic
1045399102 8:101793535-101793557 CCAGTCTTCTGTGAGGTTGAAGG + Intronic
1047443818 8:124902126-124902148 CCGGAGCTCTGTGAGGGTGATGG + Intergenic
1047808017 8:128379356-128379378 CCAGGGCTCTGTGAGGGTGATGG + Intergenic
1048903663 8:139065530-139065552 AGAGGACTCCGTGAGGGTGAGGG + Intergenic
1048979031 8:139693244-139693266 CCAGGCCTCTGTGAGTCTGCAGG - Intronic
1049497748 8:142944468-142944490 CCAGGGCTCTGTGTGTGACAGGG + Intergenic
1049552069 8:143264680-143264702 CCAGGGAGGTGTGAAGGTGACGG - Intronic
1049603930 8:143520435-143520457 CCAGGGCTGTGTGGGGGCGCAGG - Intronic
1049926966 9:418813-418835 CCAAGGCTCTCTGAGGGTGGAGG + Intronic
1049981001 9:903583-903605 CCAAAGCTCAGGGAGGGTGATGG + Intronic
1050185133 9:2965361-2965383 CAAGGCCTGTGTGAGGTTGAAGG - Intergenic
1050544498 9:6698314-6698336 TCAGTGCTCTGAGAGGCTGAGGG - Intergenic
1051782779 9:20708517-20708539 CCAGTGCTTTGGGAGGCTGAGGG + Intronic
1052046800 9:23803481-23803503 CCAGGGCTTTGAGAGGAAGATGG - Intronic
1052528932 9:29656788-29656810 CTGGGGCTCTGTGAGGGCGATGG + Intergenic
1052538457 9:29777219-29777241 CTGGGGCTCTGTGAGGGCGATGG + Intergenic
1052836866 9:33256933-33256955 CAAGGGTTCTCTGAGGCTGACGG + Intronic
1052907787 9:33852060-33852082 CCAGCACTTTGGGAGGGTGAGGG + Intronic
1053801032 9:41764632-41764654 TCAGGGCTCTGTGAGGGGGAAGG + Intergenic
1054144168 9:61550205-61550227 TCAGGCCTCTGTGAGGGGGAAGG - Intergenic
1054189463 9:61976782-61976804 TCAGGGCTCTGTGAGGGGGAAGG + Intergenic
1054649053 9:67611827-67611849 TCAGGGCTCTGTGAGGGGGAAGG - Intergenic
1054824462 9:69558735-69558757 ACTGGGGTCTGTGAGGGTGGAGG - Intronic
1054949184 9:70831062-70831084 CCAGGCATCTAAGAGGGTGATGG + Intronic
1055488873 9:76784101-76784123 CCAGGGATCTGTGAAAGTGGAGG - Intronic
1056704642 9:88941532-88941554 CTGGGGCTCTGTGAGGGTGACGG + Intergenic
1056837753 9:89971010-89971032 CCAGGGCTTGGCGAGGGTGAAGG + Intergenic
1057035537 9:91809526-91809548 CCAGCTCTCTGTGGGGCTGAGGG - Intronic
1057270111 9:93645797-93645819 CCAGAGCACTGTGAAGGGGATGG - Intronic
1059715029 9:116905579-116905601 CCTGGGCACTGTGAATGTGAGGG - Intronic
1059934633 9:119297349-119297371 ACAGGGCGCTGAGAAGGTGAAGG - Intronic
1060093323 9:120764386-120764408 CCAGGGCTCGGGGTGGGGGAGGG - Exonic
1060371690 9:123079486-123079508 CCAGCACTCTGGGAGGCTGAGGG - Intronic
1060769256 9:126319159-126319181 CCAGTGCTTTGGGAGGCTGACGG + Intergenic
1061290199 9:129646442-129646464 CCAGGGCTGTGAGAGGGCGGGGG - Intergenic
1061595002 9:131623212-131623234 CCAGTGCTTTGGGAGGCTGAGGG + Intronic
1061744430 9:132729132-132729154 CCAGCGCTTTGAGAGGCTGAAGG - Intronic
1061855262 9:133438464-133438486 CCAGGGCTGAGTGAGTGTGCAGG - Intronic
1062026304 9:134342304-134342326 CCAGGGTTCTGGGAGGGCAATGG - Intronic
1062135995 9:134928869-134928891 CCAGGTCTCTGGGTGGGTGAAGG - Intergenic
1062610801 9:137372603-137372625 CTAGGACCCTGTGAGTGTGAGGG + Intronic
1185757542 X:2663710-2663732 CCAGCACTTTGGGAGGGTGAGGG + Intergenic
1186254188 X:7701566-7701588 CTGGGGCTCTGTGAGGGTGACGG + Intergenic
1186614588 X:11173236-11173258 ACAGGGCTGAATGAGGGTGAGGG + Intronic
1188136604 X:26500690-26500712 CTGGAGCTCAGTGAGGGTGATGG - Intergenic
1188423988 X:30025054-30025076 CCAGTGCTTTGGGAGGCTGAGGG + Intergenic
1189928933 X:45987226-45987248 CCAGGGTTCTAAGAGTGTGAGGG + Intergenic
1189946598 X:46186893-46186915 CCAGGGCTCTGTGAGGGTGATGG - Intergenic
1189971471 X:46421916-46421938 CCAGTGCTCTGAGACTGTGATGG + Intergenic
1190309358 X:49105828-49105850 CCAGGGCTTTGGGAGGTTGACGG + Intergenic
1191167032 X:57402104-57402126 CCGGGGCTCTGTGAGGGTGATGG + Intronic
1191211113 X:57885654-57885676 CTAGGCCTCTGGGATGGTGATGG + Intergenic
1192459069 X:71301895-71301917 CAGGGGCTCTGTGTGGGTGTTGG + Intronic
1192498632 X:71633788-71633810 CCAGGGAGCTGGGAGGCTGAGGG - Intergenic
1192780228 X:74286569-74286591 CCAGCACTCTGGGAGGCTGAGGG + Intergenic
1192939912 X:75901472-75901494 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
1193171916 X:78346933-78346955 CCGGGGCTCTATGAGGGTGATGG + Intergenic
1193306768 X:79959899-79959921 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1195258757 X:103113305-103113327 CGAGGGCACGGGGAGGGTGATGG - Intergenic
1195535013 X:106000910-106000932 TTGGGGCTCTGTGAGGGTGATGG - Intergenic
1195709912 X:107765414-107765436 CCAGGGCTCTGAGGAGCTGAGGG - Intronic
1196517646 X:116631690-116631712 CCATGGGCCTGTGGGGGTGAAGG + Intergenic
1196527283 X:116741093-116741115 CCAGGGCTCTGTGAGGGCGATGG + Intergenic
1196841608 X:119864556-119864578 CCAGCGCTTTGGGAGGCTGAGGG + Intergenic
1196950635 X:120873126-120873148 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196951327 X:120878022-120878044 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196951467 X:120929511-120929533 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196952151 X:120934372-120934394 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196952836 X:120939233-120939255 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196953521 X:120944093-120944115 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196954206 X:120948954-120948976 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196954890 X:120953814-120953836 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196955580 X:120958697-120958719 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196956260 X:120963558-120963580 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196956942 X:120968418-120968440 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196957624 X:120973278-120973300 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196958306 X:120978138-120978160 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1196958988 X:120982998-120983020 CCAAGGGTCTGGGAGGGTAAGGG - Intronic
1198002288 X:132451598-132451620 GCTGGGCTCTGTGGGGGTGGGGG + Intronic
1198131735 X:133702735-133702757 CCAAGGCTCTGTGTGGGGTAAGG + Intronic
1198685387 X:139223019-139223041 CCAAGGCTCTGTCAAGGCGAAGG + Intergenic
1198874110 X:141204292-141204314 CCAGGGCTCTGGGCCTGTGAGGG + Intergenic
1199337498 X:146636976-146636998 CCAGCGCTTTGGGAGGCTGAAGG + Intergenic
1200304184 X:155008150-155008172 GCAGGTCTCTGTGAGGATGGAGG + Intronic
1200851542 Y:7888641-7888663 TGAAAGCTCTGTGAGGGTGACGG + Intergenic
1201471797 Y:14342756-14342778 CTGGGGCTCTGTGCAGGTGATGG + Intergenic
1201473096 Y:14354717-14354739 CCTGGGCTCAGTGTGTGTGATGG + Intergenic
1201640171 Y:16169646-16169668 CTGGGGCTCTTTGAGGGTGATGG + Intergenic
1201662643 Y:16415679-16415701 CTGGGGCTCTTTGAGGGTGATGG - Intergenic
1201749836 Y:17420626-17420648 CCAGGGCTCTGTGAGGGTGATGG + Intergenic
1201905640 Y:19083552-19083574 CTGGGGCTCTGTGAGGGTGATGG - Intergenic
1201908142 Y:19106000-19106022 CTGGGGCTCAGTGAGGGTGATGG + Intergenic
1201981663 Y:19915959-19915981 CCGGGGCTCTGTGAGGGTGATGG + Intergenic
1202271974 Y:23081706-23081728 CCGGGGCTCAGTGTGGGTGATGG + Intergenic
1202294052 Y:23338976-23338998 CCGGGGCTCAGTGTGGGTGATGG - Intergenic
1202424971 Y:24715450-24715472 CCGGGGCTCAGTGTGGGTGATGG + Intergenic
1202445818 Y:24954635-24954657 CCGGGGCTCAGTGTGGGTGATGG - Intergenic