ID: 1146743302

View in Genome Browser
Species Human (GRCh38)
Location 17:35305386-35305408
Sequence AACTTACCCAGGGCTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146743302_1146743310 13 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743310 17:35305422-35305444 CCAGGAAGTGGACTTCCTCCTGG No data
1146743302_1146743307 1 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743302_1146743306 -5 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743306 17:35305404-35305426 AAGTTTGACCATTGAAGGCCAGG No data
1146743302_1146743311 20 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743311 17:35305429-35305451 GTGGACTTCCTCCTGGACACTGG No data
1146743302_1146743312 25 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743312 17:35305434-35305456 CTTCCTCCTGGACACTGGTGCGG 0: 42
1: 50
2: 81
3: 91
4: 324
1146743302_1146743305 -10 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743305 17:35305399-35305421 TGGGTAAGTTTGACCATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146743302 Original CRISPR AACTTACCCAGGGCTCTGTG AGG (reversed) Intergenic
No off target data available for this crispr