ID: 1146743307

View in Genome Browser
Species Human (GRCh38)
Location 17:35305410-35305432
Sequence GACCATTGAAGGCCAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146743301_1146743307 2 Left 1146743301 17:35305385-35305407 CCCTCACAGAGCCCTGGGTAAGT No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743298_1146743307 8 Left 1146743298 17:35305379-35305401 CCATCACCCTCACAGAGCCCTGG 0: 19
1: 43
2: 62
3: 75
4: 613
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743302_1146743307 1 Left 1146743302 17:35305386-35305408 CCTCACAGAGCCCTGGGTAAGTT No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743303_1146743307 -9 Left 1146743303 17:35305396-35305418 CCCTGGGTAAGTTTGACCATTGA No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743297_1146743307 18 Left 1146743297 17:35305369-35305391 CCAGCTCATGCCATCACCCTCAC No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data
1146743304_1146743307 -10 Left 1146743304 17:35305397-35305419 CCTGGGTAAGTTTGACCATTGAA No data
Right 1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146743307 Original CRISPR GACCATTGAAGGCCAGGAAG TGG Intergenic
No off target data available for this crispr