ID: 1146745350

View in Genome Browser
Species Human (GRCh38)
Location 17:35323883-35323905
Sequence CAGGTCACACAGATGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146745346_1146745350 12 Left 1146745346 17:35323848-35323870 CCATCTGAGTAAAAAAAAAAAAG No data
Right 1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146745350 Original CRISPR CAGGTCACACAGATGAAGGA TGG Intergenic
No off target data available for this crispr