ID: 1146747404

View in Genome Browser
Species Human (GRCh38)
Location 17:35344605-35344627
Sequence TTGATAACAAGATCCACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146747404_1146747407 -5 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747407 17:35344623-35344645 ATCAAGTGTCCAACAAAGGCTGG No data
1146747404_1146747413 26 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747413 17:35344654-35344676 AGGGGATTAATTCTTCAAATAGG No data
1146747404_1146747406 -9 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747406 17:35344619-35344641 TGTTATCAAGTGTCCAACAAAGG No data
1146747404_1146747409 6 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747409 17:35344634-35344656 AACAAAGGCTGGAACATTCCAGG No data
1146747404_1146747410 7 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747410 17:35344635-35344657 ACAAAGGCTGGAACATTCCAGGG No data
1146747404_1146747411 8 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747411 17:35344636-35344658 CAAAGGCTGGAACATTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146747404 Original CRISPR TTGATAACAAGATCCACCAA GGG (reversed) Intergenic
No off target data available for this crispr