ID: 1146747408

View in Genome Browser
Species Human (GRCh38)
Location 17:35344632-35344654
Sequence TGGAATGTTCCAGCCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146747408_1146747414 21 Left 1146747408 17:35344632-35344654 CCAACAAAGGCTGGAACATTCCA No data
Right 1146747414 17:35344676-35344698 GACACCATGAATCTGTCCTTTGG No data
1146747408_1146747413 -1 Left 1146747408 17:35344632-35344654 CCAACAAAGGCTGGAACATTCCA No data
Right 1146747413 17:35344654-35344676 AGGGGATTAATTCTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146747408 Original CRISPR TGGAATGTTCCAGCCTTTGT TGG (reversed) Intergenic
No off target data available for this crispr