ID: 1146747412 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:35344652-35344674 |
Sequence | TATTTGAAGAATTAATCCCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146747412_1146747414 | 1 | Left | 1146747412 | 17:35344652-35344674 | CCAGGGGATTAATTCTTCAAATA | No data | ||
Right | 1146747414 | 17:35344676-35344698 | GACACCATGAATCTGTCCTTTGG | No data | ||||
1146747412_1146747416 | 14 | Left | 1146747412 | 17:35344652-35344674 | CCAGGGGATTAATTCTTCAAATA | No data | ||
Right | 1146747416 | 17:35344689-35344711 | TGTCCTTTGGAAACTCATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146747412 | Original CRISPR | TATTTGAAGAATTAATCCCC TGG (reversed) | Intergenic | ||