ID: 1146747412

View in Genome Browser
Species Human (GRCh38)
Location 17:35344652-35344674
Sequence TATTTGAAGAATTAATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146747412_1146747414 1 Left 1146747412 17:35344652-35344674 CCAGGGGATTAATTCTTCAAATA No data
Right 1146747414 17:35344676-35344698 GACACCATGAATCTGTCCTTTGG No data
1146747412_1146747416 14 Left 1146747412 17:35344652-35344674 CCAGGGGATTAATTCTTCAAATA No data
Right 1146747416 17:35344689-35344711 TGTCCTTTGGAAACTCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146747412 Original CRISPR TATTTGAAGAATTAATCCCC TGG (reversed) Intergenic