ID: 1146747413

View in Genome Browser
Species Human (GRCh38)
Location 17:35344654-35344676
Sequence AGGGGATTAATTCTTCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146747408_1146747413 -1 Left 1146747408 17:35344632-35344654 CCAACAAAGGCTGGAACATTCCA No data
Right 1146747413 17:35344654-35344676 AGGGGATTAATTCTTCAAATAGG No data
1146747405_1146747413 25 Left 1146747405 17:35344606-35344628 CCTTGGTGGATCTTGTTATCAAG No data
Right 1146747413 17:35344654-35344676 AGGGGATTAATTCTTCAAATAGG No data
1146747404_1146747413 26 Left 1146747404 17:35344605-35344627 CCCTTGGTGGATCTTGTTATCAA No data
Right 1146747413 17:35344654-35344676 AGGGGATTAATTCTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146747413 Original CRISPR AGGGGATTAATTCTTCAAAT AGG Intergenic
No off target data available for this crispr