ID: 1146763866

View in Genome Browser
Species Human (GRCh38)
Location 17:35501287-35501309
Sequence GGCTGAACACCAGGAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146763861_1146763866 -1 Left 1146763861 17:35501265-35501287 CCCAATGGAGGATCAATATGGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1146763866 17:35501287-35501309 GGCTGAACACCAGGAGGAACTGG 0: 1
1: 0
2: 2
3: 29
4: 302
1146763862_1146763866 -2 Left 1146763862 17:35501266-35501288 CCAATGGAGGATCAATATGGTGG 0: 1
1: 0
2: 3
3: 17
4: 126
Right 1146763866 17:35501287-35501309 GGCTGAACACCAGGAGGAACTGG 0: 1
1: 0
2: 2
3: 29
4: 302
1146763860_1146763866 0 Left 1146763860 17:35501264-35501286 CCCCAATGGAGGATCAATATGGT 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1146763866 17:35501287-35501309 GGCTGAACACCAGGAGGAACTGG 0: 1
1: 0
2: 2
3: 29
4: 302
1146763856_1146763866 25 Left 1146763856 17:35501239-35501261 CCTTGTTAGAGCAGAGCATGGCA 0: 1
1: 0
2: 4
3: 20
4: 169
Right 1146763866 17:35501287-35501309 GGCTGAACACCAGGAGGAACTGG 0: 1
1: 0
2: 2
3: 29
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146763866 Original CRISPR GGCTGAACACCAGGAGGAAC TGG Intronic
900473379 1:2865142-2865164 GACTGAGGACCAGGAAGAACGGG + Intergenic
900754718 1:4425706-4425728 GGCAGAACACGAGCAGGAAACGG - Intergenic
900810054 1:4795028-4795050 GGCTGGGCATCAGGAGGAGCTGG + Intergenic
901484703 1:9550754-9550776 GGCTTAAGACCAGGAGGCAGAGG - Intronic
903210301 1:21814555-21814577 GGCTGTAGACCAGGAAGAAGCGG - Exonic
903773451 1:25778363-25778385 GGCTAGACACCAGGAAGAACTGG + Intronic
904883024 1:33714849-33714871 GGCAAAACACCAGGGGGAAAGGG + Intronic
905062103 1:35149010-35149032 GGCTGAACACCAGGAAGGAATGG - Intergenic
905728503 1:40276415-40276437 GGAAGAAAACCAGGAGAAACTGG + Intronic
907246246 1:53110892-53110914 GTCTGATCCCCAGGAGGAACTGG - Intronic
907393535 1:54174304-54174326 GGCTGAGCCCCAGGAGGAGTAGG - Intronic
910623725 1:89284451-89284473 GGCTCAACACCACGTGGAAGTGG - Intergenic
910853323 1:91670051-91670073 GGCTGAACACCGGGAAGGAATGG - Intergenic
911036382 1:93553738-93553760 GGCAGGACACCATGAGCAACAGG - Exonic
911191329 1:94951544-94951566 AGCTGAGCTCCAGCAGGAACCGG - Intergenic
912460581 1:109828315-109828337 GGCTGCCCTCCATGAGGAACAGG + Intergenic
914751009 1:150534963-150534985 ATCTGAACACCAGGAGGGGCTGG - Intergenic
916406326 1:164501013-164501035 GACAGAGCACCTGGAGGAACAGG + Intergenic
919010452 1:191954525-191954547 GGCTGAGCAGGAGGAGGAAGAGG - Intergenic
919314690 1:195956145-195956167 GGCTGAAAAGAAGGAGGAAGAGG + Intergenic
920032432 1:203045469-203045491 GACTGAACTCGAGGAGGACCTGG + Intronic
920645630 1:207801899-207801921 CTCTGAACACCAGGAGAAATCGG + Intergenic
922164929 1:223107632-223107654 GGCTGAGCAGCAGGTGGGACAGG + Intergenic
922702338 1:227769206-227769228 GGCTCAACACCGGGAGGAACAGG + Intronic
922967073 1:229699301-229699323 GGCTGAGCAGGAGGAGGAAAAGG + Intergenic
923595459 1:235357893-235357915 GGCTGAATACCCGGAGGCAGGGG + Intergenic
1063034948 10:2277243-2277265 AGCTGAGCTCCAGGAGGAGCCGG - Intergenic
1063940431 10:11123072-11123094 GACTGAGGACCGGGAGGAACTGG - Intronic
1065751920 10:28895500-28895522 GGCTGAAACCCAGGAGGCAGAGG - Intergenic
1066238025 10:33505945-33505967 GGCTGAATACAGGGAGGTACTGG - Intergenic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1066731475 10:38440768-38440790 CACTGAACTCCAGGAGGAAGAGG - Intergenic
1068030401 10:51698576-51698598 GGCAGACCACCAGGAGTCACGGG + Exonic
1068672045 10:59733357-59733379 GGCTGAACTCCAGGAAGGAATGG - Intronic
1069101445 10:64325984-64326006 GGCTGAAGAGCAGGAGGAACAGG + Intergenic
1070399436 10:76040386-76040408 GGCTGAACACAATGAGAAAAAGG - Intronic
1070573704 10:77661039-77661061 TGCTGAACACATGGAGGAACTGG + Intergenic
1072733261 10:97862604-97862626 GGCTGAGGAAGAGGAGGAACAGG + Intronic
1073883290 10:108007933-108007955 GGCTCAACACCATGTGGAAGTGG + Intergenic
1074108301 10:110404841-110404863 GGCAGAAGACCCGGAGGTACTGG - Intergenic
1075642194 10:124072800-124072822 GGCAGAACCCCAGGAGGGACAGG + Intronic
1076241938 10:128915342-128915364 GGCTGAAGAGCTGGAGGCACAGG - Intergenic
1077415431 11:2422390-2422412 GGCTGGACACAAGGGGGCACTGG + Intronic
1079788098 11:24701128-24701150 GGGTGATAACCAGGTGGAACAGG - Intronic
1082263543 11:50096334-50096356 TGCTGAACACAAGGAGGTGCTGG + Intergenic
1082645558 11:55720245-55720267 GGCTGAACCTCAGGAAGAAGTGG - Intergenic
1083037746 11:59656002-59656024 GGAGGAACACTAGGAGGAAAAGG + Exonic
1083082436 11:60108291-60108313 GGCTGAACACCGGGAAGGAACGG - Intergenic
1083260965 11:61522962-61522984 GGCTGGACACCAGGAGAGATTGG - Intronic
1083908196 11:65687974-65687996 GGCTGAAGACCAGCTGAAACAGG + Intergenic
1084065949 11:66704614-66704636 GCCTGAACGCCTGGAGGACCTGG - Exonic
1084127353 11:67108637-67108659 GGCTTAAGACCAGGAGGCAGAGG + Intergenic
1085296213 11:75433209-75433231 GGCTGGACGCCAGGAGGGAGGGG + Intergenic
1086530611 11:87780449-87780471 GGCTGATTACCACGATGAACTGG - Intergenic
1086944137 11:92828541-92828563 GCATTCACACCAGGAGGAACTGG - Intronic
1088033130 11:105276643-105276665 GGCTGAAGAGAAGGAGGAAGAGG + Intergenic
1088696302 11:112368988-112369010 GGCTGAAGAGGAGGAGGAAAAGG - Intergenic
1088712719 11:112523260-112523282 GTCTGAAAACCATAAGGAACAGG + Intergenic
1088850529 11:113699976-113699998 GGCTGACCCCAAGGAGGATCCGG + Intronic
1090623405 11:128583222-128583244 GGCAGAGCCCAAGGAGGAACAGG + Intronic
1091697328 12:2636725-2636747 GGCAGTACACCAGGAGGGACAGG - Intronic
1091783783 12:3230297-3230319 AGCTGAACACCAGGAAGTCCTGG - Intronic
1092720410 12:11435326-11435348 GGCTGAGCACCAGTAGGTAATGG + Intronic
1093954808 12:25203402-25203424 GGCTGAAAACTAGCAGAAACTGG - Intronic
1094025411 12:25956663-25956685 TGTTGATCACCAGGAGGATCTGG - Intergenic
1095294565 12:40513508-40513530 GGCTGAAACACAAGAGGAACTGG - Intronic
1096360648 12:50983104-50983126 GGCTGAAGCCCAGGAGGTAGAGG - Intronic
1096383381 12:51177855-51177877 GGCTGAAGAGGAGGAGGAAGAGG - Intergenic
1099999393 12:89814751-89814773 GGCTGAAGAGGAGGAGGAAGAGG - Intergenic
1100352439 12:93797310-93797332 GTCTGGAGACCATGAGGAACAGG - Intronic
1102055713 12:109895021-109895043 GGTTGACCACCTTGAGGAACTGG + Intergenic
1103621425 12:122189598-122189620 GGCGGGACCCCAGGAGGAAAGGG - Intronic
1103762222 12:123259098-123259120 GGCTGAAGGCCAGCAGGAACAGG - Intergenic
1103915314 12:124372874-124372896 TGCTGACCACCAGGAGGTCCTGG - Intronic
1103978714 12:124721776-124721798 GCATGAACACCAGGAGGCAGAGG - Intergenic
1104282751 12:127392710-127392732 GGTTGAATACCAGGTGGAGCTGG - Intergenic
1104462216 12:128965051-128965073 AGCCGAACACCAGGAGGCAGAGG - Intronic
1104575932 12:129965839-129965861 GGGTGAACATCAGCAGGAACAGG + Intergenic
1104774283 12:131382833-131382855 GGCTCAGCACCAGGAGGGAGCGG - Intergenic
1105784306 13:23733462-23733484 GGCTGGAATCCAGGAGGAGCAGG + Intronic
1106073900 13:26440967-26440989 TGGGGAACTCCAGGAGGAACCGG + Intergenic
1107032084 13:35863498-35863520 GGGTGAACACTAGGAAGAATTGG + Intronic
1107229108 13:38086712-38086734 CGCTGAACAGCAGGAGCAAAAGG + Intergenic
1110562984 13:76929276-76929298 GGCTGAAAAGTAGGAGGAAGAGG + Intergenic
1111182751 13:84689997-84690019 GGCTGAATGCCAGGAGCCACTGG + Intergenic
1112695023 13:101938090-101938112 GGCAGAACCCCATGAGGACCTGG - Intronic
1113521420 13:110944472-110944494 TGCTGAGCACCAGGAGGCAGTGG + Intergenic
1113795407 13:113054415-113054437 GTCTGAACATCTGCAGGAACAGG + Intronic
1114270151 14:21095976-21095998 GGCTGTACACCAGGATGTTCCGG - Intronic
1114798150 14:25740081-25740103 GGCTCAACACCATGTGGAAGCGG + Intergenic
1115119649 14:29925622-29925644 TTCTGAACTCCAGGAGGAAGTGG + Intronic
1115436259 14:33378280-33378302 GGCTGAACCCTAGAAGCAACAGG + Intronic
1117215751 14:53549858-53549880 AGATGAAAACCAGGAGGAAGTGG + Intergenic
1117428365 14:55624747-55624769 GGAGGAACACCAGGAGGTAGTGG + Intronic
1117474944 14:56084537-56084559 GGGGGAACACCGGGAGAAACTGG - Intergenic
1118690490 14:68334444-68334466 GGCTGAAGAACAGGAGGAGCTGG + Intronic
1119263747 14:73252653-73252675 TGCAGAACACCAGGCGGGACTGG - Exonic
1119363907 14:74074976-74074998 TGCTGAATACCAGGTGGGACTGG + Exonic
1121012404 14:90528211-90528233 GGCTGGACAGAAGGAGGAGCTGG - Exonic
1122787381 14:104170033-104170055 GGCTCACAACCAGGAGGAAGGGG - Intronic
1122802464 14:104238515-104238537 GGCACACCACCCGGAGGAACAGG - Intergenic
1125336989 15:38636554-38636576 GCCTGAAAACCAGGAGGCAGGGG - Intergenic
1125394011 15:39227167-39227189 TGCTGAACACAAGGAGGTGCTGG - Intergenic
1125418502 15:39478280-39478302 GGGAGAACACCAAGAGGAAAGGG - Intergenic
1125886194 15:43231413-43231435 GGCTGAGAACCAGGAGCTACTGG - Intergenic
1125929384 15:43589751-43589773 GGCTGGAGTCCAGGAGGAAGGGG - Intronic
1125942551 15:43689583-43689605 GGCTGGAGTCCAGGAGGAAGGGG - Intergenic
1125978878 15:43981421-43981443 GGCTGAAGAGGAGGAGGAAAAGG + Intronic
1126424847 15:48516248-48516270 GGAGGAAAGCCAGGAGGAACAGG + Exonic
1127428471 15:58878986-58879008 GGCTGAACTACAGAAAGAACTGG + Intronic
1128218700 15:65952551-65952573 GACAGAACACCAGGGTGAACAGG - Intronic
1128974392 15:72139361-72139383 GGCTGAAGAGGAGGAGGAAAAGG + Intronic
1128989893 15:72250909-72250931 GGCTGCTCAGCAGGAGGAACTGG + Exonic
1131303859 15:91224096-91224118 GGCTGAAGACCAGGAGGGCCAGG + Intronic
1132557840 16:580239-580261 GGGTGAACACCAGGTAGTACAGG - Exonic
1133871968 16:9697238-9697260 GGATGAAAACCAGGAGCTACTGG - Intergenic
1135688975 16:24521145-24521167 GCCTGAGCAACAGGTGGAACAGG + Intergenic
1135785815 16:25347970-25347992 GGAGGAAGACCAGGAGAAACAGG - Intergenic
1136137770 16:28267810-28267832 GGCTGAACCCCAGGAGGACTAGG + Intergenic
1140755125 16:78059914-78059936 GGCTGAACACCGGGAAGGAACGG - Intronic
1141429312 16:83962983-83963005 GGATGCACCCCAGGAGGAGCAGG - Intronic
1141610707 16:85179679-85179701 GCCTGAAGACCAGGAGTAAGAGG - Intronic
1141900851 16:86989221-86989243 GGGTGAGCCCCAGGAGGAAGGGG + Intergenic
1144043398 17:11432891-11432913 GGCTGGAGAGCAGGAGGAAATGG + Intronic
1145391522 17:22459520-22459542 GGGTGAGCAGCAGGAGGAAAGGG + Intergenic
1145865478 17:28238604-28238626 GGCTGAACACCGGGAAGGAATGG - Intergenic
1146763866 17:35501287-35501309 GGCTGAACACCAGGAGGAACTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147810552 17:43167009-43167031 GGCTGAACACCGGGAAGGAACGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151197833 17:72444723-72444745 GGCTGCACCCCAGGCAGAACTGG + Intergenic
1151523008 17:74644347-74644369 GGCTCAACATCAGGAGGGAGAGG + Intergenic
1152509408 17:80775188-80775210 GGCTGAAAACAAGAAGGAAGTGG - Intronic
1153811118 18:8752744-8752766 GCCTGAACCCCAGGAGCAACTGG - Intronic
1153854950 18:9136669-9136691 GGCTGAGCAGCAGGAGGGGCGGG + Intronic
1154162156 18:11988749-11988771 GGCAAAACTGCAGGAGGAACAGG + Intronic
1159954006 18:74506820-74506842 GCCTTTACACCAGAAGGAACAGG - Intronic
1161461625 19:4400876-4400898 GGCTGAACACTTAGACGAACTGG - Intergenic
1163698023 19:18773823-18773845 CACTGACCACCAGGAGCAACTGG + Intronic
1163903165 19:20125739-20125761 GGCTGAAGAACAGGAGGATGCGG + Intronic
1164161362 19:22627479-22627501 TGCTAAACACCAGGAAGAAGAGG + Intergenic
1166020521 19:40024663-40024685 GGAGGAACACTAGGAGGAAAAGG + Intergenic
1166033795 19:40152740-40152762 GGGTGACAACCAGAAGGAACTGG + Intergenic
1167072272 19:47228087-47228109 GGCTGGAGACTCGGAGGAACTGG - Intronic
926662732 2:15486031-15486053 AGCTGAACAGCAGCAGGAAAGGG + Intronic
928277354 2:29915212-29915234 TGCTGAAAATCAGGAGGAACTGG - Intronic
928284353 2:29976010-29976032 AGCCGAACACCAGGAGTATCTGG + Intergenic
929818006 2:45251245-45251267 CTCTGAACACCAGAAGGAAAAGG - Intergenic
931274728 2:60734325-60734347 TGCTGAACACCTGGAGGTGCTGG - Intergenic
931587294 2:63841778-63841800 GGCTGTACTGCAGGAGGCACTGG - Exonic
932433761 2:71691051-71691073 GGGGGAACACCCGGAGGAAAGGG - Intergenic
933838321 2:86264093-86264115 TGCCCAACACCAGGAAGAACAGG + Intronic
934159056 2:89230839-89230861 ATCAGAACAGCAGGAGGAACAGG + Intergenic
934208218 2:89951586-89951608 ATCAGAACAGCAGGAGGAACAGG - Intergenic
934209425 2:89962697-89962719 GTCAGAACAGCAGGAGGAATAGG - Intergenic
936666718 2:114605351-114605373 GGCTGAAGAGGAGGAGGAAGAGG - Intronic
937293419 2:120795698-120795720 GGCTGGACACCTGGAGGAGTGGG - Intronic
937546705 2:123030898-123030920 GGCTGAAGAGAAGGAGGAAGAGG - Intergenic
938384464 2:130854472-130854494 GGCTGCACCCCAGGAGGGTCAGG + Intronic
938741445 2:134236257-134236279 GGCTAAACACCAGGAATAAAAGG - Intronic
938824339 2:134990336-134990358 GGCTGAGGACGAGGAGGAACAGG - Intronic
940722183 2:157294225-157294247 GGCTGAACAGGAGAAGGCACTGG + Intronic
941171848 2:162147352-162147374 TGATGAATACCAAGAGGAACAGG - Exonic
942209667 2:173657998-173658020 AGCTCCACTCCAGGAGGAACCGG + Intergenic
943185390 2:184599479-184599501 GGCTGGTCACAAGGAGGAAGTGG + Intronic
943724650 2:191240967-191240989 GGCTGAAGAGGAGGAGGAAAAGG + Intergenic
944193103 2:197024284-197024306 GGCAGGACACCAGGAAGAATGGG - Intronic
944235386 2:197437320-197437342 GCCTGAGAACCAGGAGGAAGGGG - Intergenic
945289557 2:208113586-208113608 AGTGGAACACCAGGAGGGACAGG - Intergenic
946295133 2:218777962-218777984 CCCTGGACACCAGGAGGAAATGG - Intergenic
946682530 2:222232167-222232189 AGCAGAACAGCTGGAGGAACTGG - Exonic
947196719 2:227575058-227575080 GGCTGCTCACTAGGATGAACAGG - Intergenic
948048152 2:234959027-234959049 AGCTGATCACCAGGAGCAGCTGG + Intronic
948599013 2:239097503-239097525 GGCTGACCACCATGAGGTTCAGG - Intronic
1169219252 20:3811999-3812021 GGCTGGGCCCCAGGAGGACCAGG - Intergenic
1171219566 20:23382690-23382712 GGCTCAACAGCAGGATGAAAGGG + Intronic
1172678575 20:36694128-36694150 GGCTGAGGACGAGGAGGAACAGG + Intronic
1173775403 20:45702144-45702166 GGCAGAACACCACCAGGAACTGG - Exonic
1174049545 20:47758250-47758272 GCTTGAACACCAGGAGGCAGAGG - Intronic
1174091335 20:48050844-48050866 GGCTGAGGAACAGGAGGAAGAGG + Intergenic
1174538758 20:51273301-51273323 GGATGTACAGCAGGAGGAAGTGG + Intergenic
1175719681 20:61278558-61278580 GGCTGAGCACCAGGCGTAAGAGG - Intronic
1176215512 20:63945948-63945970 GACTGAGCAGCAGCAGGAACAGG - Exonic
1178104782 21:29305713-29305735 GGGAGAACAGCAGCAGGAACAGG - Intronic
1178208632 21:30501092-30501114 GGCTGAGGAGGAGGAGGAACGGG - Intergenic
1178252764 21:31020511-31020533 TGCTGAACAGCAGAAGGAGCTGG + Intergenic
1178919948 21:36732237-36732259 GGCTGGACAGCAGGAGGATGAGG - Intronic
1179611250 21:42552782-42552804 GGCTGAAAAGCAGGAAGAAGAGG + Intronic
1179772496 21:43632656-43632678 GGCTGAAGAGGAGGAGGAAGAGG - Intronic
1179887925 21:44322313-44322335 GGCAGACCACCAGCAGGAAGAGG - Intronic
1180083505 21:45497360-45497382 TGCTGACCAACAGGAGGGACGGG - Intronic
1180893196 22:19306662-19306684 TGCTGAAGCCCAGGAGGAAGAGG - Intergenic
1181312310 22:21952139-21952161 GTCTGTACAACAGGAAGAACTGG - Intronic
1183465588 22:37978744-37978766 GGCTGAGCACCTTGAGGAAGAGG + Intronic
1183472703 22:38018005-38018027 AGCTGAAGCCCAGGAGGATCTGG - Intronic
1183802479 22:40178688-40178710 GGGTGAACACCAGGAGGTTTGGG + Intronic
949551665 3:5116869-5116891 AGCTGAACAAGAGAAGGAACAGG - Intergenic
949896118 3:8768562-8768584 CGCTGAACATCCCGAGGAACTGG - Exonic
950660113 3:14461923-14461945 GGCTGAGCAGCAGGGGGAGCCGG - Intronic
951170510 3:19536598-19536620 GGCTGAAGAGAAGGAGGAAGAGG + Intergenic
951991393 3:28679350-28679372 GGCTGTAAAGCAGGAGGAATGGG - Intergenic
952146013 3:30532866-30532888 TGCTGAACACATGGAGGCACTGG + Intergenic
952159799 3:30682108-30682130 GGCCCAACTCCAGGAGGAACAGG - Intronic
952822803 3:37499392-37499414 AGCAGAACACCTAGAGGAACCGG - Intronic
952908359 3:38159556-38159578 GGCTGAGGACAAGGAGGAAAAGG + Intergenic
955175057 3:56605876-56605898 GGCAGAGCACCAGGGGGAAGGGG - Intronic
956390802 3:68770951-68770973 GGCTGGACATCAAGAGGAGCAGG + Intronic
957273692 3:78063240-78063262 AGCTGAGCTCCAGGAGGAAATGG - Intergenic
957861380 3:85956159-85956181 AGCTAGACACCAGGAGTAACAGG - Intronic
962097016 3:132302983-132303005 GGCTGAACACCGGGATGGAACGG - Intergenic
962162648 3:133015147-133015169 GGCTGAAGAGCAGGAAGAAGAGG - Intergenic
962708882 3:138069143-138069165 GGCTGAAGAGGAGGAGGAAGAGG - Intronic
964933355 3:162052030-162052052 GGCTGAACACCGGGAAGGAACGG - Intergenic
966003049 3:174973708-174973730 GTCTGTACCACAGGAGGAACAGG - Intronic
966837427 3:184059847-184059869 GGCTGACCACCATCAGGGACAGG - Exonic
967035538 3:185646128-185646150 GACTGAACTCCTGTAGGAACAGG + Intronic
968455154 4:694014-694036 GGCTGAACAACATGAGGAGGTGG - Intergenic
970969493 4:21965250-21965272 AGGTGAAGAGCAGGAGGAACTGG - Intergenic
971251859 4:24979271-24979293 GGGTGTACACCACCAGGAACAGG + Intronic
971621548 4:28860416-28860438 GGCTGAAGAAGAGGAGGAAGAGG + Intergenic
976432468 4:84978695-84978717 GTCTGAGCACCAGGAGGCAAGGG - Intergenic
976613775 4:87055460-87055482 GTGTGAAAACAAGGAGGAACAGG - Intronic
978587956 4:110293376-110293398 TGGTCAACACCAAGAGGAACCGG + Intergenic
978982583 4:114967227-114967249 AGCTGAACTCCAGAAGGAAAAGG + Intronic
979257857 4:118623378-118623400 CACTGAACTCCAGGAGGAAGAGG - Intergenic
979330492 4:119417184-119417206 CACTGAACTCCAGGAGGAAGAGG + Intergenic
980072728 4:128260684-128260706 GGCTGAACACCGAAAGGAACTGG + Intergenic
980347699 4:131643831-131643853 GACTGAACACACTGAGGAACTGG - Intergenic
981708260 4:147683828-147683850 GGCTGAGCACGAGGAGGTAGTGG + Exonic
982918309 4:161242781-161242803 GTTTGATCACAAGGAGGAACTGG - Intergenic
983797251 4:171880193-171880215 GGCTGAACAAGAGGAGGTTCAGG - Intronic
983897702 4:173099363-173099385 GGCTGAACACCAGGAAGGAACGG + Intergenic
984819324 4:183866409-183866431 CTCAGAACACCAGGAGAAACAGG - Intronic
987543116 5:19280319-19280341 GGCTGGACACCAGCAGAAAAGGG - Intergenic
988469650 5:31526577-31526599 GGAGGAAAACAAGGAGGAACTGG + Exonic
989362093 5:40613345-40613367 GGCTGAACACCAGAATCAACTGG - Intergenic
989557448 5:42813869-42813891 GGCTGAACACCGGAAAGAACTGG + Intronic
990897937 5:60718884-60718906 GGCTGAACAGGAGGAGGAAGAGG - Intergenic
993993564 5:94690519-94690541 GGCAGAACAGCAGAAGGAACTGG + Intronic
995526252 5:113052831-113052853 GGCTGGTCACCAGAAGGACCAGG - Intronic
995604824 5:113842418-113842440 TGCTGAACACAAGGAGGTAAGGG + Intergenic
1000703097 5:164477488-164477510 GGCTGAAAAGGAGGAGGAAGAGG + Intergenic
1001447752 5:171799029-171799051 TGATGAACACAAGGATGAACTGG + Intergenic
1001879179 5:175228392-175228414 GGCTGAACACGTGGAGGTACTGG + Intergenic
1002694991 5:181081292-181081314 GACTGACCACCTTGAGGAACTGG - Intergenic
1003215742 6:4109084-4109106 GGCAGGACACCATGAGCAACAGG - Intronic
1004145845 6:13065357-13065379 GGAGGAAAACCAGGAGGGACTGG + Intronic
1004680829 6:17892746-17892768 TGCTGAACACAAGAAGGTACTGG + Intronic
1005317095 6:24613642-24613664 GAAAGAACACAAGGAGGAACAGG + Intronic
1009396267 6:63203845-63203867 GGCTCAACACCATGTGGAAGCGG + Intergenic
1014061533 6:117077509-117077531 GGCTGAAGAAGAGGAGGAAGAGG - Intergenic
1015851127 6:137573890-137573912 GACTGAACAGCAGGAGAATCAGG + Intergenic
1016844956 6:148560762-148560784 GGCTGATCATCAGGAAGGACAGG + Intergenic
1018190382 6:161305006-161305028 GGCTGCAGAGCAGGAGGCACGGG + Intergenic
1018665038 6:166127667-166127689 GGCTGGAGGCCAGGAGAAACTGG + Intergenic
1019780780 7:2938519-2938541 GGCTGAATACTGGGAGGTACAGG + Intronic
1019866135 7:3712128-3712150 GGCTGCACAGCAGGAGGCGCAGG + Intronic
1020398883 7:7751620-7751642 GGCTCAAGCCCAGGAGGAGCTGG - Intronic
1020753376 7:12170462-12170484 GACAGAACACCTGGAGGAAGGGG - Intergenic
1021201595 7:17733741-17733763 GGCTGAGGAGAAGGAGGAACAGG - Intergenic
1021214822 7:17902758-17902780 GGCTGCAGACCATTAGGAACTGG + Intronic
1021809026 7:24385044-24385066 GGCTGAAGAGGAGGAGGAAGAGG - Intergenic
1023157535 7:37265895-37265917 GCCAGAGCACCGGGAGGAACAGG + Intronic
1023386713 7:39665205-39665227 GGCTGAAGAGGAGGAGGAAGAGG - Intronic
1023398319 7:39772485-39772507 TGCTGAACACAAGGAGGTGCTGG - Intergenic
1023399846 7:39784664-39784686 CACTGAACTCCAGGAGGAAGAGG - Intergenic
1023906362 7:44524658-44524680 GGCTTAACCCCAGGAGGCAGAGG + Intronic
1024072783 7:45800448-45800470 CACTGAACTCCAGGAGGAAGAGG - Intergenic
1024650557 7:51399732-51399754 CACTGAACTCCAGGAGGAAGAGG + Intergenic
1025054675 7:55755316-55755338 CACTGAACTCCAGGAGGAAGAGG + Intergenic
1025134339 7:56398006-56398028 TGCTGAACACAAGGAGGTGCTGG + Intergenic
1025184393 7:56845948-56845970 CACTGAACTCCAGGAGGAAGAGG + Intergenic
1025686192 7:63720086-63720108 TGCTGAACACAAGGAGGTGCTGG - Intergenic
1025909673 7:65818369-65818391 TGCTGAACACAAGGAGGTGCTGG - Intergenic
1025911244 7:65830532-65830554 CACTGAACTCCAGGAGGAAGAGG - Intergenic
1027518959 7:79180388-79180410 GGCCGAAGGCAAGGAGGAACAGG + Intronic
1029485840 7:100839677-100839699 GGCTGAACACCAGGAAGGAACGG + Intronic
1029821740 7:103153022-103153044 GGCTGAACACCGGGAAGGAATGG + Intergenic
1031186765 7:118491321-118491343 GACTGATCACCAGGATAAACTGG + Intergenic
1032050160 7:128644137-128644159 CACTGAACTCCAGGAGGAAGAGG - Intergenic
1033268874 7:139912901-139912923 GGCTTAACACGAGGAAGAGCAGG + Intronic
1034518347 7:151599752-151599774 GGCTGCACAGCAGGAGGCAAGGG - Intronic
1035598085 8:877362-877384 GGCTAAACACCATGGGGGACAGG - Intergenic
1035600231 8:892932-892954 GGATGCAGACCAGGAGGCACGGG - Intergenic
1036699377 8:11001889-11001911 GGCTGAACAGCAGAGGGACCAGG - Intronic
1038198513 8:25390120-25390142 GGCTGTGAAGCAGGAGGAACAGG + Intronic
1039593280 8:38768505-38768527 AGCTGCACAGCAGAAGGAACGGG + Intronic
1039645229 8:39275045-39275067 AAATGAACACCAGGAGGCACGGG - Intronic
1041515139 8:58691533-58691555 GGCTGAACACCGGGAAGGAATGG + Intergenic
1042408713 8:68436650-68436672 AGCTGAACACCAGTAGGAAACGG - Intronic
1043418722 8:80077400-80077422 GGCTGAACATTATGAGGACCAGG - Intronic
1043513811 8:80977329-80977351 GGCTGTAAACCAGCAGCAACAGG + Intronic
1047322237 8:123797477-123797499 GGCTGAAGAGGAGGAGGAAGAGG - Intronic
1049595915 8:143483335-143483357 GGCTCAGCACCAGGAGAAACCGG - Intronic
1052142186 9:25000962-25000984 GGCTGAGAATGAGGAGGAACAGG + Intergenic
1052795807 9:32922285-32922307 GGCTGAAGGGCAGGAGGAAATGG + Intergenic
1055399235 9:75905654-75905676 GGCTGAACAGCAGGAAGTAAGGG + Intronic
1056085042 9:83139606-83139628 GGCTGAGGAGGAGGAGGAACAGG + Intergenic
1056288305 9:85113991-85114013 GTCTGACCACCTTGAGGAACTGG - Intergenic
1056660260 9:88537985-88538007 TGCTGAGGACAAGGAGGAACTGG + Intronic
1057665301 9:97039690-97039712 GACCGGACACCAGGAGGGACGGG + Intergenic
1060325175 9:122607914-122607936 CTCTGAACACCAGGAGCAGCAGG + Intergenic
1061362657 9:130153624-130153646 GGCTGAGGACCACGAGGAGCGGG + Intergenic
1061835090 9:133323450-133323472 GGCTGAACACCAGCAGGGAGTGG + Intergenic
1061847510 9:133395975-133395997 GACTGACCCCCAGGAGGCACAGG + Intronic
1186168731 X:6855111-6855133 GGCTGAAGAGGAGGAGGAAGAGG - Intergenic
1186405222 X:9295932-9295954 GGCTGAAGAGGAGGAGGAAGAGG - Intergenic
1187043078 X:15617276-15617298 GGCTCAATACCAGGAGGATGAGG + Intergenic
1187548967 X:20282151-20282173 GGATGAACAGCCAGAGGAACAGG - Intergenic
1189473531 X:41332881-41332903 GGATGAGGAACAGGAGGAACCGG - Intergenic
1194179472 X:90694968-90694990 GGCTGAACACCCTGAGGACTAGG + Intergenic
1196417977 X:115493299-115493321 GGCTTTACACTAGGAGCAACAGG - Intergenic
1196940396 X:120770015-120770037 GGCAGAACATCTGGAGGAATAGG - Intergenic
1197910461 X:131478185-131478207 GGATGAAAGCCAGCAGGAACAGG - Intergenic
1198203544 X:134445290-134445312 TGCTGAACACGTGGAGGTACTGG - Intergenic
1198512480 X:137366481-137366503 GGCTGAACAGCAGGAGCAGGCGG - Intergenic
1198566616 X:137911829-137911851 CACTGAACACCTGGAGAAACAGG - Intergenic
1200333272 X:155320093-155320115 GACAGAACACCAGGGGGAAGGGG + Intronic
1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG + Intergenic
1201326417 Y:12765256-12765278 GGCTGAGGACAAGGAGGAAGAGG + Intronic
1201365570 Y:13203079-13203101 GGCTGACTACCAGGAGGCAGAGG + Intergenic
1201559112 Y:15297196-15297218 GGCTGAAGAGGAGGAGGAAAAGG + Intergenic
1201559135 Y:15297532-15297554 GGCTGAAGAGGAGGAGGAAGAGG - Intergenic