ID: 1146765788

View in Genome Browser
Species Human (GRCh38)
Location 17:35520309-35520331
Sequence AACCATGGACTGCTTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 7, 2: 24, 3: 60, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146765788 Original CRISPR AACCATGGACTGCTTCTGGC TGG Intronic
900229769 1:1550767-1550789 GACCATGGACTGGTGCCGGCCGG + Intronic
900422158 1:2560337-2560359 AGCCCTGGCCTGCATCTGGCCGG + Intronic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
902997461 1:20237923-20237945 GACCATGCACTGGCTCTGGCCGG + Intergenic
903242444 1:21992482-21992504 GACCACGGACTGGTTCTGTCTGG - Intronic
903245953 1:22015667-22015689 GAGCATGGACTGGTTCTGTCTGG - Intergenic
904479999 1:30787668-30787690 ACCCATGGCCTGCCTGTGGCAGG + Intergenic
904849366 1:33445912-33445934 AGCCATGGACTGCTCCTCTCTGG - Intergenic
904945452 1:34195849-34195871 GACCATGGAATGCTTCCAGCAGG - Intronic
904996825 1:34637884-34637906 GACCATGGGCTGGTTCTGGCCGG - Intergenic
905453501 1:38072106-38072128 AACCAAGGAATGCTTGTGGAAGG - Intergenic
906590960 1:47023814-47023836 AGCCATGGAATTCTCCTGGCTGG + Exonic
907659831 1:56381761-56381783 ACATATGCACTGCTTCTGGCAGG + Intergenic
909297537 1:73969864-73969886 GGCCATGGACTGGTTCTGGCCGG - Intergenic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
915592541 1:156878903-156878925 AACCATGGGCTGTCTCTGGTGGG + Intronic
916148524 1:161763220-161763242 GGCCATGGACTGGTTCTGGCTGG - Intergenic
917923957 1:179773627-179773649 AACCTTGGACTGCTTACAGCGGG - Intronic
918356483 1:183709964-183709986 AGCCATGTACTCCTTCTTGCTGG - Intronic
920452061 1:206066932-206066954 AACCACTGACTGGCTCTGGCTGG - Intronic
921055822 1:211541711-211541733 GACCATGGGTTGCTTCTGGTGGG - Intergenic
922911907 1:229225409-229225431 AGCCATGAGCTGCTGCTGGCCGG - Intergenic
922978729 1:229806650-229806672 GACCGTGGGCTGGTTCTGGCTGG - Intergenic
923133822 1:231099994-231100016 GACCATGGACCAGTTCTGGCTGG - Intergenic
1063278933 10:4603063-4603085 CACCATGGACTGATTCTGGGCGG + Intergenic
1063298808 10:4833360-4833382 CACCAAGGACTTCTTATGGCAGG - Exonic
1064694101 10:17948593-17948615 GGCCATGGACTGGTTCTAGCCGG + Intergenic
1065766753 10:29037516-29037538 ACCCATGGACTGGTTCTGTCTGG - Intergenic
1065801514 10:29356973-29356995 ATCCAAAGACTGCTTCAGGCAGG - Intergenic
1066696758 10:38085826-38085848 CACCATAAACTGGTTCTGGCTGG - Intergenic
1066995800 10:42561899-42561921 CACCATGAACTGGTTCTGGCTGG + Intergenic
1072973980 10:100041799-100041821 ATCCAGAGACTGGTTCTGGCTGG - Intergenic
1075948681 10:126459056-126459078 AATCGTGAACTGCTTCTTGCTGG + Exonic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1076299270 10:129412473-129412495 AACCATGAACTCAGTCTGGCTGG - Intergenic
1076638317 10:131897793-131897815 GACCTTGGACTGGTTCTGGCCGG + Intergenic
1078074932 11:8149913-8149935 AACCACAGAATGGTTCTGGCTGG + Intronic
1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG + Intergenic
1082934484 11:58642168-58642190 GACTATGGACTGGTTCTGGTCGG - Intronic
1083919335 11:65773343-65773365 CATCATGGACTGGTTCTGGCTGG - Intergenic
1084877444 11:72143529-72143551 AACCATGGACCAGTTCTGGCTGG + Intergenic
1084877851 11:72146807-72146829 AACCATGGGCTGGTTCTGGCTGG + Intergenic
1084882602 11:72182309-72182331 AACCATGGACCAGTTCTGGCTGG + Intergenic
1086001342 11:81989028-81989050 TACCATGCACTAGTTCTGGCTGG - Intergenic
1088809837 11:113384784-113384806 AACCCTGGACAGGTTCTGGCAGG - Intergenic
1089945002 11:122461707-122461729 AAACATGGACTGCTGCTGCTGGG + Intergenic
1094351455 12:29530438-29530460 GACTGTGGACTGCTTCTAGCTGG + Intronic
1095426027 12:42075485-42075507 GACCATGGGCTGGTTCTGGATGG + Intergenic
1095436934 12:42199608-42199630 GACCATAGACTGTTTCTGGATGG - Intronic
1098114062 12:67155874-67155896 GACCATGGACTGGTTCTGGCTGG - Intergenic
1098546965 12:71722040-71722062 GACCATGGGCTGTTTCTGGCCGG + Intergenic
1098851797 12:75604665-75604687 AAGCATGGACTGCCTCTGCTTGG + Intergenic
1099702749 12:86108588-86108610 CACCATGGATTGGTTCTGGCCGG + Intronic
1100861312 12:98810202-98810224 AACCATGGACTAGTTCTGGTTGG + Intronic
1101913250 12:108876837-108876859 GACTATGGACTGCTTCTGGTGGG + Intronic
1103029837 12:117603981-117604003 AACCATGGAGTGGTTCTGCCTGG + Intronic
1103980431 12:124733597-124733619 AGCCAAAGACAGCTTCTGGCCGG - Intergenic
1104241707 12:126996306-126996328 GACCATGGACTGGTTCTGGCTGG - Intergenic
1106770429 13:32956209-32956231 AACTATGAACTGCATCTGGATGG - Intergenic
1107653434 13:42568041-42568063 AACCATGGACTACTTCTGGCTGG + Intronic
1109647324 13:65275475-65275497 AACCATGGACTACTTCTGGCTGG - Intergenic
1111208129 13:85039484-85039506 AACCACGGACTGGTCCTGGCTGG - Intergenic
1111484348 13:88876689-88876711 GACCATGGAGTGGTTCTGGCAGG - Intergenic
1111554509 13:89862688-89862710 AACCAAGGACTGGCTTTGGCTGG - Intergenic
1111884868 13:94007485-94007507 GACCATGGACAGCATCTGGATGG + Intronic
1113508959 13:110836695-110836717 GACCATGGCCTGGTTCTGGCTGG - Intergenic
1113965691 13:114152312-114152334 AACCATGGTCTGCTACTTGCTGG - Intergenic
1116435381 14:44890048-44890070 GACCGTAGACTGGTTCTGGCTGG + Intergenic
1116924461 14:50619961-50619983 AAACATGAACTGGTTATGGCTGG + Intronic
1117625946 14:57638263-57638285 GACCACAGACTGGTTCTGGCTGG + Intronic
1117769420 14:59118090-59118112 AGCCATGGACTGGCTCTGGCAGG + Intergenic
1119104566 14:71912072-71912094 GGTCATGGACTGGTTCTGGCAGG - Intergenic
1120732206 14:88016428-88016450 AACCATGGACTGGTTCTGGCTGG + Intergenic
1121396024 14:93624086-93624108 AATCAGGCACTGCTTCTGTCTGG - Intronic
1122385092 14:101339400-101339422 CTCCAGGGACTGGTTCTGGCTGG - Intergenic
1202890765 14_KI270722v1_random:155021-155043 AAACCTGGCTTGCTTCTGGCAGG - Intergenic
1123899875 15:24865439-24865461 AAACATGGACTGGGTCTGACTGG - Intronic
1124510275 15:30318422-30318444 AATCATGGACTGGTTCTGGCTGG - Intergenic
1124732614 15:32212131-32212153 AATCATGGACTGGTTCTGGCTGG + Intergenic
1126497368 15:49306991-49307013 TACCATATACTGCTTCTGGAGGG - Intronic
1126945936 15:53820046-53820068 AATGATGGATTGCTTCTGGGCGG + Intergenic
1127365103 15:58282208-58282230 AGCCATAGGCTGCATCTGGCTGG + Intronic
1128220545 15:65965269-65965291 AACCATGGACTACTTCCTGGAGG - Intronic
1129187287 15:73916805-73916827 CACCATTGAGTGCTTCTGTCCGG - Intergenic
1132423796 15:101696865-101696887 CACCATGCACTGGTTCTGGTTGG + Intronic
1132870720 16:2114642-2114664 AACCCTGGACTGCGGCTGCCTGG - Exonic
1133032059 16:3015824-3015846 CACCTTGCACTGCATCTGGCCGG + Exonic
1133872940 16:9706444-9706466 GACCATGGACTCATTCTGGCTGG + Intergenic
1137380986 16:47999530-47999552 GACCATGGACTGGTTCTGGTCGG + Intergenic
1138237421 16:55396511-55396533 AGCCATCGACTGCTTTTGGGTGG - Intronic
1138277763 16:55748594-55748616 AGCCATGGACTGGACCTGGCCGG - Intergenic
1138283656 16:55791661-55791683 AGCCATGGACTGGACCTGGCCGG - Intergenic
1138285346 16:55805326-55805348 AGCCATGGACTGGACCTGGCCGG + Intronic
1140353365 16:74283572-74283594 AACTGTGCACTGTTTCTGGCTGG + Intergenic
1143995452 17:11002804-11002826 AACCATGGACGGGTTCTGGCCGG + Intergenic
1144090604 17:11852559-11852581 AACCAGGGGCTGCTCCAGGCTGG - Intronic
1145286449 17:21509686-21509708 AACCATGGATTGTCTTTGGCTGG - Intergenic
1146691367 17:34878365-34878387 AAACATGCACTGCTCCAGGCTGG - Intergenic
1146765788 17:35520309-35520331 AACCATGGACTGCTTCTGGCTGG + Intronic
1147176160 17:38657469-38657491 ATCCAGGAAGTGCTTCTGGCTGG - Intergenic
1148146097 17:45366079-45366101 AACCAAGGTCTGCTGCTGGTGGG + Intergenic
1149881645 17:60297975-60297997 GACCATGGACTGGTTCTGGCTGG + Intronic
1152792645 17:82290225-82290247 GACCATAGACGGGTTCTGGCTGG - Intergenic
1154333033 18:13445188-13445210 AAATGTGGAGTGCTTCTGGCCGG + Intronic
1156813486 18:41280542-41280564 GACCATGGACTGCTTTTGGCAGG - Intergenic
1157793305 18:50552442-50552464 GACCATAGACTGGTTCTGGCTGG + Intergenic
1159502265 18:69288783-69288805 GACCATGGACTATCTCTGGCTGG - Intergenic
1160189725 18:76705678-76705700 AATCACAGACTGGTTCTGGCTGG - Intergenic
1162857210 19:13477997-13478019 AATCAGGGACTGCTTCTTGGAGG - Intronic
1164442341 19:28288901-28288923 GACCATGGACTAGTTCTGGCTGG - Intergenic
1165133653 19:33649732-33649754 CACCATGGCCTGGTTCTGGCCGG - Intronic
1165286782 19:34849396-34849418 AACCATGGGCTGGTTCTGGCTGG - Intergenic
1167718699 19:51162272-51162294 GAGCATGGACTGGTTATGGCAGG - Intergenic
1167857248 19:52252644-52252666 AACCATGGACTGCTTCTGGTGGG - Intergenic
1202666186 1_KI270708v1_random:121858-121880 AAACCTGGCTTGCTTCTGGCAGG - Intergenic
925451882 2:3976057-3976079 AACCAGGGACTGCCTCAGGCTGG + Intergenic
925495828 2:4448076-4448098 CACCATCGACTGGTTCTGGCCGG + Intergenic
925711849 2:6748716-6748738 AACCATGGGCTAGTTCTGGCTGG + Intergenic
928536798 2:32249005-32249027 AACCACAGACTGGTTCTGGCTGG + Intronic
929419705 2:41778121-41778143 CACCATGGCCTGTTTCTGGGTGG - Intergenic
932056813 2:68453967-68453989 AACCATGGACTGGTTCTGGCCGG + Intergenic
932181105 2:69646920-69646942 AACCACAGACTGGTTCTGGCTGG + Intronic
933035703 2:77394821-77394843 AACCCTGGCCTGGTTCTGGCTGG - Intronic
935619203 2:105113890-105113912 GGCCATGGACTGGTTCTGGCTGG + Intergenic
935676766 2:105601073-105601095 GGCCATGGACTGGTTCTGGCTGG - Intergenic
935947196 2:108297236-108297258 AAGCATGGAGGGCTACTGGCAGG + Intronic
941186631 2:162327066-162327088 AACCATGGCCTCCTTCTGTGGGG + Intronic
944417723 2:199495630-199495652 AACCATAGACTGGTTCTGGCTGG + Intergenic
945964271 2:216169375-216169397 AACCACGGACTGGTTCTAGTGGG - Intronic
945968366 2:216212151-216212173 GACCATGGACTGGTTCTAGTGGG - Intergenic
946799002 2:223389617-223389639 AACTGTGGACTGTTTCTGGCCGG + Intergenic
946990884 2:225328273-225328295 GACCATGGACTGGCTCTGACTGG - Intergenic
948846629 2:240685994-240686016 CAGCAGGGACTGGTTCTGGCTGG - Intergenic
949029633 2:241786797-241786819 AACCATGGAGGGATTCTGGGTGG - Intronic
1169406989 20:5330025-5330047 GACTACGGACTGGTTCTGGCCGG - Intergenic
1169799901 20:9504117-9504139 AGCCATGGACTGATTCTGGCCGG + Intergenic
1170803293 20:19608100-19608122 AACCAGGGAAGGCTTCTTGCAGG - Intronic
1171384066 20:24755563-24755585 AACTGTGGACTGGTTCTGGATGG - Intergenic
1172310518 20:33914625-33914647 GACCATGGGTTGCTTCTGACTGG + Intergenic
1172613749 20:36269774-36269796 AACCATGTACTGTTTCTCACAGG - Intronic
1172969762 20:38864929-38864951 TAGCATGGCCTCCTTCTGGCTGG + Intronic
1173760817 20:45558862-45558884 ATCCATGCACTTCTTCTGACAGG + Exonic
1174416153 20:50368588-50368610 AGCCATGGAAGGCTTATGGCAGG - Intergenic
1176177403 20:63735246-63735268 AACCCTGGTCTGCTTCTGCAGGG - Exonic
1178694109 21:34778527-34778549 AACCCTGGATTGCTTGTGTCTGG - Intergenic
1179934588 21:44593963-44593985 AACCATGGACTGGCTCCAGCCGG + Intronic
1180873310 22:19160436-19160458 CACCCTAGACTGGTTCTGGCTGG + Intergenic
1181396954 22:22629615-22629637 CACCATGAACAGCTTGTGGCGGG - Intergenic
1181499700 22:23308974-23308996 CACCATGAACAGCTTGTGGCGGG - Intronic
1181643516 22:24217597-24217619 GACCATGAACTGGCTCTGGCTGG + Intergenic
1182004606 22:26949401-26949423 AACCACGGACAGCTCCTGGGTGG - Intergenic
1182909339 22:33968051-33968073 AATCATTGGCTGCTTCTGGTTGG + Intergenic
1184982953 22:48107144-48107166 AACCATGGACAGCCTCAGGTGGG - Intergenic
949552193 3:5120763-5120785 ATCCATGCATTGGTTCTGGCTGG + Intergenic
950199029 3:11029607-11029629 CACCAGGGACTGCTTCTTGGAGG + Intronic
950719514 3:14872745-14872767 CACCATGGACTGGCTCTGGCTGG - Intronic
952676417 3:36036519-36036541 GACCATGGACTAGTTCTGTCTGG + Intergenic
953308532 3:41853753-41853775 GACCATGGACTGGTTCTGGCCGG + Intronic
953359430 3:42281802-42281824 GACCATGGACTGGTTCTGGCTGG + Intergenic
953745980 3:45574411-45574433 GACCATGGGCTAGTTCTGGCTGG + Intronic
954073321 3:48158911-48158933 AAGCTTGGGCTGCTGCTGGCTGG + Exonic
954587924 3:51752937-51752959 AACCATGGATGGCTTCTGAGTGG - Intergenic
954808827 3:53235623-53235645 AACCAAGCTCTGCTTCTGCCCGG + Intronic
955126081 3:56114300-56114322 GACCATGGACTTCCTCTGGCTGG - Intronic
956701147 3:71959925-71959947 GATCATGGACTGGTTCTGGCTGG + Intergenic
957089694 3:75717510-75717532 AAACCTGGCTTGCTTCTGGCAGG + Intronic
958758798 3:98282221-98282243 GACCACGGACTGGTTCTGGCTGG + Intergenic
959071862 3:101709345-101709367 AACCATGGACTGATTCTGGCAGG + Intergenic
959781550 3:110240257-110240279 GACCACTGACTGGTTCTGGCTGG - Intergenic
959869204 3:111307205-111307227 GACCATGGATTGGTTCTAGCTGG + Intronic
960043653 3:113175516-113175538 ATCCAGGGACTCCATCTGGCTGG + Intergenic
960055195 3:113272209-113272231 AAACAAGGACTGCTTCTGCAGGG - Intronic
961111180 3:124284473-124284495 AAGCATGGATGGCTTCTGGGTGG - Intronic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
961370154 3:126423861-126423883 AGCCATGGGCTGCTTCAGGGTGG - Intronic
961580126 3:127874195-127874217 AGCCCTGGACTGCTTCTGGCAGG - Intergenic
961907246 3:130275791-130275813 AGCCATGGACTGGTTCTTGCTGG - Intergenic
962177018 3:133165965-133165987 AACCATGGACTGATTCTGGCTGG - Intronic
964392175 3:156209209-156209231 AGCCAGGGAATGCTTCTGGAAGG + Intronic
964749098 3:160038423-160038445 ACCCCTGACCTGCTTCTGGCAGG + Intergenic
965097652 3:164254632-164254654 GACCATGGACAGGTTCTGGTTGG + Intergenic
965557336 3:170032049-170032071 GACCATGGACTGGTTCTAGTTGG - Intergenic
967445807 3:189565102-189565124 GACCATGGACTGGCTCTGGTTGG + Intergenic
967693637 3:192506121-192506143 GACCATGCACTGGCTCTGGCTGG - Intronic
968919059 4:3513249-3513271 CAGCATGAACTGCTCCTGGCTGG - Intronic
969702455 4:8775001-8775023 AACCACGGGCTGCCTCTGGCCGG + Intergenic
971336634 4:25729210-25729232 AACCATGCACTGGTTCTGGCTGG + Intergenic
971793285 4:31196422-31196444 AACCAAGGCCTCCTTCTGACAGG + Intergenic
972051004 4:34733302-34733324 AACCATGGAATGCTAATGACAGG - Intergenic
972922403 4:43960152-43960174 AACCATGGGCTAGTTCTGGCTGG - Intergenic
973553098 4:52054676-52054698 GACCATAGGCTGGTTCTGGCCGG - Intronic
974351269 4:60750068-60750090 AACAACGGACTCATTCTGGCAGG - Intergenic
975974094 4:80075146-80075168 GACCATAGACTGGTTCTGGCTGG - Intronic
976440986 4:85074266-85074288 AGCCATGGACTGGTACTGGTTGG - Intergenic
976814973 4:89137879-89137901 TCCCAGGGACTGCTCCTGGCCGG + Intergenic
976976230 4:91168491-91168513 AAGCAGGGAGTGCTTCTGCCTGG + Intronic
977817321 4:101429930-101429952 AACGATGAACTGGTTCTGGCTGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978737473 4:112100320-112100342 GACCATGGACTGGTTCTGGGCGG - Intergenic
979543542 4:121914332-121914354 AACCTTGGATTTCTTCTGACAGG + Intronic
983079867 4:163371977-163371999 GACCATGGATTGGTTCTGGCTGG + Intergenic
986316781 5:6594516-6594538 GACCATGAACTGGTCCTGGCTGG + Intergenic
987425313 5:17766357-17766379 AACCGAGGGTTGCTTCTGGCCGG + Intergenic
989265590 5:39470078-39470100 CACCATGGACTTCCTCTGTCTGG - Intergenic
992747883 5:79836891-79836913 AAACATGGACTGGTCCCGGCTGG - Intergenic
992895135 5:81239226-81239248 AAGCTAGGACTGATTCTGGCTGG - Intronic
993563619 5:89444497-89444519 AACCATGGTATGACTCTGGCAGG + Intergenic
996926253 5:128830000-128830022 AAACATGGACTGCTTTTGATAGG + Intronic
999874375 5:155786327-155786349 AACCTGGGACTGTTTCTGCCTGG - Intergenic
1002834482 6:854461-854483 AACCAGTGACTGCCCCTGGCAGG - Intergenic
1003798026 6:9628337-9628359 AACCATGGACTGGTTTTGGTTGG - Intronic
1003983045 6:11407592-11407614 GACCAAGGACTGCATCTGTCTGG - Intergenic
1004282384 6:14292116-14292138 ACCCATGGACTGCTTCATGTGGG + Intergenic
1005077867 6:21926232-21926254 AAACATGAACTGCTGCTGTCTGG - Intergenic
1005614448 6:27559217-27559239 TACCTTGGAATGCTTTTGGCTGG + Intergenic
1005981812 6:30842428-30842450 GACCATGGACTGGTTCTGGCTGG + Intergenic
1006798600 6:36745672-36745694 AAGCATGCACTGCTTCAGGATGG - Intronic
1007101384 6:39249679-39249701 AACCATGGACTGGTTCTGCCTGG - Intergenic
1008312256 6:49990376-49990398 AGCCAGGGACTGCTTATGGCAGG + Intergenic
1008570662 6:52813521-52813543 AACCTTGAATGGCTTCTGGCTGG + Intergenic
1011188584 6:84706266-84706288 AGCCAAGGACAGCATCTGGCTGG - Intronic
1011725513 6:90206447-90206469 AACTCTGAAATGCTTCTGGCAGG + Intronic
1012105134 6:95147904-95147926 GACTATGGACTGATTCTGGCTGG - Intergenic
1013584211 6:111564450-111564472 AAAAATGCACTGCTGCTGGCTGG - Intronic
1014157973 6:118134196-118134218 AAAGATGAACTGCTTCTGGTGGG + Intronic
1015309595 6:131751728-131751750 GACCACGGACTGGTTCTGACTGG + Intergenic
1018916332 6:168134779-168134801 TTGCAGGGACTGCTTCTGGCAGG - Intergenic
1018943963 6:168332371-168332393 CTCCATGGGCTGCTTGTGGCTGG + Intergenic
1019019554 6:168906616-168906638 GACCATGGACTGGTTCTGGCTGG - Intergenic
1019225785 6:170506907-170506929 GACCGTGGACTGCTTCTGGCCGG - Intergenic
1019842936 7:3466533-3466555 AGCCTTGCACTGCTTCTGGCAGG + Intronic
1020042346 7:5013576-5013598 AACCATGATCTGCTTGAGGCAGG - Intronic
1021703684 7:23345745-23345767 AAGCATTATCTGCTTCTGGCAGG - Intronic
1023935531 7:44737328-44737350 AACCATGGGCTGCTGGTGTCTGG + Intergenic
1024148671 7:46544117-46544139 GACCATGGCCTAATTCTGGCTGG + Intergenic
1024788158 7:52931919-52931941 AACCAGGGTCTGCTTTTGGGAGG - Intergenic
1024790798 7:52963089-52963111 GACCATGGACTGGTTCTGGATGG - Intergenic
1026140271 7:67699654-67699676 AATCGTGGACTGTTTCAGGCAGG + Intergenic
1026271681 7:68842300-68842322 TACAATGGACTAATTCTGGCCGG + Intergenic
1026315736 7:69225639-69225661 AACTATGGACTGGTTCTGGCCGG - Intergenic
1026858447 7:73769855-73769877 CACCTTGCACTGCATCTGGCCGG + Exonic
1026867243 7:73831377-73831399 CACCTTGCACTGCATCTGGCCGG - Exonic
1027400487 7:77800631-77800653 AACCATGAACTTTTTTTGGCTGG + Intronic
1028384870 7:90243894-90243916 CACTATGGACTGGTTCTGGCAGG - Intergenic
1029439857 7:100581601-100581623 TTCCATGGTCAGCTTCTGGCAGG - Intronic
1032804017 7:135338369-135338391 GACCATGGACTGGTTCTGGCCGG + Intergenic
1036705617 8:11044138-11044160 GACCGTGGACTGGTTCTGGCTGG + Intronic
1037556837 8:20033364-20033386 GAGCATGGTCTGCTTCTGGGAGG + Intergenic
1038113957 8:24531755-24531777 AACCATGGGCTGGTTCAAGCAGG - Intergenic
1038231079 8:25700848-25700870 GACCATGAACTGGTTCTGACTGG + Intergenic
1038801735 8:30755401-30755423 TACCATGGACTGCACCTGGCTGG + Intronic
1039362085 8:36887566-36887588 AACCATGGATTGGTTCTGGCCGG - Intronic
1040865073 8:52040657-52040679 GACCTTGGACTCCTGCTGGCAGG - Intergenic
1041720285 8:60969131-60969153 GACTATAGACTGGTTCTGGCTGG - Intergenic
1042659279 8:71135678-71135700 CACCATGGAGTGCTTCAGGTGGG + Intergenic
1045764047 8:105646248-105646270 AACCACAGAGTGGTTCTGGCCGG - Intronic
1048321881 8:133406448-133406470 AACCAAGGACTGGATCTGGGGGG - Intergenic
1048387535 8:133926522-133926544 GACTATGGACTGATTCTGGCTGG - Intergenic
1049263418 8:141652176-141652198 ACCCATGGCCTCTTTCTGGCAGG + Intergenic
1051022033 9:12556268-12556290 GACAATGGACTGATTCTGGCTGG - Intergenic
1051574525 9:18599686-18599708 ATCCATAGGCTGCATCTGGCTGG - Intronic
1052721050 9:32171455-32171477 GACCATGGACTGGTCCCGGCTGG - Intergenic
1053097632 9:35342220-35342242 AACCAAGGAGTGCTCCTGGATGG + Intronic
1056867061 9:90237351-90237373 GACCATGGACTGGCCCTGGCTGG + Intergenic
1057000071 9:91500514-91500536 AACCATAGACTGGCTCTGGTCGG - Intergenic
1057097786 9:92327642-92327664 AACCATGGACTTGTTCTAACAGG - Intronic
1057469048 9:95341512-95341534 AGCCATGGCTTGGTTCTGGCCGG + Intergenic
1057822396 9:98342606-98342628 GACCATGGTCTGCATCTGGCTGG + Intronic
1060053165 9:120391425-120391447 AACCATGGACTGAGTTGGGCAGG - Intronic
1060054159 9:120399580-120399602 TCCCATGTCCTGCTTCTGGCTGG - Intronic
1060587368 9:124795016-124795038 CACCATGGACTGCAGCTGCCCGG - Exonic
1061625174 9:131837205-131837227 AATCATGGACTGCTTCCCGGAGG + Intergenic
1062714852 9:138004009-138004031 AACCATCCTCTGCTGCTGGCGGG + Intronic
1185471234 X:385039-385061 CACCACGGACTGGTTCTGGCCGG + Intronic
1187807495 X:23136903-23136925 TTCTATGGACTGCTTTTGGCAGG - Intergenic
1188641241 X:32508217-32508239 TACCATTGACTGCTTCTTTCTGG - Intronic
1189785537 X:44555826-44555848 TACCATGCAGTGGTTCTGGCCGG + Intergenic
1190410232 X:50129813-50129835 AGCCATAGACTGGTTCTGGCTGG - Intergenic
1194970622 X:100339096-100339118 AACTTTGGAGTGGTTCTGGCAGG + Intronic
1196110391 X:111940896-111940918 AACTATGGACTGGTCCTGGTGGG + Intronic
1196358150 X:114819651-114819673 GACTATGAACTGGTTCTGGCTGG - Intronic
1196911883 X:120492222-120492244 CACCATGGACTGGTTCTGGCCGG + Intergenic
1197618178 X:128717747-128717769 GACCATGGACTGGTTCTGGCTGG - Intergenic
1198307703 X:135399262-135399284 GACCATGGACTGGCTCTGGCTGG - Intergenic
1199153190 X:144514279-144514301 GACCATTGAATGGTTCTGGCTGG + Intergenic
1199785458 X:151101213-151101235 AAGCAGGGACTTTTTCTGGCTGG + Intergenic
1200518541 Y:4179984-4180006 ACCCATGCACTTCTTTTGGCAGG - Intergenic