ID: 1146765917

View in Genome Browser
Species Human (GRCh38)
Location 17:35521562-35521584
Sequence CATCAAAACCCAATTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146765911_1146765917 17 Left 1146765911 17:35521522-35521544 CCCAGCTAGCTAAAGCCAGATTG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1146765917 17:35521562-35521584 CATCAAAACCCAATTGAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 145
1146765915_1146765917 2 Left 1146765915 17:35521537-35521559 CCAGATTGCAGAGATAGGCAGGC 0: 1
1: 0
2: 0
3: 17
4: 104
Right 1146765917 17:35521562-35521584 CATCAAAACCCAATTGAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 145
1146765912_1146765917 16 Left 1146765912 17:35521523-35521545 CCAGCTAGCTAAAGCCAGATTGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1146765917 17:35521562-35521584 CATCAAAACCCAATTGAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146765917 Original CRISPR CATCAAAACCCAATTGAGCC TGG Intronic
900273168 1:1804862-1804884 CATCAAAACCACATTAGGCCGGG + Intronic
904515153 1:31048907-31048929 CATCAAAAACCTTTTGAGGCCGG + Intronic
905208851 1:36359414-36359436 CAACAAAACCCAAGAGATCCTGG + Intronic
905404200 1:37722337-37722359 CATCAAACCCCATGTGACCCAGG + Intronic
906683328 1:47745927-47745949 CATCATCACCCAACTGAACCCGG + Intergenic
907740816 1:57163863-57163885 CATCAAAAGCCAAGAGAACCTGG + Intronic
908748887 1:67400925-67400947 CATAAAAACCCAAGAGGGCCAGG + Intergenic
910872316 1:91846164-91846186 TTCCAAAACGCAATTGAGCCGGG + Intronic
913612971 1:120526270-120526292 TATGAAAACCCAAATTAGCCTGG - Intergenic
913989284 1:143595441-143595463 CATCAGCACCCCGTTGAGCCTGG + Intergenic
914363020 1:146952393-146952415 CTTCAAAACATAATTGAGCGAGG + Intronic
914578216 1:148995978-148996000 TATGAAAACCCAAATTAGCCTGG + Intronic
916258459 1:162815122-162815144 CCTCAAAACCCAACAGTGCCTGG - Intergenic
916370056 1:164081958-164081980 AATCACAACCCAATTCAGGCAGG + Intergenic
917102656 1:171461489-171461511 CATCAAAAAACAGATGAGCCTGG + Intergenic
917903020 1:179562101-179562123 AATTAAAATCCAATTGAGGCTGG - Intronic
918569679 1:185974857-185974879 CAACAAAACTCAATTAAGACAGG - Intronic
920410593 1:205757108-205757130 AATCAAAACCACAATGAGCCGGG - Intergenic
922019750 1:221691752-221691774 CATAAAAATCCAAATGTGCCGGG + Intergenic
923780081 1:237014647-237014669 CATCAGAAGTCAATTGAGCTGGG + Intergenic
1063730093 10:8686801-8686823 CATCAAAAGTTATTTGAGCCAGG - Intergenic
1066701753 10:38137131-38137153 AATCAAAACCCAAGGAAGCCTGG - Intergenic
1068219348 10:54024610-54024632 CATCAAAACACAACTGCCCCTGG + Intronic
1073223297 10:101894491-101894513 AATCACAACCCAGGTGAGCCTGG - Intronic
1075494550 10:122908638-122908660 CACCAAAACCCAAATGGGCATGG - Intergenic
1076712330 10:132344864-132344886 TACCAAAATCCACTTGAGCCAGG - Intronic
1078525231 11:12095751-12095773 ATTCAATACCCAATAGAGCCAGG - Intronic
1078865606 11:15294564-15294586 CAGCAAAGCCCAATAAAGCCTGG - Intergenic
1079909771 11:26295287-26295309 CATCAAAAATCATTTGAGTCAGG + Intergenic
1080119734 11:28663576-28663598 CATCAGAACTCCTTTGAGCCAGG - Intergenic
1080496397 11:32824786-32824808 CTTCAAAACTCAGTTAAGCCTGG + Intergenic
1081802506 11:45869706-45869728 CATCATGACCCAACTGAGGCAGG + Exonic
1083951342 11:65958238-65958260 TATAAAAACCCAATTTGGCCAGG - Intronic
1084919735 11:72459325-72459347 CGTCTAAACCCAATTCAGCAGGG - Intergenic
1085352521 11:75808779-75808801 CAATAATACCCACTTGAGCCAGG + Intergenic
1086582191 11:88411956-88411978 CATCAAAACCCACTTTTGGCCGG - Intergenic
1091974965 12:4817085-4817107 AGTCAAAACCCATGTGAGCCAGG - Intronic
1092175390 12:6401539-6401561 AAAAAAAACCCAAATGAGCCAGG - Intergenic
1092615232 12:10210937-10210959 CATCAAAACTAAAATGAGGCCGG - Intergenic
1093439341 12:19175577-19175599 CATCAAAACCCAATAAAACCTGG - Intronic
1093874739 12:24336837-24336859 AATAAAAACCTAATTGAGCCGGG + Intergenic
1097034249 12:56112247-56112269 CATCAAATCCATTTTGAGCCAGG - Intronic
1102909136 12:116699314-116699336 TGTCAAAACCCAATAGAGGCCGG + Intergenic
1103829771 12:123769471-123769493 TATCAAAACCCACTTTAGGCCGG - Intronic
1104043714 12:125146800-125146822 TATCAAAACCCGAAAGAGCCAGG + Intergenic
1105055150 12:133091778-133091800 CATCAAAACCCAGTTAAATCTGG - Intronic
1107205483 13:37780671-37780693 TATCAAATCCCATTAGAGCCTGG - Intronic
1109069271 13:57743085-57743107 CAACAAAACTCAAATTAGCCTGG + Intergenic
1110870634 13:80448920-80448942 CAACAAAACCCAAGCAAGCCTGG + Intergenic
1111154705 13:84307735-84307757 TATAAAAATCCAATTGAGGCTGG + Intergenic
1111307447 13:86434007-86434029 CATCTAAAACCACTTCAGCCTGG - Intergenic
1111963830 13:94840432-94840454 CACCAAAATACAATTGAGGCAGG - Intergenic
1115225704 14:31099464-31099486 CTTAAAAAACCATTTGAGCCAGG + Intergenic
1116856222 14:49954843-49954865 CATCTAAGCCCATTTGAGCCAGG - Intergenic
1118081621 14:62367812-62367834 CTGCAAAACCCAATTAAGCATGG + Intergenic
1124032361 15:26023100-26023122 AAACAAAACCCAAATTAGCCGGG - Intergenic
1126230954 15:46323774-46323796 CATCAAAACACAAATGAGGCTGG + Intergenic
1127488326 15:59439028-59439050 AATCAAAACCCAATCGTGGCAGG + Intronic
1135375773 16:21946019-21946041 AATTAAAACAAAATTGAGCCGGG + Intergenic
1137246672 16:46711494-46711516 AATAAAAACCCAAATGAGGCTGG - Intronic
1139445112 16:66992979-66993001 TATCAAAACCGAATTGGGCTGGG - Intronic
1139662200 16:68428865-68428887 CAGCAGAACCCAACTGGGCCTGG - Intronic
1144763743 17:17722027-17722049 CAGCAAAACCCAAGTGTGACAGG + Intronic
1146765917 17:35521562-35521584 CATCAAAACCCAATTGAGCCTGG + Intronic
1148079369 17:44959515-44959537 CACCACAACCCAAGTGGGCCTGG - Intergenic
1150808865 17:68340579-68340601 CATCAAAAAACAATTAGGCCTGG - Intronic
1151913945 17:77103817-77103839 CCTCATAACCCCATGGAGCCGGG - Intronic
1153413558 18:4820941-4820963 CCTCAGAACCCAAGAGAGCCAGG + Intergenic
1153668581 18:7388658-7388680 CATCAAAACTAATTTGAGCTTGG + Intergenic
1159987684 18:74863214-74863236 AAAAAAAACCCAAGTGAGCCGGG - Intronic
1160405399 18:78642738-78642760 CATCATAAAGCAATTGAGCAAGG + Intergenic
1161858346 19:6778744-6778766 AAACAAAACCCAATTTTGCCTGG + Intronic
925305142 2:2842839-2842861 GATCCAAGCCCCATTGAGCCCGG + Intergenic
929007582 2:37410927-37410949 CTTAAAAACCCAATGGAGGCTGG + Intergenic
929029873 2:37640324-37640346 CATTAGAACCCAAGAGAGCCAGG - Intergenic
932758935 2:74426951-74426973 AAACAAAACCCCAGTGAGCCAGG - Intronic
933745581 2:85568631-85568653 CTTCAAAGCCCAAGTGAGACCGG - Intronic
935233634 2:101119987-101120009 CAAAATAACCCAAGTGAGCCAGG + Intronic
935473331 2:103486099-103486121 CATTAAAACTCAATTCACCCTGG - Intergenic
935702679 2:105825916-105825938 CATCAAGATCTAATGGAGCCAGG - Intronic
938941037 2:136169868-136169890 CCTCACAACCCATTTGAGGCAGG - Intergenic
939057200 2:137380114-137380136 CAACAAAACACATTTGGGCCAGG + Intronic
943856014 2:192792189-192792211 CAACAGAACCCAGTTGAGCATGG - Intergenic
945432180 2:209777262-209777284 CAGCAACACCCAATTTATCCTGG - Exonic
1168989942 20:2086476-2086498 CATCAAAGCACAATTTAGCCAGG + Intergenic
1169004762 20:2197210-2197232 CATCAAAACCCACATGAGGTTGG - Intergenic
1169103637 20:2974680-2974702 AATCAAAACCAAAATGAGGCCGG - Intronic
1171450939 20:25235932-25235954 CATTAAAACTCCATGGAGCCAGG - Intergenic
1174511395 20:51055900-51055922 CATAAAAACTCAGTTGAGGCCGG - Intergenic
1174665881 20:52257279-52257301 AATCAAAACCCCATTGAGGCCGG + Intergenic
1175044237 20:56089222-56089244 CATCAAAACCCCATTTAAACAGG - Intergenic
1180681669 22:17631391-17631413 TGTCAAAACCCAATTGAGGCTGG - Intronic
1184200448 22:42965046-42965068 CATCAAAACCCAACTGTGTGTGG + Intronic
1184980028 22:48089467-48089489 CCTCAAAACCCACGTCAGCCTGG - Intergenic
949698964 3:6733692-6733714 CATCATAACCCATTGCAGCCTGG - Intergenic
952209900 3:31219874-31219896 CAACAAATACAAATTGAGCCAGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
954159148 3:48707732-48707754 CATTAAAACCAGAATGAGCCTGG - Intronic
959363945 3:105432605-105432627 CATTAAAACCCATATGAGGCAGG - Intronic
960721475 3:120628374-120628396 CAGCAGAACCTAATTGAGACTGG - Exonic
960985659 3:123278969-123278991 CAAAAAAACCCATGTGAGCCGGG + Intergenic
962932584 3:140051685-140051707 CCTCAAAACACTATTGAGGCTGG + Intronic
963031052 3:140976723-140976745 CAACAAAACCCAACTGTGTCTGG - Intronic
963922600 3:150920293-150920315 CATCAGAACCCACCTGAGCCAGG + Intronic
964130142 3:153277539-153277561 CACCAAAACCAAAATGAGCAGGG - Intergenic
966792209 3:183683541-183683563 CACCAGAAACCATTTGAGCCAGG + Exonic
971158502 4:24108739-24108761 CATGAACACCCAGTGGAGCCTGG + Intergenic
972789403 4:42356754-42356776 AATTAAAACCAAATTGAGGCTGG + Intergenic
974945529 4:68523508-68523530 CATAAACACCTAATTGAGCCTGG - Intergenic
974955446 4:68634969-68634991 CATAAACACCTAACTGAGCCTGG - Intronic
976136450 4:81942538-81942560 AATCAAAACCTAAATGAGGCCGG + Intronic
978260921 4:106757595-106757617 CATCAAAAACCAATTGTGAGGGG + Intergenic
979499537 4:121423585-121423607 CATCAAAACCAAAGATAGCCTGG - Intergenic
980621677 4:135314947-135314969 CTTTAAAACATAATTGAGCCAGG - Intergenic
982131864 4:152236312-152236334 CATCAAAGACCACTGGAGCCAGG + Intergenic
982985476 4:162200913-162200935 CATAAAAACCCAAACGAGGCCGG - Intergenic
984770821 4:183435005-183435027 TATCAAGTCCCAAATGAGCCTGG + Intergenic
986075445 5:4332044-4332066 CTTCAAAGACAAATTGAGCCTGG - Intergenic
989111011 5:37906739-37906761 CTTCTAGACCCAATTCAGCCAGG + Intergenic
989282238 5:39658160-39658182 CATCAAAAACCAAATAAACCAGG + Intergenic
989754097 5:44931532-44931554 CAACAAATCCCACTTGAGCATGG + Intergenic
991227995 5:64295235-64295257 CCTCAAAAAACAATTCAGCCTGG + Intronic
994873837 5:105389527-105389549 CATGAGAACTCAATAGAGCCTGG + Intergenic
998489757 5:142536392-142536414 CATAAAAACCCAAGTAAGACTGG + Intergenic
1003637868 6:7850301-7850323 CATGAAAACCAAAATTAGCCAGG - Intronic
1006063640 6:31444583-31444605 CATCAAAACCCAAAAGGGCAGGG + Intergenic
1009963397 6:70552262-70552284 AATCCAAATACAATTGAGCCTGG + Intronic
1012520624 6:100116921-100116943 TACCAAAACCAAATTGATCCAGG + Intergenic
1013120000 6:107132565-107132587 CATCAAATCACAACTGAGTCTGG + Intergenic
1015897616 6:138032630-138032652 CCTCAAAATCCAATTTAGCTTGG + Intergenic
1022042296 7:26592469-26592491 CAGCAAAAGCCAAATAAGCCAGG - Intergenic
1023447786 7:40250080-40250102 CTTTAAAAGCCAATTAAGCCGGG - Intronic
1026738419 7:72963572-72963594 CATCAAAACCCAAATCTGGCCGG + Intronic
1027105315 7:75401498-75401520 CATCAAAACCCAAATCTGGCCGG - Intronic
1032980488 7:137276482-137276504 CCTCAAAACCCATTTCACCCTGG - Intronic
1034623527 7:152474827-152474849 CATCAAAACCCAACAAAACCAGG - Intergenic
1035518969 8:261122-261144 CAGGAAAATCCAATGGAGCCAGG - Intergenic
1038850215 8:31268393-31268415 CATCAAAACCCAAAAGGGCAGGG - Intergenic
1040464706 8:47683829-47683851 AATAAAAACCCAATTTGGCCGGG + Intronic
1040478592 8:47803081-47803103 CATGAAAAGCCATTTCAGCCTGG - Intronic
1043789494 8:84446637-84446659 AATCAATACTCAACTGAGCCAGG - Intronic
1044657824 8:94566675-94566697 AATCAAAACCACAATGAGCCTGG + Intergenic
1044817726 8:96130414-96130436 CATCAAAACCAAATATACCCAGG + Intergenic
1045531712 8:102991241-102991263 CATCAAATCCAATTTGATCCTGG + Intergenic
1048983897 8:139720084-139720106 GATCTAAACCCAAATGAGACTGG + Intergenic
1050402210 9:5268234-5268256 TATAAAAGCCCAGTTGAGCCAGG + Intergenic
1051414520 9:16824930-16824952 CAACTAAACCCAGTTTAGCCTGG - Intronic
1052640941 9:31165359-31165381 CATCAAAACCAGATTGGGCAGGG + Intergenic
1055896756 9:81186249-81186271 AATAAAAACCAAATTTAGCCAGG - Intergenic
1056561663 9:87735206-87735228 CATCAAAACCTAACTGAACTGGG + Intergenic
1057150786 9:92794197-92794219 CATCAAAAGCAAATTCAGGCCGG - Intergenic
1061800640 9:133111888-133111910 CATGAAAACCCGATTAAGCCTGG + Intronic
1187373271 X:18727950-18727972 CATAAAAACCCAAGAGAACCGGG - Intronic
1189010705 X:37043493-37043515 CATCAACACCCACATCAGCCTGG - Intergenic
1189035698 X:37492062-37492084 CATCAACACCCACATCAGCCTGG + Intronic
1195967589 X:110442814-110442836 CAGCAATAGCCACTTGAGCCAGG + Intronic
1196816584 X:119669891-119669913 CAACAGAGCCCAATTGAGCCTGG + Intronic