ID: 1146767304

View in Genome Browser
Species Human (GRCh38)
Location 17:35535008-35535030
Sequence GATAATGTATGTAAAGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 1, 1: 3, 2: 23, 3: 150, 4: 742}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146767304_1146767305 26 Left 1146767304 17:35535008-35535030 CCAAAAACTTTACATACATTATC 0: 1
1: 3
2: 23
3: 150
4: 742
Right 1146767305 17:35535057-35535079 TTATCTTTATTTTACCAATGAGG 0: 2
1: 3
2: 90
3: 510
4: 2580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146767304 Original CRISPR GATAATGTATGTAAAGTTTT TGG (reversed) Intronic
901129155 1:6951424-6951446 GATAATGGATGGAAAGTCTCTGG + Intronic
901408794 1:9068262-9068284 GATAATGCATGTAAAGTACCTGG - Intronic
901905868 1:12410002-12410024 GAGAATGCAAGTAAAGCTTTTGG + Intronic
901932623 1:12605808-12605830 GATACTTTATGAAAAGTTTATGG + Intronic
902306166 1:15541112-15541134 TATAATGTATATAAAGCTCTAGG + Intronic
902806216 1:18862855-18862877 GATAATGTATATAAAATGCTTGG - Intronic
902892953 1:19457979-19458001 GATAATGTGGGAAAAGTCTTAGG + Intronic
902947513 1:19852537-19852559 GATAAAGTTTGTAAAGTTTCTGG - Intergenic
903538094 1:24080679-24080701 GATAATTTATGAAAAGTGTTTGG + Intronic
903546335 1:24125799-24125821 AATAATATATGTAAAGCATTTGG + Intronic
903623396 1:24714449-24714471 GATAAGGTATGTGAAGTTCTGGG + Intergenic
903964797 1:27080572-27080594 GCTAATATATTTAAAGATTTAGG - Intergenic
904034932 1:27553574-27553596 GATAATCTATATAAAGTGCTTGG - Intronic
904244786 1:29180064-29180086 GATAATAAATGTAAAGCATTTGG - Intronic
904553219 1:31338911-31338933 AATGATGTATTTAAAGTTTTTGG + Intronic
904923627 1:34028733-34028755 GATAATGTATGTAAAGTGCCTGG + Intronic
905002588 1:34684793-34684815 GATAATGTAGGTAAAGTGCTTGG + Intergenic
905134245 1:35786246-35786268 AATAATGTAAGTTAAGATTTGGG + Intergenic
905154101 1:35958932-35958954 GATAATGTCAGTAGACTTTTGGG + Intronic
905433038 1:37938350-37938372 GATAATGTGTGAAAAGTTCTTGG + Intronic
905809790 1:40903732-40903754 GGTAATGGATGCAGAGTTTTGGG + Intergenic
906187579 1:43872542-43872564 GATAAGGCATGTGAAGTTCTTGG - Intronic
906806533 1:48784174-48784196 GATAATCTATGTAAAATGCTTGG + Intronic
907120226 1:52001889-52001911 GATAATGTATGTAAAATAGGTGG + Intergenic
907595031 1:55711906-55711928 CATAATATATGTAAAGTCTCTGG + Intergenic
907684016 1:56592142-56592164 GATAATATATGCAAAGTGCTTGG - Intronic
907696246 1:56732117-56732139 GATAAATTCAGTAAAGTTTTAGG + Intronic
907710037 1:56871691-56871713 GATAAGGAATGTAAAGTGTTTGG + Intronic
907994594 1:59616802-59616824 GATAATACATGAAAAGTTCTTGG - Intronic
908343014 1:63202239-63202261 ATTAATGTATGTAAAGTGTATGG + Intergenic
908572485 1:65423939-65423961 GATAATCTATGTAAAGTGCTTGG - Intronic
908593986 1:65666224-65666246 GATAATGTATTCAAAGTACTGGG - Intergenic
908759838 1:67501433-67501455 GATAATGTATGTAAATCTCCAGG - Intergenic
908792767 1:67799158-67799180 GAAAATGTATGTATAACTTTTGG - Intronic
908953266 1:69588300-69588322 GATAATGTATGTTAAGAGCTAGG - Intronic
909048670 1:70741868-70741890 GATAATTTTAGTAAAGTTTCAGG - Intergenic
909152962 1:72031917-72031939 CAAAATGCATGTAAAGTATTTGG - Intronic
909190950 1:72550433-72550455 TAAAATGTATATGAAGTTTTTGG - Intergenic
909349138 1:74629052-74629074 GCTAATATATGTTCAGTTTTGGG - Intronic
909355142 1:74699864-74699886 GAAAATGTTTGAAAAGTGTTGGG + Intergenic
909717970 1:78733108-78733130 AAAAATGTATGTATATTTTTAGG - Intergenic
910056648 1:83040855-83040877 GATAATGTATGCAAAATGTCTGG + Intergenic
910116110 1:83733894-83733916 CATAATGTATGTAAAGTACCTGG + Intergenic
910264730 1:85326410-85326432 GATAATAAATGTAAAATGTTTGG - Intronic
910659429 1:89655533-89655555 CATAATGAATATAAAATTTTGGG + Intronic
911119770 1:94284312-94284334 AATAAGGTATGTAAAGTGTTTGG - Intergenic
911296878 1:96128463-96128485 TAAAATGTATTTTAAGTTTTGGG + Intergenic
911474136 1:98355663-98355685 GAGAATGTAGCTAAAGTTTAAGG + Intergenic
911909035 1:103608466-103608488 GACAAGCTATTTAAAGTTTTTGG + Intergenic
911913884 1:103670995-103671017 GACAAGCTATTTAAAGTTTTTGG - Intronic
912392362 1:109312646-109312668 AATATAGTATGGAAAGTTTTTGG - Exonic
912434501 1:109651238-109651260 GATAAGGACAGTAAAGTTTTTGG - Intergenic
912478698 1:109961004-109961026 GAAAATGTATGCAAAGAGTTTGG - Intergenic
912659908 1:111518304-111518326 GATAATGTATGCAAAGTGTCTGG - Intronic
912857836 1:113187276-113187298 GAAAATGTATGTAAGGCATTTGG + Intergenic
912944915 1:114076812-114076834 GATAATGTATGTAAAGAATTTGG + Intergenic
913122013 1:115751118-115751140 AATAATGCATGTAAAGTGCTTGG + Intronic
913174235 1:116259320-116259342 CATTATGTATGTAAAGAGTTTGG - Intergenic
913417842 1:118631627-118631649 AATAAATTCTGTAAAGTTTTAGG - Intergenic
914407970 1:147395788-147395810 GGTATTGTATTTAAAATTTTTGG + Intergenic
914715329 1:150249550-150249572 GATAATGTATATTGGGTTTTTGG - Intergenic
915389916 1:155533256-155533278 GATAATATATGTAAAACATTTGG - Intronic
915512628 1:156394664-156394686 GATAATGTATGTAAAGTGTTTGG - Intergenic
915892768 1:159786711-159786733 GATAACGTCTGTAAAGCATTTGG - Intergenic
915937930 1:160099611-160099633 GGTAATGTACATAAAGTGTTTGG + Intergenic
916333728 1:163646368-163646390 GTTAATTTATGTAAAGTGTAAGG + Intergenic
916995972 1:170301690-170301712 GATAATGTAAGCAAAGCATTTGG - Intergenic
917084183 1:171289532-171289554 GATAATCCATGTAAAGCATTAGG + Intergenic
917266175 1:173223230-173223252 GATAATGCATGTAAAGTACCTGG + Intergenic
917831885 1:178899266-178899288 GGTAATGTATGCAAAATGTTTGG + Intronic
918001076 1:180496832-180496854 GATAAAATATGTGAAGTGTTTGG - Intronic
919017054 1:192052065-192052087 AAAAATGTATGTAAAATTCTTGG + Intergenic
919120794 1:193337919-193337941 GATAATTTATATATAGATTTGGG + Intergenic
919148290 1:193662761-193662783 AATAATGCATGTAAAGTACTTGG - Intergenic
919230847 1:194771992-194772014 GATATCATATGTCAAGTTTTAGG - Intergenic
919263723 1:195234592-195234614 GATAATGTATGTATATTTCTTGG + Intergenic
919333512 1:196203025-196203047 GATAATGCATGTAAAGTGTTTGG - Intergenic
919426510 1:197439057-197439079 GATAAGGTATATATACTTTTGGG - Intronic
919702267 1:200642936-200642958 GATCATGTATGTACAGTGGTGGG + Intronic
920515574 1:206582520-206582542 GATAATGTATGCCAAGTACTTGG + Intronic
920600043 1:207315342-207315364 AATAATGTATGTAAAGCATTTGG - Intergenic
920843709 1:209576170-209576192 GATAATGTATGTGAATTGCTTGG - Intergenic
921406690 1:214788117-214788139 GATCATATATGTATATTTTTTGG + Intergenic
921426557 1:215008601-215008623 GATAATTAATGTCAACTTTTTGG + Intronic
921483557 1:215690708-215690730 GAAAATGAATCCAAAGTTTTTGG - Intronic
921559304 1:216638212-216638234 GATAATATATGTAATATTCTTGG - Intronic
921656235 1:217741448-217741470 GATAATATATGTAATCTTATTGG + Intronic
921932686 1:220768117-220768139 GATAATGCATGTAAAGGGTTTGG - Intronic
922512545 1:226181631-226181653 AATAATGTACATACAGTTTTTGG + Intronic
922547856 1:226471958-226471980 GGTAATATATGTAAAGTTGTTGG + Intergenic
922849071 1:228716516-228716538 TATAATGTGTGTAAAATGTTAGG - Intergenic
923022189 1:230173805-230173827 TATAATGTATGTAAATGTATGGG + Intronic
923059705 1:230459900-230459922 GATAATGTTTGTAAATTGCTTGG + Intergenic
923162495 1:231327782-231327804 GATAATGTGTGTAAAGCGTCTGG + Intergenic
923264752 1:232303766-232303788 GATAATGCAGATAAAGTTCTTGG + Intergenic
923965167 1:239129623-239129645 GATAATATATGCAAAATTATTGG - Intergenic
924151815 1:241137500-241137522 GATAATGAATATAAAATTTGGGG - Intronic
924612666 1:245586956-245586978 GATAATGCATGAGAAGTTCTCGG - Intronic
1063714277 10:8512383-8512405 GATTATGTATGTAAAGCATCTGG + Intergenic
1063875193 10:10468802-10468824 GATGCTTTATGTAAAGTTTATGG - Intergenic
1064630639 10:17307142-17307164 GATATTACATGTAAAGTATTGGG + Intergenic
1064768863 10:18702989-18703011 GATAATATATGTAAAGGGCTTGG + Intergenic
1065488098 10:26254294-26254316 GATAATCTAACTAATGTTTTGGG - Intronic
1065669113 10:28094474-28094496 AATAATTCATGTAAAGCTTTCGG + Intronic
1065901055 10:30208301-30208323 GATAATATGTGTAAAGTGATTGG - Intergenic
1065979209 10:30874983-30875005 AATAAAGGATGTAAAGTTGTAGG + Intronic
1065988460 10:30981556-30981578 GATAATGTAAGTAAAGTGCCTGG + Intronic
1066510801 10:36093441-36093463 GTCAATGTATGCAAAGTCTTTGG - Intergenic
1067618310 10:47771488-47771510 AACAATGTAAGTAAAGTATTTGG - Intergenic
1067912866 10:50364670-50364692 TAACATGTATGTAAAGTTTATGG - Intronic
1068154036 10:53172557-53172579 TATTAAGTATGTAAAGTGTTTGG + Intergenic
1068419770 10:56775926-56775948 GATAATTTATATAAAGTTATGGG - Intergenic
1068499936 10:57832315-57832337 GATAATGTGTGTAAAGCATTTGG - Intergenic
1068548613 10:58381112-58381134 GATAATGTATGTAAAATACTTGG + Intergenic
1068615075 10:59105319-59105341 AATAATGTATGTAAAGCATTTGG + Intergenic
1068615408 10:59109301-59109323 AATAATGTATGTAAAGTGCCTGG - Intergenic
1068840986 10:61613873-61613895 GATAATACATGTAAAGTGTTTGG + Intergenic
1068938233 10:62656779-62656801 GAAAATGTTTGTAAATTCTTTGG + Intronic
1069377809 10:67811832-67811854 GATCATGGATGTAAAGTGCTCGG + Intronic
1069377838 10:67812156-67812178 GATCATGGATGTAAAGTGCTTGG - Intronic
1069773331 10:70912949-70912971 GCTAATGTATGGAAAGTGCTCGG + Intergenic
1069991009 10:72316122-72316144 GATCATGTATGTAAAGTGGTTGG - Intergenic
1070033914 10:72703208-72703230 GATAATCTATGTAAAATTCTTGG - Intronic
1070259046 10:74835713-74835735 GATAATCTATGTAAAGTACCTGG + Intronic
1070285455 10:75080253-75080275 GATAATGCATATAAAGCTCTTGG + Intergenic
1070562846 10:77580876-77580898 AATAATGCATATAAAGTATTGGG - Intronic
1070909418 10:80104496-80104518 GATAATATTTGTAAAATATTTGG - Intergenic
1070939426 10:80330126-80330148 GAGAATGGATGCAAAGGTTTGGG - Intergenic
1071391514 10:85179937-85179959 AATAATGCATGTAAAGTTCTTGG + Intergenic
1071543007 10:86504878-86504900 GCTAAAGTATATAAAGGTTTTGG - Intronic
1071575754 10:86724801-86724823 GATAATGTAAGTGAAGTATTTGG - Intronic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1071818830 10:89260125-89260147 GATAATGAATGTTAAGTATTAGG - Intronic
1072120885 10:92404846-92404868 GATGATGTATGGAAAGTGCTTGG + Intergenic
1072333405 10:94375299-94375321 GATAATGTATGCAAAGTACCTGG + Intergenic
1072631261 10:97148203-97148225 GAAAATGCACATAAAGTTTTTGG + Intronic
1072990943 10:100193055-100193077 GACAATGTATATAAAGTGCTTGG - Intronic
1073341957 10:102751875-102751897 CATAATATATGTAAAGCTCTTGG + Intronic
1073479417 10:103777163-103777185 GATAATGTAGGTAAAGTGCTTGG + Intronic
1073937798 10:108655068-108655090 GTTAATATATGTAAAGAATTTGG + Intergenic
1074146202 10:110719543-110719565 GTATATGTATGTATAGTTTTAGG + Intronic
1074303926 10:112258497-112258519 GATAATGCATGGAAAGTGTTTGG + Intergenic
1074931321 10:118129115-118129137 GATAATATATGTAAAGTGTTTGG + Intergenic
1075448530 10:122530717-122530739 GATAATGTATGTAAAGGGCCTGG - Intergenic
1076400998 10:130185239-130185261 TAAAATGTATGTAAAGACTTAGG + Intergenic
1077765151 11:5150923-5150945 GAAAATGTATTTAAATTTTTAGG + Intergenic
1077852836 11:6091435-6091457 GATAACGTCAGCAAAGTTTTAGG - Intergenic
1078647050 11:13150348-13150370 GATAATGTATGAAAAGTACCGGG + Intergenic
1078911189 11:15733806-15733828 GATAGTGTATACAAAGTATTTGG + Intergenic
1079355172 11:19724642-19724664 GATAATGTATGTAAAGTGTCTGG - Intronic
1079383874 11:19961724-19961746 GATGGTGTTTGTAAAGTGTTTGG + Intronic
1079396214 11:20066104-20066126 AATAATGAATGTAAAGTGCTTGG + Intronic
1079487865 11:20954172-20954194 GATAATGTATGTAATTTTATGGG + Intronic
1079556486 11:21764094-21764116 GAAAATGTAAGTAAAGTTTTGGG + Intergenic
1079616217 11:22496651-22496673 GATAATGCATGAAATGTGTTAGG + Intergenic
1079679580 11:23277981-23278003 GATAATGTATATAAAGTGCTTGG + Intergenic
1079690997 11:23416789-23416811 AATAATGTATGAGAAGTTTTTGG + Intergenic
1080039409 11:27743693-27743715 GATAATGTATGCCAAATGTTCGG + Intergenic
1080133269 11:28821462-28821484 GACAATGTATATAAAGTTCTTGG - Intergenic
1080274153 11:30485074-30485096 GATCATGTATGTTAAGTTCCTGG - Intronic
1080359011 11:31491306-31491328 GATAATGTATGTATTCTTTAAGG - Intronic
1080694348 11:34588354-34588376 GATGATGTATGTAAAGTACCTGG + Intergenic
1081320031 11:41680632-41680654 GATATAGTATCTAAAGATTTTGG + Intergenic
1081601610 11:44499189-44499211 GATGATGTATGTAAAGGATCTGG + Intergenic
1081908262 11:46682876-46682898 GCTAATGTATGTGAAGTGCTTGG - Intronic
1082640748 11:55657581-55657603 CATACTATATGTAGAGTTTTAGG + Intergenic
1082660727 11:55907710-55907732 ATTAATGTATTTACAGTTTTTGG + Intergenic
1082680362 11:56160731-56160753 GATAATGAAGGTTAAGATTTGGG + Intergenic
1082796103 11:57379041-57379063 GATAATACATGAAAAGTGTTTGG - Intronic
1082805993 11:57450918-57450940 GATAATGTATATAAAGCTTCTGG + Intergenic
1083231302 11:61322102-61322124 GATAATGTATATAAAGTGCCTGG + Intronic
1085132417 11:74052321-74052343 GATAATATATGTAAAGTACTTGG - Intronic
1085320298 11:75569995-75570017 GAGAATGTGTGTTAAGTTTCTGG - Intronic
1086094122 11:83033520-83033542 GATAAATTATGTAAAGCTCTTGG - Intronic
1086663190 11:89447480-89447502 GAAAATCTATGTAAAGTGCTTGG - Intronic
1086724266 11:90163263-90163285 TATAATGTATTCAAAGTTGTAGG + Intronic
1087230966 11:95663056-95663078 AATAAATTATGTAAAGTTATAGG - Intergenic
1087834054 11:102852564-102852586 CATAATATATGTAACGTGTTGGG - Intergenic
1087905307 11:103688957-103688979 GTTAATGCATGTAAAGTGCTTGG + Intergenic
1088126817 11:106436504-106436526 AATAATATATTTAAAGTGTTCGG - Intergenic
1088525116 11:110744543-110744565 GATCATGTATGTAAAGTGCCTGG - Intergenic
1089307690 11:117536930-117536952 GATAATGTACGTAAAGTCATTGG - Intronic
1089449061 11:118578675-118578697 GAAACTGTATGTAAAATTTTGGG + Intronic
1089748548 11:120634136-120634158 GATAATATATGTAAAGTGCTTGG + Intronic
1089755848 11:120686107-120686129 GATAATGTATGTAAACTATGTGG + Intronic
1090202662 11:124867293-124867315 CATAATGTATGTAAAGCCCTTGG - Intronic
1090235893 11:125146873-125146895 GATCATGTCTGCAAAGTTCTTGG + Intergenic
1090413391 11:126524252-126524274 GATAATCTATGTAAAGTGCCTGG + Intronic
1090421091 11:126575429-126575451 GATAATGTATGTACAATACTGGG + Intronic
1090603226 11:128394261-128394283 GATAATATAGGGAAATTTTTAGG - Intergenic
1090618400 11:128538654-128538676 GGTAATGTATGTAAAATATATGG + Intronic
1090803073 11:130186537-130186559 CAGATTGTATGTAAAGATTTGGG + Intronic
1090816064 11:130296998-130297020 GCTAATGTGTTTAAAGATTTTGG - Intronic
1091682542 12:2537396-2537418 GTTAATGTATGTAAAATTCATGG + Intronic
1091809852 12:3387647-3387669 GATAATGCATGTAAAGTTCTTGG - Intronic
1092236481 12:6813875-6813897 GATGATGCCTGTAAAGTATTTGG + Intronic
1093035414 12:14328017-14328039 GAGAAAGTATGTAATATTTTTGG + Intergenic
1093146449 12:15572337-15572359 TATACTGTTTGTATAGTTTTAGG - Intronic
1093385962 12:18553919-18553941 GATAAAGTAGGAAAAGTCTTTGG - Intronic
1093500243 12:19803639-19803661 GAAAATGTAGGTGAAGTGTTGGG - Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094135533 12:27121366-27121388 GATAATTTATGTAAATGTGTAGG + Intergenic
1094175842 12:27540314-27540336 GATAATGAATGCAAAGAGTTTGG + Intronic
1094185021 12:27632762-27632784 GATAATTTATGTAAATGTGTAGG + Intronic
1094296298 12:28910316-28910338 GATACTTTATGGAAAGTTTATGG + Intergenic
1094343821 12:29443850-29443872 TATAATGTATGTAAAATATTTGG - Intronic
1095598249 12:43983713-43983735 GATAACATATGTAAAGTTCTTGG - Intronic
1095617776 12:44213163-44213185 GATATAGGATGTAAAGTCTTTGG - Intronic
1095800261 12:46265101-46265123 GATAATGAATGTGAAGTATTTGG - Intronic
1095891499 12:47239007-47239029 CATAATTTAGGTAAAGTTATGGG - Intergenic
1096217591 12:49806878-49806900 GATAATATATGTAGAGTGTCTGG + Intronic
1096284764 12:50289483-50289505 GAAAATGTATGTAAAATATTTGG + Intergenic
1096411716 12:51381746-51381768 GATAATGTAGGTAAAATGTTTGG + Intronic
1097430822 12:59504192-59504214 GATGATGTTGGTAAAATTTTAGG + Intergenic
1097440944 12:59607744-59607766 GATAAGGTATGAAAAGCTCTGGG - Intronic
1097586789 12:61524997-61525019 GATGGTATATGTAAAGTTTCTGG + Intergenic
1097614612 12:61868967-61868989 GATAATGTATGTGAAATTCCTGG + Intronic
1098269843 12:68759285-68759307 GGTAATGAATGTAAAAGTTTTGG - Intronic
1098700569 12:73619888-73619910 GTTAATATATGTAAAGTATTTGG - Intergenic
1098761633 12:74432535-74432557 GATAATGTCTGTTAACTTGTTGG + Intergenic
1098768925 12:74527455-74527477 GATAATGTAAGTAAAATCTCAGG - Intergenic
1098957227 12:76699956-76699978 GATAATGTATGTAAAAAATCTGG + Intergenic
1099313334 12:81054853-81054875 GATAATGCATATAAAGTGCTTGG - Intronic
1099389417 12:82060886-82060908 GATAATGTTTGTAGAGCATTTGG + Intergenic
1099397796 12:82162717-82162739 CATAATGAATGAAAACTTTTGGG + Intergenic
1099441053 12:82700263-82700285 GATAAGTTATGTAAAGTACTTGG + Intronic
1099618330 12:84968179-84968201 GTTAATGTATGTCAAGTTCAGGG - Intergenic
1100332339 12:93596209-93596231 AATAATGTATGTAAAGTGCATGG - Intergenic
1100512905 12:95294911-95294933 GATACTTTATTTAAACTTTTAGG + Intronic
1100519409 12:95358877-95358899 GATAATGTATTTAAAGTGCCTGG - Intergenic
1100790139 12:98121112-98121134 GATAATGTATATAAAGCACTTGG + Intergenic
1101118002 12:101550785-101550807 GTTAATGCATGTAAAGCGTTTGG + Intergenic
1101229106 12:102721716-102721738 GATAATATTGGTAAAGTGTTTGG - Intergenic
1101269488 12:103128658-103128680 GATAATGTATATAAAGTGCTAGG + Intergenic
1101331219 12:103759309-103759331 GATAATGCATGCAAAGTTCCTGG + Intronic
1101437294 12:104674929-104674951 GCTAATGTATGTAAAGTGTCGGG + Intronic
1101626522 12:106448403-106448425 AATAACGTATGTAAAGAATTTGG - Intronic
1101643342 12:106604806-106604828 AATTATGTAAGTAGAGTTTTAGG + Intronic
1101680395 12:106958276-106958298 GAAAATTTATGTACTGTTTTTGG + Intronic
1102486207 12:113259275-113259297 GATAAAGAATCTAATGTTTTGGG - Intronic
1102838700 12:116094431-116094453 AATAATGCATGTAATGTATTTGG - Intronic
1102934815 12:116887522-116887544 GAGAATGTCTGTCAAGTGTTTGG + Intergenic
1105533968 13:21246716-21246738 GATAATATATTTAAAGTTGATGG - Intergenic
1105989231 13:25601897-25601919 GATAATTTATATAAAGTGCTAGG - Intronic
1106569133 13:30911175-30911197 AATAATGTGTGTAAAGCTCTTGG - Intronic
1106721473 13:32439564-32439586 GAAATTGTATGTAAAATTTTGGG - Intronic
1106873445 13:34046396-34046418 AATAATGTATAAAAAGTTTCAGG - Intergenic
1106957055 13:34951376-34951398 GTTAATATATGTAAAGTGCTTGG + Intronic
1106965032 13:35053812-35053834 GATAATGTATGAAAACTATGAGG - Intronic
1107282413 13:38751645-38751667 TATAATGTATGTATAGTATTTGG + Intronic
1108720111 13:53122779-53122801 GATAATGTCTGTAAAGTGCTTGG + Intergenic
1109220026 13:59632043-59632065 GATACTGTTTGCAAGGTTTTGGG - Intergenic
1109371810 13:61431545-61431567 GATAAAGTATGAAAAGAGTTCGG - Intergenic
1109486632 13:63030710-63030732 GATAATGTAAGTAAAGTGTTTGG + Intergenic
1110734965 13:78925826-78925848 GATAATGTATGCAAAGTGCCTGG - Intergenic
1111073097 13:83195742-83195764 AATAAAGTATATAATGTTTTTGG + Intergenic
1111207175 13:85026656-85026678 GATATTGTATGGAAAGCCTTTGG + Intergenic
1111235933 13:85407542-85407564 GATAACATATGTACATTTTTTGG + Intergenic
1111832697 13:93349898-93349920 TATAATTTATGTCAAGTATTGGG + Intronic
1112084723 13:96018195-96018217 TATTATGTCTATAAAGTTTTGGG - Intronic
1112143017 13:96667369-96667391 TATAATGCATGTCAAGTTATAGG + Intronic
1112244401 13:97717502-97717524 TCTAATGTTTGTATAGTTTTAGG - Intergenic
1112355748 13:98673678-98673700 GACAATCTATGTAAAGTGCTTGG - Intergenic
1112464981 13:99635876-99635898 GATAATATATATAAAGTGCTTGG + Intronic
1112493635 13:99888361-99888383 AATAATGTATGTAAAGTGCCAGG + Intronic
1112710853 13:102127292-102127314 GATAATGTGTGTAAAACATTTGG - Intronic
1113193413 13:107777153-107777175 GATACTTTATGTGAAGTTTCGGG - Intronic
1114793149 14:25681661-25681683 GATAATATATGTAAAGTGCCTGG + Intergenic
1115323196 14:32107845-32107867 TATAAAGGATTTAAAGTTTTGGG + Intronic
1115345519 14:32338790-32338812 AGTATTTTATGTAAAGTTTTTGG + Intronic
1115482942 14:33879968-33879990 TTTAATGGATGTAGAGTTTTAGG + Intergenic
1116571114 14:46516537-46516559 GACAAATTCTGTAAAGTTTTAGG + Intergenic
1116614041 14:47111105-47111127 GTTAATGTATGCAAAGCTTTTGG - Intronic
1116651476 14:47598718-47598740 GATAATTTCTGAAAAGATTTGGG + Intronic
1116654404 14:47633018-47633040 GATAATGCTTGTAAAGTGGTTGG + Intronic
1116716580 14:48434218-48434240 GATAATGAATTTGAAGTTTTAGG - Intergenic
1117058633 14:51938345-51938367 GATTATGCATGTAATGTTTTAGG + Intronic
1117589218 14:57249128-57249150 GATAAAGTATGTAAAATACTAGG - Intronic
1118782516 14:69018275-69018297 AATAATGTATGTAAAGCAGTTGG - Intergenic
1119583312 14:75807533-75807555 GATAATGCATATAAAGTCCTTGG - Intronic
1119765408 14:77184494-77184516 GATAATGGGTGTAAAGTGCTGGG + Intronic
1120128406 14:80775133-80775155 GAGGATGTATGTAAAGTGCTTGG - Intronic
1120128617 14:80778101-80778123 GATAAAATATGTAATGTGTTTGG - Intronic
1120378499 14:83741994-83742016 AATAATACATGTAAAGTATTTGG + Intergenic
1120496399 14:85242476-85242498 GCTATTGAATATAAAGTTTTGGG - Intergenic
1121399599 14:93661721-93661743 GATAATATATGTAAAGCACTTGG - Intronic
1123631495 15:22263191-22263213 AATGATGTTTTTAAAGTTTTTGG + Intergenic
1125266384 15:37886313-37886335 GATAATAAATGAAAAGTATTTGG - Intergenic
1126861817 15:52891835-52891857 GATAATGTAGGTAAAGAATCTGG + Intergenic
1127735706 15:61836829-61836851 GATCATGTGTGTAAAGTGTCTGG - Intergenic
1127749052 15:62014682-62014704 GATAGTTTATGTAAAGCTTTTGG - Intronic
1127837180 15:62799276-62799298 GATAATGTGTGTAGAGTGCTTGG + Intronic
1128379266 15:67099759-67099781 GATAATCTATGTAAGGTATGGGG - Intronic
1128570939 15:68732418-68732440 TTAAATGTATGTAAAGGTTTAGG + Intergenic
1129039738 15:72675761-72675783 CATACTGTATGTAATCTTTTAGG - Exonic
1129430546 15:75498257-75498279 CATACTGTATGTAATCTTTTAGG - Intronic
1130002706 15:80060596-80060618 GATAATTTATATTAAGTTGTTGG + Intronic
1130723434 15:86412864-86412886 GATAATATATGTAAAGTACTTGG - Intronic
1130936598 15:88476148-88476170 GATAATGAATGTAAAGTGTCTGG - Intronic
1130971514 15:88737408-88737430 GATATTTTATGTAAAGCATTAGG - Intergenic
1131016968 15:89065923-89065945 GATAATGTATGTAAAGTGCCAGG - Intergenic
1131039024 15:89244860-89244882 GTTAATGAATGTAAAGTGCTGGG + Intronic
1131175306 15:90205595-90205617 AATAATGTATGTAAAGTGTTTGG + Intronic
1131203294 15:90419305-90419327 AATAATGCATGTAAAGTATTTGG + Intronic
1131943863 15:97597706-97597728 GATAGTGTATATAAAGTGGTTGG - Intergenic
1133463126 16:6004394-6004416 GTTAATATTTGTAAAGATTTAGG + Intergenic
1133551561 16:6860812-6860834 CATCATTTATGTACAGTTTTTGG + Intronic
1137570389 16:49562407-49562429 GATCATGTAGGTAAAGTGCTTGG + Intronic
1137709755 16:50558354-50558376 GAGAATGCATGGAAAGTATTAGG - Intronic
1138988173 16:62357125-62357147 GATAATGTAAGTAAATACTTGGG + Intergenic
1139240305 16:65384830-65384852 GCTAATGTATGGCAAGTTTTGGG - Intergenic
1139345276 16:66298997-66299019 GATAATGTATGTAAATCACTTGG + Intergenic
1139721644 16:68860855-68860877 GATAATGTGTGTCAAGTATCTGG + Intronic
1140103314 16:71937585-71937607 GATCATGTATGCAAAGCTATTGG + Intronic
1140143782 16:72285757-72285779 CATAAAGAATGTAAAGATTTTGG + Intergenic
1140520834 16:75580070-75580092 GATAATGTATGTAAATCATCTGG - Intergenic
1140637849 16:76937698-76937720 GATCATGTTTGTAAACGTTTAGG + Intergenic
1140822060 16:78671662-78671684 GACAGTGTATGTAAAGCATTTGG + Intronic
1140925302 16:79576765-79576787 GATAATGTATGTAAAGCACCTGG - Intergenic
1140988152 16:80179294-80179316 CATAATGTAAGTCAAGATTTTGG - Intergenic
1141066907 16:80921315-80921337 GATAATGTATATGAAGTTCCTGG - Intergenic
1141290028 16:82709600-82709622 GATAATTCATGTCAAGTATTTGG + Intronic
1141768770 16:86075928-86075950 GATAATGTATGTAAAGGGTTTGG - Intergenic
1141769004 16:86077536-86077558 GATAATATATGTAAAGGGCTTGG + Intergenic
1141971507 16:87487269-87487291 AATAACGTTTTTAAAGTTTTTGG - Intronic
1142751842 17:1993585-1993607 GATAATATATGTAAAGTGTCTGG + Intronic
1144953602 17:19006774-19006796 GATATAGTATATAAACTTTTGGG + Intronic
1145353625 17:22114867-22114889 GATCATATATGGAAAGTATTAGG + Intergenic
1145356265 17:22156771-22156793 GATAATGTATGTAAAATGTTTGG - Intergenic
1146433886 17:32824520-32824542 GATACTATGTGTAAAGTATTTGG - Intronic
1146523290 17:33543666-33543688 GGTAATGTACGTAAAGTACTTGG - Intronic
1146648952 17:34594516-34594538 GTTAATGCATGTAAAGTGCTTGG + Intronic
1146767304 17:35535008-35535030 GATAATGTATGTAAAGTTTTTGG - Intronic
1147243184 17:39104171-39104193 GATAGTGTATGTAAAGTGTTGGG - Intronic
1147293183 17:39460388-39460410 GATAATGTATGTAAAATTCTTGG + Intergenic
1147413996 17:40275267-40275289 ATTAATGTGTGTAATGTTTTGGG - Intronic
1147478560 17:40737252-40737274 GATAATGTAGGCAAAAATTTGGG - Intergenic
1147612441 17:41809976-41809998 GAGAATGTCTGTAAAGTGCTTGG + Intronic
1148038888 17:44690393-44690415 GATAATGCATGAAAAGCTTTTGG - Intergenic
1149384380 17:56127159-56127181 GATAATTTATGCAAAGTGCTCGG - Intronic
1150129781 17:62662499-62662521 GATAATACATGTAAAGCATTTGG - Intronic
1150151786 17:62815491-62815513 AATAGTGTATGTAAAGTTTCTGG + Intergenic
1150171932 17:63005729-63005751 TATAATATCTGTAAGGTTTTGGG + Intergenic
1150308006 17:64103008-64103030 GCTAATGGATGTTTAGTTTTAGG - Intronic
1151096789 17:71507909-71507931 GATGATGTATGTGAAAGTTTAGG - Intergenic
1153694817 18:7629555-7629577 GAGCATGTATGAAATGTTTTAGG + Intronic
1154958728 18:21286613-21286635 GATTATATATGTAAAGTGCTGGG - Intronic
1155013114 18:21802813-21802835 GATTGGGTATGTAGAGTTTTGGG + Intronic
1155090083 18:22499807-22499829 AATAATGTATGTAATCTTTAGGG - Intergenic
1155118489 18:22794144-22794166 GATACTGTTTTTAAAATTTTGGG - Intergenic
1155459715 18:26064034-26064056 GATAATGTATTTAATAATTTAGG + Intronic
1155779137 18:29809085-29809107 AATAAAGTATTCAAAGTTTTTGG + Intergenic
1155828201 18:30476339-30476361 TATATTGTAGATAAAGTTTTGGG - Intergenic
1155836793 18:30595247-30595269 GATAATGTATATATACGTTTTGG + Intergenic
1155876243 18:31092383-31092405 TATAATGAATTTTAAGTTTTTGG - Intronic
1156102829 18:33619042-33619064 GGTAATTTATGTAAAGTCCTTGG - Intronic
1156322012 18:36035356-36035378 GATAATGTATGTAAAGTGCTTGG - Intronic
1156498764 18:37543647-37543669 GATAATGACTGTGAAGGTTTTGG - Intronic
1156547821 18:37983042-37983064 AACAATGTATGTAAAGTTAAAGG + Intergenic
1156592425 18:38506229-38506251 GATACTTTATGAAAAGTTTGTGG - Intergenic
1156981670 18:43296616-43296638 GATAATGTGTTTTAAATTTTGGG + Intergenic
1157014337 18:43692511-43692533 GATAATGTATTCAAAGTGTGAGG + Intergenic
1157410932 18:47462357-47462379 GATAATATATGTAAAGATCTTGG + Intergenic
1158159357 18:54462552-54462574 GATAAGGCCTGTAAAGTTCTAGG + Intergenic
1158416506 18:57253628-57253650 AATCATGCATGTGAAGTTTTTGG - Intergenic
1158622616 18:59046214-59046236 GATAATGTATGTAAAGAACTTGG + Intergenic
1159107052 18:64014649-64014671 GATAATGTGTGGAAACTGTTTGG - Intergenic
1159390121 18:67781674-67781696 TATAATGTATTCAAATTTTTAGG - Intergenic
1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG + Intronic
1162280813 19:9696330-9696352 GATACTGAGTGTACAGTTTTTGG - Intronic
1162659655 19:12159193-12159215 GATAAAGTATGAAAAATCTTTGG + Intergenic
1167831632 19:52027839-52027861 GATAATGTTGTTCAAGTTTTCGG - Intronic
1167930967 19:52864424-52864446 GATAATGAATATCAAGTGTTAGG - Intronic
1168429431 19:56266363-56266385 GATAATGTGTGTGAAGTTGTTGG + Intronic
925535023 2:4907299-4907321 AATAATGTATGTAAATTTCTTGG - Intergenic
926030361 2:9581654-9581676 AAGAGTGTAAGTAAAGTTTTGGG - Intergenic
926164938 2:10515926-10515948 GATAATGTCTGATAATTTTTTGG - Intergenic
926263583 2:11292245-11292267 TATAATGTAGTTAAAGTTTTTGG - Intronic
926318713 2:11732558-11732580 GATAATGTCTGCAAAGGGTTTGG + Intronic
926505546 2:13710278-13710300 GATTAAGTATGTAAAGTTTAAGG + Intergenic
926589188 2:14721534-14721556 TATAATGTATGTAAAGTTCCTGG - Intergenic
927330062 2:21852064-21852086 GATAATGTATGGAAAACTTCAGG - Intergenic
927473282 2:23392546-23392568 GATAATATATGTAAAGTACTCGG - Intronic
928192022 2:29179612-29179634 GATAACGTATGTGAAGTGTTAGG + Intronic
928320976 2:30282640-30282662 GACAATTTCTGTAAAGTTCTTGG - Intronic
928422680 2:31151163-31151185 GATAACGTATGTCAAGTGTCTGG + Intronic
928450742 2:31376044-31376066 GATAATGTTAGTGAAGTGTTCGG + Intronic
928846570 2:35680983-35681005 GATAATGTTTCTAAAGTGTAGGG + Intergenic
928901671 2:36324629-36324651 AAAAATGTATGTAAAGTTTTGGG - Intergenic
929131160 2:38573718-38573740 GAAAATGAATGTAAAGTCTGGGG + Intronic
929209910 2:39344711-39344733 GAAAATGAATGGAAAGTTTTAGG + Intronic
929315266 2:40469964-40469986 GATAAAGTAATTATAGTTTTAGG - Intronic
930587782 2:53289726-53289748 GATAATGTATGGGCAGTTTAAGG + Intergenic
930971554 2:57401038-57401060 CATAATATATGTAAAATTTATGG - Intergenic
931593478 2:63912952-63912974 TATAATGTGTATAAAGTATTTGG - Intronic
931661409 2:64567298-64567320 GATAATGCATGTAAAGTAGCAGG + Intronic
931724719 2:65098357-65098379 TATGATGTATGTAAAGAATTTGG - Intronic
932124169 2:69128329-69128351 AATAATATTTGTAAAGTATTTGG + Intronic
932205542 2:69878191-69878213 GATAATGTATTTTATGTTTCAGG + Intronic
932477432 2:72015032-72015054 GCAAATGTATGTAAAGCATTTGG - Intergenic
932560304 2:72862212-72862234 GCTAATGTCTGCAAAGTTTGTGG - Intergenic
932804241 2:74769168-74769190 GAAAATGTATGTAAAGTGTCTGG + Intergenic
932842910 2:75100272-75100294 GATGATGCATGCAAAGTTCTTGG + Intronic
932888783 2:75571978-75572000 GATGATGGATGTAAACATTTAGG + Intergenic
932992293 2:76802262-76802284 AATAAAGTAAGTAAAGTTGTAGG + Intronic
933192012 2:79344926-79344948 GATAGTGTATGTAAAGTACTTGG + Intronic
933822341 2:86124876-86124898 GATAATGTATAGAAAGTACTTGG + Intronic
933859198 2:86447592-86447614 GACAGTGTATGTAAAGTGTCTGG - Intronic
935380929 2:102450300-102450322 GATAATGTATATGAACTTCTTGG - Intronic
936934982 2:117830666-117830688 GCTAATGTGTTTAAAGATTTTGG - Exonic
937176288 2:119939143-119939165 GATAATATATTAAAAGTTGTTGG - Intronic
937604786 2:123786096-123786118 GATAAATTAAGTAAAGTTTTAGG - Intergenic
937813907 2:126230008-126230030 GAGAATGTATGTTGAGTGTTGGG - Intergenic
938414296 2:131091684-131091706 GGTAATGAAGGTAAAGTTTGGGG - Intronic
938822542 2:134974299-134974321 GATAATATATTAAAAGTTTTAGG - Intronic
938873487 2:135507561-135507583 GATAAAGGATGTAATGTTTTAGG + Intronic
938877144 2:135544096-135544118 GATAATGCCTGTAAATGTTTTGG + Intronic
939262809 2:139832183-139832205 CAATATGTATATAAAGTTTTAGG - Intergenic
939348108 2:140994747-140994769 TTTAAAGTATGTAAAATTTTAGG - Intronic
939664964 2:144940558-144940580 GATAATATATGCAAAATTTCTGG - Intergenic
939952610 2:148493226-148493248 GATAATGTAGGAAAATTGTTTGG - Intronic
940136509 2:150442297-150442319 AATAATGTATGTAAAGCACTTGG + Intergenic
940334652 2:152512901-152512923 GATAACGCATGTAAAGTAGTTGG - Intronic
940672415 2:156687145-156687167 AATCATGTATGTAAAGTGTCTGG - Intergenic
940845657 2:158639129-158639151 GATAATGAAGGTAAAGTTCTTGG + Intronic
941329819 2:164166033-164166055 GATCTTGTATTTAAAGTTTTTGG + Intergenic
941445734 2:165596895-165596917 GATAATGTCTATAAAGCTATTGG - Intronic
941637208 2:167947505-167947527 GGTAATGTAGGAAAAGCTTTTGG + Intergenic
942408475 2:175681512-175681534 GATAATGTATGGAAAATGTTTGG - Intergenic
942603389 2:177664570-177664592 GATAATTTAGGTATATTTTTGGG + Intronic
942866397 2:180680712-180680734 GTAAATGTATGTAAAATATTTGG - Intergenic
943251979 2:185534895-185534917 TTTAATGTATTTAAAGTCTTTGG + Intergenic
943725606 2:191248197-191248219 AGTAATGTATGTAAAATTCTTGG - Intronic
943938189 2:193953416-193953438 AAAAATGTATGTAAAATATTTGG + Intergenic
944320132 2:198331060-198331082 GATAATATATGTAAAGCGCTTGG + Intronic
944489944 2:200248180-200248202 GATAATGCATGTAAAGCACTTGG + Intergenic
944706301 2:202292347-202292369 TATAATGTATGTAAACTACTTGG - Intronic
944858978 2:203796690-203796712 GATAATGAATGTGAAGTTCCTGG + Intergenic
944962753 2:204894129-204894151 TATAACATTTGTAAAGTTTTGGG + Intronic
945166638 2:206953811-206953833 GATGATGTATGTAAATGTCTGGG - Intronic
945325777 2:208480634-208480656 TATGATGTATGAAAAGTATTGGG - Intronic
945398122 2:209346666-209346688 ATTAATGTATGTCAAGTTTCTGG - Intergenic
946214243 2:218171554-218171576 GTTAATATATGTAAAGTGGTTGG + Intergenic
946641799 2:221791898-221791920 GATAATGTATGTAACATGTCAGG - Intergenic
948594654 2:239072061-239072083 GATACTTTATGAAAAGTTTATGG - Intronic
948637807 2:239350800-239350822 AATATTGTATTTAAAGTTCTCGG - Intronic
1168982609 20:2020742-2020764 GATAATGCATATAAAGCATTTGG - Intergenic
1169033120 20:2428573-2428595 TATAATGTATATAAAGTATTTGG + Intronic
1169497652 20:6130408-6130430 GATAATGTATGCAAAGAACTAGG - Intergenic
1170109676 20:12791299-12791321 GATAATGTATTGAATGTCTTTGG + Intergenic
1170525610 20:17233283-17233305 GTTAGTGCATGTAAAGTTCTGGG + Intronic
1170527347 20:17252482-17252504 GATAATGCATGAAAAGTGCTTGG - Intronic
1170616937 20:17960912-17960934 GATCACGTATCCAAAGTTTTAGG + Intronic
1171563888 20:26159052-26159074 GATCATATATGGAAAGTATTAGG + Intergenic
1172384000 20:34520257-34520279 GATAATGCATGCTGAGTTTTGGG + Intronic
1172681287 20:36717657-36717679 GAGAATGTATGTAAAGCACTTGG + Intronic
1173155516 20:40605113-40605135 GATAAAGAATGTAAAGTTCATGG - Intergenic
1173679205 20:44864748-44864770 GGAAATCTATGTAAAGTTCTTGG - Intergenic
1173933804 20:46844194-46844216 GATAATGAATGAAAAGTGATTGG + Intergenic
1174491118 20:50896569-50896591 AAAAATGTTTTTAAAGTTTTTGG - Intronic
1174520990 20:51130537-51130559 GATAATTTCTGTAAAGTACTTGG + Intergenic
1175078708 20:56399265-56399287 GAGAATGTATTTAGAATTTTTGG - Exonic
1177079499 21:16620853-16620875 CATACAGTATGTAAACTTTTGGG + Intergenic
1177321840 21:19531966-19531988 GATAATGCAGGTAGAGTTTTAGG - Intergenic
1177356490 21:20014872-20014894 TATACTGTATGGAAAGTTCTAGG + Intergenic
1177420989 21:20856607-20856629 GAAAATGTATTTATAGTTTGCGG + Intergenic
1177714588 21:24822673-24822695 GATTATGTTTGGAAACTTTTTGG + Intergenic
1178379978 21:32099714-32099736 GATAAGCTATGTAAAATGTTCGG + Intergenic
1178779940 21:35593047-35593069 GATAATGTTTGTAAAGTGTTTGG + Intronic
1179240190 21:39583474-39583496 TATAATATATGTAAATTTATAGG + Intronic
1180253061 21:46602461-46602483 GATAACATATGAAATGTTTTAGG - Intronic
1181736717 22:24887352-24887374 GATACAGTGTGTAATGTTTTGGG + Intronic
1181782479 22:25203083-25203105 CATAATGCATGTTAAATTTTAGG - Intronic
1181927670 22:26373157-26373179 GCAAATGTATGTAGAGTTCTTGG + Intronic
1182188438 22:28432841-28432863 TATAAAGTATGTGAAGTTTGTGG + Intronic
1182191354 22:28463988-28464010 GATCATGTATATTAATTTTTTGG - Intronic
1182208729 22:28655288-28655310 GATAATACATGGAAAGATTTAGG - Intronic
1182250773 22:28998303-28998325 AAAAAAGTATGTAAAGTTCTTGG + Intronic
1182463209 22:30496762-30496784 GATAATGTATAGAAAGTGTTTGG + Intronic
1182857687 22:33532482-33532504 GATAATGTATGTGAAATATATGG - Intronic
1183139960 22:35928054-35928076 GATAACATATGTAAATTTCTTGG - Intronic
1183562137 22:38583548-38583570 GATAATTTGTGCAAAGTTCTTGG - Intronic
1183818754 22:40326717-40326739 GAGAATCTATGTAAAGAGTTAGG + Exonic
1184953786 22:47865789-47865811 GATAGTATATGTAAATATTTGGG + Intergenic
949677092 3:6467840-6467862 GATAATGCATGTAAAGTGCTTGG + Intergenic
949939635 3:9144895-9144917 GATAATGCATGTAAAGTGCTTGG + Intronic
950316025 3:12003125-12003147 GATCATGTATGTAAAGCATCTGG - Intergenic
950319678 3:12039422-12039444 GATAATGTATGTAAGGCCTGTGG - Intronic
951493198 3:23296325-23296347 ATTATTGTATGTTAAGTTTTAGG + Intronic
952079330 3:29738993-29739015 AATAATGCATGTTAAGTGTTTGG + Intronic
952165531 3:30744547-30744569 GCTAATTTTTTTAAAGTTTTTGG - Intronic
952184261 3:30951833-30951855 GATAATGTATGCAAAATACTTGG - Intergenic
952774022 3:37027461-37027483 GATAACGTATGCAAAGTATTTGG - Intronic
952870719 3:37898557-37898579 GATCATGTGTGTAAAGCTCTTGG - Intronic
953317683 3:41943803-41943825 TATAATGTAAGTGAAGTTTGAGG - Intronic
953488003 3:43320899-43320921 AATCATGTTTGTAAAGTTTTGGG - Intronic
954998844 3:54907472-54907494 TTTTATGTATATAAAGTTTTTGG + Intronic
955618174 3:60831657-60831679 GATAATATATGAAAAGTTATTGG - Intronic
955806727 3:62744161-62744183 GATGATGCATATAAAGTATTAGG + Intronic
955867104 3:63396797-63396819 GTTAATGTTTTTAAAGTTTTAGG - Intronic
955896844 3:63709451-63709473 GACAATGTATATAAAGCATTTGG - Intergenic
955985620 3:64571221-64571243 GATGATGCATATAAAGTCTTAGG - Intronic
956069645 3:65434282-65434304 GATAATGTAGGTAAAGTGCCTGG + Intronic
956210038 3:66793083-66793105 GAGAATGTATGTAAAGTGCTTGG - Intergenic
956483421 3:69696095-69696117 GTTAATATATGTAAAGTGCTTGG - Intergenic
956760686 3:72441198-72441220 GATAATGCATTTAATTTTTTAGG - Intronic
956964082 3:74438389-74438411 GAAAATAAATGCAAAGTTTTTGG + Intronic
957330789 3:78760342-78760364 GAAAATTTATGTATAATTTTAGG + Intronic
957430042 3:80092689-80092711 GTTAATTCATATAAAGTTTTTGG - Intergenic
957482994 3:80822560-80822582 AAAAATGTATTTAAAATTTTTGG - Intergenic
957678881 3:83405567-83405589 GATAATGTATGTACATATATTGG - Intergenic
957890295 3:86348325-86348347 GATAATTTTTGTAATTTTTTTGG + Intergenic
958027165 3:88061499-88061521 TATAAAATATGTAAAGTTTCAGG - Intronic
958711834 3:97725994-97726016 GATAATATATGTAAAGTACCTGG + Intronic
959630275 3:108499886-108499908 GATAATGCATTTAAAGTGCTCGG - Intronic
959641036 3:108635152-108635174 GATAATGAATGAAAAGTGGTAGG - Intronic
959835901 3:110917635-110917657 AATAATGTATGTAAAGCAGTTGG - Intergenic
959974484 3:112443309-112443331 GATAATGCAAGTATAGTTTAAGG + Intergenic
960246970 3:115410577-115410599 GATAATATATGCAAAGCATTTGG - Intergenic
960718856 3:120605344-120605366 GATAATCTCTATAAAGGTTTAGG - Intergenic
961331220 3:126140250-126140272 GATAACATATTAAAAGTTTTGGG + Intronic
961626878 3:128270141-128270163 GATAATGTATATAAGGTTCCTGG + Intronic
961933963 3:130563590-130563612 GATGATGTGTGTCATGTTTTGGG - Exonic
961995304 3:131235675-131235697 GATAAGGCATGTAAAGGGTTTGG - Intronic
962062876 3:131949456-131949478 GAAAAGATATGCAAAGTTTTAGG + Intronic
962285225 3:134079429-134079451 GATAATGCATGAAAAGTCCTTGG - Intronic
962555256 3:136543815-136543837 GATAACAAATGTAAAGTATTTGG + Intronic
962810371 3:138954547-138954569 GATAATGCATGTAATGTTCCTGG - Intergenic
963442349 3:145356051-145356073 TAAAATGAAGGTAAAGTTTTAGG + Intergenic
963633476 3:147763492-147763514 GAAGATGTTTGTAAAATTTTTGG + Intergenic
963657833 3:148081571-148081593 AAGAATTTATGAAAAGTTTTTGG + Intergenic
963825951 3:149953614-149953636 GGTTATGTATGTAGAATTTTTGG - Intronic
963866061 3:150362969-150362991 GATTATGAATGAAAGGTTTTGGG - Intergenic
964173991 3:153803495-153803517 GAAAATGTGTGTAATTTTTTTGG + Intergenic
964834950 3:160928232-160928254 GATAATGGATGTAAAATTGTGGG + Intronic
964897919 3:161620501-161620523 GATTAAGTATGTTAAGGTTTAGG + Intergenic
964932404 3:162042843-162042865 GATAATGTTACTGAAGTTTTTGG + Intergenic
965461398 3:168969052-168969074 GGTACTGTATATAAAGTATTTGG - Intergenic
965538641 3:169850725-169850747 GTGAATGCATGTAAAGTTCTTGG + Intronic
965744366 3:171908485-171908507 AATATTGTATGTAATATTTTTGG - Intronic
965845460 3:172955861-172955883 GATAATGAATGTAGAGTGTCTGG + Intronic
966130672 3:176634688-176634710 GATACTGTGTGTAAAGTTCTTGG - Intergenic
966270354 3:178097282-178097304 GATAATGTATGTAAAGCACCTGG + Intergenic
966599390 3:181760397-181760419 GAAAACATATGTAAAGTTCTGGG + Intergenic
966628815 3:182049447-182049469 GATAATGTTTGTAGAGTGCTGGG + Intergenic
966659988 3:182403539-182403561 GATAATGTCTGTAAAGCACTTGG + Intergenic
967048373 3:185758501-185758523 GATAATGCATGTAAAGTACATGG + Intronic
967647576 3:191944857-191944879 GGCAATGTATGGAAACTTTTGGG + Intergenic
969160531 4:5253875-5253897 AATAATGTATGTAAAGTGCCAGG + Intronic
970119410 4:12735894-12735916 GATATGGTATGTAACCTTTTTGG + Intergenic
970125778 4:12808722-12808744 GATAATATATGTAAATCATTTGG + Intergenic
970367898 4:15379407-15379429 GCTAATATATGTAAAATGTTGGG - Intronic
970508137 4:16753942-16753964 GATGGTGCATGTAAAGTTTTTGG - Intronic
970810544 4:20088199-20088221 GATGATATATATAAAGTTTCTGG - Intergenic
970835408 4:20399496-20399518 GTTAATATATGTAAAGTGATCGG + Intronic
970910066 4:21264612-21264634 CTTAATGTTTATAAAGTTTTTGG + Intronic
970935353 4:21563845-21563867 GATAATGGATTTGAAGGTTTAGG + Intronic
970951016 4:21755305-21755327 GATAATAAATGTAACGTTTCTGG + Intronic
971036185 4:22695185-22695207 GATAATGTGTGTTAAGTACTTGG + Intergenic
971512104 4:27439412-27439434 GATAACTTCAGTAAAGTTTTAGG - Intergenic
971604348 4:28638332-28638354 GATATTACATATAAAGTTTTTGG + Intergenic
971676560 4:29637343-29637365 GATAATGCCTGTATATTTTTTGG + Intergenic
971765917 4:30831460-30831482 GATAACATTTGTAAAGTCTTAGG + Intronic
971782800 4:31058649-31058671 TATAATGTAGGTAATATTTTTGG + Intronic
972183513 4:36499336-36499358 GATATTGAATGTAAAATTTCCGG + Intergenic
972232380 4:37089782-37089804 AATAATGTCAGTAAAGTTTCAGG - Intergenic
972377990 4:38491040-38491062 GATAATGTATATAAAGTACTTGG - Intergenic
972388062 4:38586868-38586890 GATAATACATGTAAAGCTCTTGG - Intergenic
972711258 4:41597336-41597358 GTGAATATATGTAAAGTTCTTGG + Intronic
972783476 4:42306206-42306228 GATAATGTGTATAAAGTGTTTGG - Intergenic
972969954 4:44561800-44561822 CATAATGTATGTAAAATACTGGG + Intergenic
974214864 4:58831738-58831760 GAGAATGTATCTCAAGTTTATGG + Intergenic
974686649 4:65240840-65240862 TATAATATATGTAAAGATTTTGG - Intergenic
974816154 4:67006163-67006185 GATTCTGAATGCAAAGTTTTAGG + Intergenic
974978039 4:68916607-68916629 TATAATGTATTTAAAATTCTAGG - Intergenic
974987225 4:69042889-69042911 TATAATGTATTTAAAATTCTAGG + Intronic
975054128 4:69906565-69906587 TATAATGTACATAAAGTATTTGG + Intergenic
975087704 4:70363430-70363452 GATAATGTATGTAATGCATTTGG - Intronic
975223227 4:71838497-71838519 GATAATATATTTAAAGCTATGGG + Intergenic
975780356 4:77832735-77832757 GAAAATGTAAATAAAGTTTCTGG - Intergenic
975886595 4:78973717-78973739 GATAACGCATGTAAAATATTTGG - Intergenic
975915004 4:79314083-79314105 GATCATGTATGTTATTTTTTAGG - Intronic
976050158 4:81002128-81002150 GATAATAAATCTAAAGTTCTTGG + Intergenic
976880141 4:89911860-89911882 AATAATAAATGTAAAGTTTTTGG - Intronic
977530675 4:98196800-98196822 AATAATGTGTGTAAAGTTCTTGG + Intergenic
978219230 4:106250074-106250096 GACAATGTATCTTAACTTTTGGG - Intronic
978233306 4:106426739-106426761 GATAATGCATGGAAAAGTTTTGG - Intergenic
978523875 4:109644833-109644855 CATAATGTATGAATAGCTTTAGG + Intronic
978732903 4:112050878-112050900 GTTAATGTATGTAAATGGTTTGG - Intergenic
978814893 4:112893172-112893194 GATAAAGCATATAAAGTATTTGG + Intronic
979216961 4:118177189-118177211 GATAATGTATGTGAAGGTACTGG + Intronic
979482246 4:121233465-121233487 GATAATGTTTGTAAAGCATCTGG - Intergenic
979632382 4:122918401-122918423 GATAATATATATAAAGTGCTTGG - Intronic
980288749 4:130816218-130816240 GATAATGTCAGTAAAGTTTCAGG - Intergenic
980318186 4:131233823-131233845 GATACTCTATTTAATGTTTTGGG - Intergenic
980651683 4:135725256-135725278 GATGATTTATGAAAAGTTTAGGG - Intergenic
980674099 4:136051797-136051819 GAGAAAGTATGTGATGTTTTGGG + Intergenic
980906439 4:138952861-138952883 AATAATCTCTGTAAACTTTTAGG - Intergenic
981285283 4:143010378-143010400 CATACTGTATGTAAGGTTGTGGG - Intergenic
982572062 4:157062923-157062945 GATATTGTACATAAAGTTTCTGG + Intergenic
982651369 4:158091420-158091442 GGTAATGCATGTAAACTATTTGG + Intergenic
982751143 4:159163641-159163663 GTTAATCTATTTAAATTTTTTGG + Intronic
983028564 4:162769373-162769395 GACAATGTATGTTAAATTTGAGG + Intergenic
983094455 4:163544902-163544924 GATAAGGTATGAAAACTTATAGG + Intronic
983469658 4:168140953-168140975 AAAAATGTATGTAAACCTTTGGG - Intronic
983488304 4:168357876-168357898 GATAATGTAAGAAAAGTGATTGG - Exonic
983611399 4:169649294-169649316 AATAATACATGTAAAGTTTTTGG + Intronic
984131883 4:175886348-175886370 CATAATGTCTGTAAAATGTTGGG + Intronic
984150854 4:176128110-176128132 GAACATGTATGTACAGGTTTTGG + Intronic
984350890 4:178591522-178591544 GAAAATGTTAGTCAAGTTTTTGG - Intergenic
984960428 4:185092162-185092184 GATAACGTTTGTAGAATTTTTGG + Intergenic
986398053 5:7350051-7350073 CATACAGTATGTAAACTTTTGGG + Intergenic
987161956 5:15154193-15154215 GAAAATATATGTGAAGTTTTTGG + Intergenic
988220581 5:28341506-28341528 ATTAACATATGTAAAGTTTTTGG - Intergenic
989141417 5:38205232-38205254 GATACTGTGTGAAAAGTTTGTGG + Intergenic
989303272 5:39919702-39919724 GATAAAGTATGTAAAGTGCCTGG + Intergenic
989535371 5:42557517-42557539 GATAATTTATTTAAAGCATTTGG - Intronic
989658296 5:43769224-43769246 GAAAAAGTATGTAAAATTCTTGG + Intergenic
989741860 5:44783071-44783093 TTTAATGTATGTTAAGTGTTAGG - Intergenic
990493047 5:56320709-56320731 GATAATGCATGTAAAGTATTTGG - Intergenic
990570243 5:57071221-57071243 GTTAATGTATGTAAAATACTTGG + Intergenic
991316713 5:65317271-65317293 GATAATGTTTTTCAAGTGTTTGG - Intronic
991684437 5:69168477-69168499 GTTAATGCATGTAAAATGTTAGG - Intronic
992192111 5:74303367-74303389 GACAATGTATGTGAAGTGCTAGG - Intergenic
992218763 5:74550989-74551011 GCTAATGAAAGTAATGTTTTTGG - Intergenic
992240262 5:74761832-74761854 GTTAGTGTATGTAATGATTTAGG + Intronic
992275792 5:75116875-75116897 GATGATTTATGGAAAGTTTTTGG - Intronic
992484989 5:77186022-77186044 GATAATCTATGTAAAGTGGTTGG + Intergenic
992630572 5:78676301-78676323 GATAATCTACGTCAAGTTATTGG - Intronic
992774155 5:80075361-80075383 GATAATGTAGGTAAAGCTCCCGG + Intronic
992836384 5:80645687-80645709 AATTTTGTATGTAAAGTTTCTGG - Intronic
992926040 5:81588275-81588297 GATAATGTATATAAAGTGTCTGG - Intronic
993825428 5:92679688-92679710 GACAATATATGTAAAGTGCTTGG - Intergenic
994120753 5:96110098-96110120 TCTAATGTATGGAGAGTTTTTGG - Intergenic
994257201 5:97612739-97612761 GAGAACCTATGTAAAATTTTAGG - Intergenic
994345547 5:98681309-98681331 GCTAATGTGTTTAAAGATTTTGG - Intergenic
994583885 5:101681650-101681672 AAGAATATATGTATAGTTTTTGG - Intergenic
994893881 5:105675774-105675796 TATAATATATGTTAAGTGTTTGG + Intergenic
995132428 5:108644506-108644528 GATAATGTAGGGAAAGTATCAGG + Intergenic
995365333 5:111353172-111353194 AATAGTGTATGTAAAGTTCCTGG - Intronic
995923124 5:117337767-117337789 AATTATGTATGTAAAGCTCTAGG + Intergenic
995943086 5:117608540-117608562 GATAATATCTGTAATATTTTTGG - Intergenic
995945569 5:117641015-117641037 TATAAGGTTTGTAAAGTATTTGG - Intergenic
996157930 5:120126646-120126668 GATAATGTAATAAAAGTTTTTGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996497203 5:124172940-124172962 GATAATGTTTGTAAAGAGTTTGG - Intergenic
996862101 5:128079532-128079554 GATTATGAATGTATAGATTTTGG + Intergenic
996915302 5:128704713-128704735 GATAATGTATGTAATGTTCATGG + Intronic
997312995 5:132905142-132905164 GCTAATGTATATAAAATATTGGG - Intronic
997598744 5:135125190-135125212 GACTATGTATGTAAAGCTCTTGG + Intronic
997790743 5:136758551-136758573 GATAAATTCTGTAAAGTTTCAGG - Intergenic
998097305 5:139403485-139403507 GCTAAGGCATGTAAAGTTCTTGG + Intronic
998183784 5:139963592-139963614 GAAAATGCATATAAAGTGTTTGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998610171 5:143680179-143680201 GATAATATATGCAAAATTCTTGG + Intergenic
998671899 5:144362907-144362929 GATGGTGTATGTAAAGTGATTGG + Intronic
998706623 5:144769437-144769459 GATAATGTATGTAAATCATTTGG + Intergenic
998761956 5:145442110-145442132 GATAATATATATGAAGTCTTTGG - Intergenic
998876406 5:146604656-146604678 AATAATGTATTTAAAGCTTGAGG - Intronic
999005261 5:147969256-147969278 GGTAATGTATATAAAGTGTTTGG + Intergenic
999188127 5:149728089-149728111 GATAATATATGTACAGTGCTTGG - Intergenic
999403603 5:151286767-151286789 GTTAATGTATGTAAATAATTTGG + Intronic
999517015 5:152311614-152311636 GATCATCTATATAAAGTATTTGG - Intergenic
999686891 5:154111242-154111264 GATAAAGTATGCAAAGTGCTTGG - Intronic
999788287 5:154912173-154912195 AATACTGTATGTTAACTTTTGGG + Intronic
999845488 5:155474992-155475014 GATGATGCATGTAAAGAGTTTGG + Intergenic
999905654 5:156138423-156138445 GACCATGTATGTGAAGTTTTGGG - Intronic
999939677 5:156528299-156528321 GTTAATTTATGTAAAGCTTATGG + Intronic
999990454 5:157045376-157045398 GATGATGCATGTAAAGTGGTTGG + Intronic
1000627393 5:163554741-163554763 GAAAATGAATATAAAATTTTGGG - Intergenic
1000775202 5:165411102-165411124 AATAATGTATATAAAGCGTTTGG + Intergenic
1000810307 5:165853478-165853500 GATAATGTGTCTAAAGCTTCTGG - Intergenic
1000885837 5:166746348-166746370 TATAATGCATGTAAAGTGATTGG - Intergenic
1001111322 5:168898700-168898722 GAGAATGTATATAAAGTAATGGG + Intronic
1001205080 5:169754861-169754883 GATCATGCATGTAAAGTATTTGG + Intronic
1001246159 5:170106841-170106863 GATAATGTACACAAGGTTTTAGG + Intronic
1001691427 5:173635406-173635428 TATAATGTATGCAAAGTGTGAGG + Intergenic
1001741470 5:174056318-174056340 GATACAGGATGTAAAGTGTTTGG + Intronic
1002316258 5:178345860-178345882 AATAATTTATGAAAAATTTTGGG + Intronic
1003055212 6:2812174-2812196 GATAATGTATGTAAAGTTTCTGG + Intergenic
1003377151 6:5590136-5590158 GATAATGTATTTAAAGTTGGTGG + Intronic
1003651277 6:7962486-7962508 GAAAATGTAAGTAAAATTATAGG + Intronic
1003796398 6:9610094-9610116 GAAAATGTTTTTAAAGATTTAGG + Intronic
1004174812 6:13330242-13330264 GAGAAAGTATGTAAAGTGCTTGG + Intergenic
1004727160 6:18322167-18322189 GATAATCTATATAAACATTTTGG - Intergenic
1004731451 6:18363453-18363475 GCTAATGTATTTAAAGATTTTGG + Intergenic
1005218316 6:23557146-23557168 GATAATGTATGTAAATTACCTGG - Intergenic
1005409910 6:25533479-25533501 GATAATGCTTGAAAAGTATTTGG + Intronic
1005737611 6:28763393-28763415 CATAAATTATTTAAAGTTTTTGG - Intergenic
1007534175 6:42570224-42570246 TATAATGGTAGTAAAGTTTTTGG + Intronic
1007616555 6:43183000-43183022 GATCATGTATGTAAAGCACTTGG - Intronic
1008035369 6:46739658-46739680 AATAATGCATGTAAAGTGCTTGG + Intergenic
1008677561 6:53836398-53836420 TATAATCCATGTAAAGTGTTTGG + Intronic
1008785992 6:55168843-55168865 GTTAATGTATGTAACGTACTTGG + Intronic
1008928575 6:56913235-56913257 GATAATGCATGCATAGTATTTGG - Intronic
1009270897 6:61612650-61612672 AATAATATATGTAAAGTGCTTGG - Intergenic
1009326142 6:62349689-62349711 GATTTTGTATGTCATGTTTTGGG - Intergenic
1009386674 6:63092864-63092886 TATAATGAATGGAGAGTTTTTGG + Intergenic
1009400061 6:63244118-63244140 GAAAATTAATTTAAAGTTTTTGG + Intergenic
1010009373 6:71032446-71032468 GATAATATATATAAAGTGTCTGG + Intergenic
1010258228 6:73785108-73785130 AATAATTTATGTGAAGTGTTTGG + Intronic
1010577883 6:77555499-77555521 GATATTGTATGAACAGTTTTAGG - Intergenic
1011115938 6:83891797-83891819 GAACATGTATGGAATGTTTTAGG + Intronic
1011636004 6:89373989-89374011 GAAAATTTATGTACAGTTTTAGG - Intronic
1011659659 6:89583391-89583413 GATAATGCATGGAAAATTATGGG + Intronic
1012179330 6:96131731-96131753 CATAATGTCTGCAAAGTTATAGG - Intronic
1013521184 6:110935269-110935291 GTCAATGTATGTAAGGTATTTGG - Intergenic
1013799777 6:113929583-113929605 GATCATGTAAGTTAGGTTTTGGG + Intergenic
1013968404 6:115984362-115984384 GATAATGTGTGTGAAGGTCTTGG - Intronic
1014245985 6:119069034-119069056 GAAAATATATGTGAAGTATTAGG + Intronic
1014315129 6:119854920-119854942 CATACTGTATGTACAGTATTTGG - Intergenic
1016115084 6:140271087-140271109 GATAATATATACAAAGTGTTGGG - Intergenic
1016253450 6:142074255-142074277 GATAGTAAATGTAAAGCTTTAGG + Intronic
1016658685 6:146550170-146550192 GATGATGTTTGAAGAGTTTTAGG + Intronic
1017109338 6:150917674-150917696 GATAAGGTATATAAAGTTCTTGG - Intronic
1017519394 6:155188088-155188110 GATAATGTGTGCAAAGTTCCCGG + Intronic
1018990113 6:168668233-168668255 GTTAATGTATGTAAAGTGCTTGG + Intronic
1020376590 7:7494197-7494219 GATAATGTATGTAACATGTCTGG - Intronic
1020473724 7:8569977-8569999 GACAATGTATGTAAAATAGTTGG + Intronic
1020485180 7:8712647-8712669 GATAATGCTTGTAAAGTTTTTGG - Intronic
1020547518 7:9552057-9552079 GATAATGTTGGTAAAATTGTGGG + Intergenic
1020960135 7:14792274-14792296 AATAATGAATGTAAGGTATTTGG + Intronic
1020989127 7:15174048-15174070 GATGATGTTTGTAAAATATTGGG + Intergenic
1021101892 7:16593867-16593889 GATAATGTATGTCAAGTGCTAGG + Intergenic
1021300162 7:18962776-18962798 GATAATATATGTAAATACTTAGG - Intronic
1021778373 7:24076140-24076162 TGTAAGGTATGTAAACTTTTTGG + Intergenic
1022213588 7:28236159-28236181 GATAATGTATGTAAAGTACATGG + Intergenic
1022329155 7:29361134-29361156 AATAATGTATGTCAATTCTTGGG - Intronic
1022395045 7:29980137-29980159 GATAATATATGTAGAGTGTCAGG + Intronic
1022513436 7:30958956-30958978 GATACTTTATGAAAAGTTTAAGG + Intronic
1022570877 7:31453150-31453172 GATGGTGTATGTAAAGTGTGTGG - Intergenic
1024517980 7:50276568-50276590 GATTATGTAAGTAAAGTGATTGG + Intergenic
1025195089 7:56926378-56926400 GATAATGTAAGTGAAGTTTCTGG - Intergenic
1025249188 7:57340564-57340586 GTTAATATAGGTAAAGTGTTTGG + Intergenic
1025273843 7:57555204-57555226 GATCATATATGGAAAGTATTAGG - Intergenic
1025676863 7:63650565-63650587 GATAATGTAAGTGAAGTTTCTGG + Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1027503276 7:78982390-78982412 GGATATGTCTGTAAAGTTTTTGG + Intronic
1027619945 7:80471918-80471940 GATTGTGTATGTAGAGTGTTTGG + Intronic
1027753736 7:82184873-82184895 GATAATTTCTGTAAAGTGCTTGG - Intronic
1027857352 7:83529512-83529534 CAAAATGTTTGTAAATTTTTTGG - Intronic
1028153644 7:87405245-87405267 TATACAGTATGTAAACTTTTGGG - Intronic
1028204711 7:88003263-88003285 GATAATGAATATAAAGTTTCTGG - Intronic
1028247574 7:88499591-88499613 GATAATGTAGGTGAAGTGTCTGG + Intergenic
1028480386 7:91298177-91298199 GATAATATAAGAAAAGATTTAGG - Intergenic
1028500784 7:91516879-91516901 GATGATATATGTAAAGCCTTTGG - Intergenic
1029572753 7:101381487-101381509 TATAATGTATGAAAATTTATTGG + Intronic
1030043265 7:105471294-105471316 GATACTCTTTGGAAAGTTTTTGG + Intronic
1030050923 7:105536974-105536996 GAAAATCTATGTAAAATGTTAGG - Intronic
1030171946 7:106611705-106611727 GATACAGAAAGTAAAGTTTTAGG + Intergenic
1030196026 7:106854516-106854538 AATAATTTATGTAACGTTTAAGG - Intergenic
1030539310 7:110809920-110809942 CAAAGTGTATGTAAAGCTTTTGG - Intronic
1030635878 7:111948153-111948175 GATAATTTATGTAAAGTCCTTGG - Intronic
1031510724 7:122646151-122646173 GATAATGTTTATAAAAATTTAGG - Intronic
1031863045 7:127005052-127005074 GATTACGTATGTGAAGTCTTGGG + Intronic
1031900595 7:127406024-127406046 GATAATGGATATAAAGTGTCTGG - Intronic
1032022278 7:128414916-128414938 GATAACACATGTAAAGTTCTTGG + Intergenic
1032273765 7:130436524-130436546 CACAATGTATGTATAGTTCTAGG - Intronic
1032470075 7:132171879-132171901 GATAATGTATGTAAAGTGCTTGG + Intronic
1032628668 7:133622584-133622606 GATCATGTATGCAACGTTTGGGG - Intronic
1032712822 7:134476118-134476140 GATAATGTGTGCAGAGTTTATGG - Intergenic
1032818123 7:135497996-135498018 GTTAATGTATATAAAGTGCTTGG - Intronic
1034003060 7:147437968-147437990 GATAAATTATGTAAAGTTGCAGG - Intronic
1034572611 7:151969283-151969305 GGAAATGAATTTAAAGTTTTAGG + Intronic
1034613727 7:152396127-152396149 GATAGTGTTTGTAATGCTTTGGG - Intronic
1034886762 7:154804265-154804287 GATAATGTCTGTAAAGCACTTGG - Intronic
1035820055 8:2580980-2581002 AATAATGTTTGTATAGGTTTCGG - Intergenic
1035886567 8:3297715-3297737 GATAATATTTGTATAGCTTTGGG + Intronic
1035941018 8:3901097-3901119 GTTAATGTGTGTATACTTTTGGG + Intronic
1035947281 8:3979209-3979231 AATAATGTATAGGAAGTTTTAGG + Intronic
1037049741 8:14357678-14357700 GATAATACATATAAAGTGTTTGG - Intronic
1037251277 8:16897430-16897452 AATAATGCATGTAAAGCTTGTGG - Intergenic
1037706721 8:21321627-21321649 GATAATATAGATAAAGTCTTTGG + Intergenic
1038773602 8:30507370-30507392 TATAGTGTATGTAAAGTACTAGG + Intronic
1038882952 8:31635006-31635028 GGCAATATATGTAAAGTTTAAGG - Intergenic
1039083453 8:33756610-33756632 AATAATGCAGGTAAAGTTCTTGG - Intergenic
1039530803 8:38259971-38259993 GATAATATATGTAAAACATTTGG + Intronic
1039638139 8:39188579-39188601 GTTAATATATGTAAAGTGCTTGG - Intronic
1040566557 8:48572697-48572719 GATAATTTATTTAACCTTTTTGG + Intergenic
1040867114 8:52059154-52059176 GATACAGTATGTGAAGATTTAGG - Intergenic
1041242618 8:55861278-55861300 GATAATGTATGCAAATACTTGGG + Intergenic
1041597465 8:59672828-59672850 GATAATGTATATAAAGTACCTGG + Intergenic
1041850914 8:62391222-62391244 GATAAGGTACATATAGTTTTGGG - Intronic
1042029752 8:64463173-64463195 AATAAAATATGTCAAGTTTTGGG + Intergenic
1042042912 8:64613608-64613630 GAAAATTTGTGTAAAATTTTGGG - Intronic
1042125553 8:65534281-65534303 GTTCATGTATATAAAGTATTTGG - Intergenic
1042280065 8:67046392-67046414 AGTAATGCATATAAAGTTTTTGG + Intronic
1043637706 8:82407157-82407179 TTTAATATATGTAGAGTTTTGGG - Intergenic
1043863062 8:85343715-85343737 GGCAATTTATTTAAAGTTTTAGG + Intronic
1044043898 8:87405325-87405347 AATGATGCATGTAAAGTATTTGG + Intronic
1044122704 8:88417340-88417362 TATAATGTATTTCAAGTTGTTGG + Intergenic
1044228972 8:89752544-89752566 CATCATGTATTAAAAGTTTTGGG + Intergenic
1044358267 8:91251613-91251635 GATAATGTATGTAAGGGTTTAGG - Intronic
1044398154 8:91738385-91738407 GATAATGTATGTAAAGAGTTTGG - Intergenic
1044571050 8:93719447-93719469 GAAAATGCATGTAAAGCTTTGGG - Intronic
1044642536 8:94398993-94399015 GTTAATCAATGTAAAGTTCTTGG - Intronic
1044711372 8:95061565-95061587 TATAATGAATGTATATTTTTTGG + Intronic
1045321071 8:101081490-101081512 GATAATGCATGCAAAATATTTGG + Intergenic
1045396706 8:101767962-101767984 AATAAAATATGCAAAGTTTTTGG - Intronic
1045509250 8:102801283-102801305 GATAAATTCAGTAAAGTTTTAGG + Intergenic
1045632729 8:104145478-104145500 GAAAAAGTGTTTAAAGTTTTGGG - Intronic
1045704754 8:104909203-104909225 GATAATGTATATTAAGTACTTGG + Intronic
1045736768 8:105305283-105305305 GTTAATATATGTAAAGTGCTTGG - Intronic
1045894659 8:107200246-107200268 GATATTGTAAGTAAAGATTTGGG + Intergenic
1046112023 8:109736985-109737007 GATACCATATGTAAAGTGTTTGG + Intergenic
1046237790 8:111449264-111449286 GATGATGTATGTAAAGTTAATGG - Intergenic
1046241025 8:111492969-111492991 GATAATTTTTTTAATGTTTTGGG + Intergenic
1047014540 8:120709886-120709908 GATGATATATGTAAAGTGTCTGG + Intronic
1047525185 8:125626946-125626968 AATAATCTATGTAAAATGTTTGG - Intergenic
1047621793 8:126615253-126615275 GATAATGTATTTAACTTATTTGG + Intergenic
1047694735 8:127392182-127392204 AATAATGTATGTTAAGTTTCTGG + Intergenic
1047903435 8:129448479-129448501 GATCATACATGTAAAGTGTTTGG + Intergenic
1048264752 8:132975671-132975693 GATAGTGCATGCAAAGTGTTTGG - Intronic
1048311781 8:133328394-133328416 AATAATGCATGTAAAGTGCTTGG - Intergenic
1048338203 8:133518743-133518765 GATAATTTATTCAAAGTGTTTGG - Intronic
1048420219 8:134270833-134270855 GATAATGTGTGTGATGTTTCTGG - Intergenic
1048423811 8:134304130-134304152 GATAATGAATCCAAAGTTATAGG + Intergenic
1048639128 8:136333445-136333467 CATACTGTATGCAATGTTTTAGG + Intergenic
1050008728 9:1163114-1163136 TGTAATGTTTGTAAAGTTCTTGG + Intergenic
1050506726 9:6356414-6356436 GATAATATATGTGAAGTCCTTGG - Intergenic
1050856911 9:10369957-10369979 AATAATATATGTATAGTATTAGG - Intronic
1051036949 9:12759004-12759026 GATAAGGTATGTAAAGTGTCTGG + Intergenic
1051162950 9:14229535-14229557 AATAATGTATGTAAAGTTTGTGG + Intronic
1051208592 9:14716453-14716475 GATAATGTATGCAAATTTTAAGG - Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1051414717 9:16826979-16827001 GTTAATGTATGTAACTTTTTTGG + Intronic
1051583302 9:18700681-18700703 AGTAAAGTATGTAAATTTTTTGG + Intronic
1051586562 9:18732891-18732913 AATAATGTATATAAAGTGATGGG - Intronic
1052283672 9:26760660-26760682 GGTAATGTATGGAAATTTTGCGG - Intergenic
1052632125 9:31055108-31055130 GATAATGAATTCAAAGGTTTAGG - Intergenic
1052835302 9:33245794-33245816 AATAATGTATGTAAACTATTTGG - Intronic
1054935991 9:70688285-70688307 AATAATTTTTTTAAAGTTTTGGG - Intronic
1055543308 9:77338547-77338569 GATTGTGTATGTAAAGGATTTGG + Intronic
1055551468 9:77435676-77435698 GATAATGTATGTAGAGGCCTTGG - Intronic
1055683657 9:78745237-78745259 TATAATAACTGTAAAGTTTTTGG + Intergenic
1056682823 9:88734062-88734084 GATTATGCATGTAAAATTCTTGG - Intergenic
1057538185 9:95936871-95936893 CATAAAGTATGTAACCTTTTGGG + Intronic
1057539216 9:95949538-95949560 GATAATATATTTAATGTATTGGG + Intronic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1057809754 9:98248718-98248740 GATGACGCATGTAAAGTGTTGGG + Intronic
1057859844 9:98632325-98632347 GATAATGTATGTAAAATGTCTGG + Intronic
1057991154 9:99771566-99771588 GATAATGTATTTAGGTTTTTTGG + Intergenic
1058553509 9:106140872-106140894 GATAATGTATGCAAAATATCTGG + Intergenic
1058642670 9:107102503-107102525 CATAATGTATGTAAAGTGCCTGG + Intergenic
1059188131 9:112295867-112295889 GATATTGTAGGTAAAGGTTCGGG + Intronic
1059323730 9:113489038-113489060 GATAATGTATGTAAAGTGCTTGG - Intronic
1059416248 9:114164227-114164249 GATCATGCCTGTAAAGTATTTGG + Intronic
1059711660 9:116873233-116873255 GATAATGTAGGTAAAGCATTAGG + Intronic
1059835447 9:118147016-118147038 GATAATGTCTATAAAGTTTTTGG + Intergenic
1060039730 9:120289587-120289609 GGTAATGTCTGTAAAGTGTGTGG + Intergenic
1060292791 9:122319675-122319697 AATAATGCATGTGAAGTTTTAGG + Intronic
1060382250 9:123187052-123187074 GTTAATATATGAAAAGTCTTAGG - Intronic
1060392084 9:123286103-123286125 GATATTGTGTTTTAAGTTTTGGG + Intergenic
1060478235 9:124000564-124000586 AATAATGTCTATAAAATTTTAGG - Intergenic
1060509284 9:124220353-124220375 GATAATGTAGGTAGAGTGTTTGG + Intergenic
1060595872 9:124848566-124848588 ATTAATGTATGTAAAGTGCTTGG - Intergenic
1060641646 9:125243774-125243796 GAAAATGTATGTAAAATGTCTGG - Intergenic
1060685059 9:125602713-125602735 GATAATGTATGAAAAGTGCTTGG - Intronic
1060804584 9:126566513-126566535 GATAATGTATGTAAAGTGTTTGG - Intergenic
1061274395 9:129561220-129561242 GATATTGTATGGAAAGTGGTAGG + Intergenic
1185761920 X:2694998-2695020 GATACTGTCTGGAATGTTTTCGG + Intronic
1186225675 X:7396512-7396534 GATTATTTTTGTAAAGTTTATGG + Intergenic
1186365496 X:8888577-8888599 GAAAATGAATGTAAACTTTTGGG + Intergenic
1186600075 X:11027365-11027387 GATAATGAATGGAGAGTTCTGGG - Intergenic
1186998936 X:15155372-15155394 GATGATGGATATAAAGTTTCAGG - Intergenic
1187020305 X:15374596-15374618 GATAACGTAAGTGAATTTTTGGG + Intronic
1187235391 X:17462544-17462566 CATAACGTATGTAAAGTACTTGG - Intronic
1187398795 X:18941172-18941194 GAAATTGTGTGTAAAGTTTGAGG + Intronic
1187546645 X:20260726-20260748 GATAATATATGTAAAGTACTTGG - Intronic
1187995119 X:24917896-24917918 GACAATGCATATAAAGTGTTTGG - Intronic
1188103659 X:26122372-26122394 AATAATGTATGTTAAGCTTTAGG + Intergenic
1188715417 X:33454428-33454450 GATAACTTCTGTAAAGTTTCAGG + Intergenic
1189067214 X:37823174-37823196 GATGAAGTATGTAAAGTTCCAGG - Intronic
1189455321 X:41182542-41182564 GACAATGTATGTCAAGTCTTTGG + Intronic
1189534082 X:41918783-41918805 GATTATGTATGTAATATTTTGGG - Intronic
1189544481 X:42027423-42027445 GATAATGAATTTAGTGTTTTAGG + Intergenic
1189642630 X:43089211-43089233 GATAATGGATGAAAAGCTCTCGG + Intergenic
1190453015 X:50599504-50599526 GATTATGCATGCAAAGTGTTTGG + Intronic
1190462281 X:50689453-50689475 GATGATGTGGGTAAAGTCTTAGG - Intronic
1191157500 X:57290113-57290135 CATAATATATATAAAGTTCTTGG + Intronic
1191868763 X:65727558-65727580 GATGATGGATGTAAGGTTCTTGG + Intronic
1191898517 X:66018252-66018274 GATAATGCATGTAAAGCCTTTGG - Intergenic
1192295271 X:69841174-69841196 AATAATGTATCTAAAATTCTAGG + Intronic
1193678956 X:84493728-84493750 GATTAGGTATTTATAGTTTTAGG - Intronic
1193952077 X:87811836-87811858 GATAATGCAAGTAAAGTGTTTGG + Intergenic
1194325621 X:92512951-92512973 GATGATGTATCCAATGTTTTTGG + Intronic
1194407606 X:93516563-93516585 GATACTATATGTAAACTTCTTGG + Intergenic
1194674049 X:96772058-96772080 GCTACTGTATATAAAATTTTGGG + Intronic
1194814008 X:98420531-98420553 GAGAAGGTATCAAAAGTTTTCGG + Intergenic
1194963641 X:100263724-100263746 TATAAAGTAGGTAAGGTTTTAGG - Intergenic
1195120319 X:101743737-101743759 GACAATCTATGGAAAGTGTTTGG + Intergenic
1195420249 X:104667452-104667474 GACAATGTATGTAAAGTGCCTGG - Intronic
1195488297 X:105436144-105436166 AATAAAGTATGTAACTTTTTGGG - Intronic
1195806572 X:108778164-108778186 GAAAATGTATGTACAGTTGAAGG + Intergenic
1195843474 X:109200687-109200709 GATAATGTATATAAAGTTCCAGG + Intergenic
1195918030 X:109955010-109955032 ATTAATGTATGTAAAGTATTTGG + Intergenic
1196024661 X:111028709-111028731 AATAATGTTTGTAAAGTACTTGG - Intronic
1196063898 X:111441725-111441747 GATAATGGTTGTAAAGTATTTGG + Intergenic
1196156065 X:112431740-112431762 ATTATTGTATGTTAAGTTTTAGG + Intergenic
1196157519 X:112447322-112447344 GATAATATATGTAAATTTCCTGG - Intergenic
1196491444 X:116272216-116272238 TAAAATGTATGTAAATTTTAAGG - Intergenic
1196586119 X:117430184-117430206 CATAATGTATGTAAAAATTCTGG - Intergenic
1196717087 X:118822665-118822687 GAAATTGTATGCAAAGATTTCGG - Intergenic
1196748665 X:119094928-119094950 GATAATGCATGTATAGGGTTTGG + Intronic
1197134339 X:123043475-123043497 GATAATAAAGGTAAAGTATTTGG + Intergenic
1197292015 X:124670081-124670103 TATAATCCATGTAAAGTTTCTGG + Intronic
1197295658 X:124716417-124716439 GATCATGGGTGGAAAGTTTTAGG - Intronic
1197579786 X:128267759-128267781 ATTAGTGTTTGTAAAGTTTTAGG - Intergenic
1197707192 X:129642575-129642597 GATGATGCAGGTAAAGTTTTTGG - Intergenic
1197826196 X:130593024-130593046 GATAATATATGTAAGGTGTTTGG - Intergenic
1198159749 X:133995985-133996007 GATTATGTAGGTAAAGTGTCTGG + Intergenic
1198509773 X:137338610-137338632 GATAATATATGTAAAGCACTTGG + Intergenic
1198545591 X:137689372-137689394 GATAATACATGTGAAGTATTAGG - Intergenic
1198551102 X:137745629-137745651 GATAATATCTGTAAAGTGTCTGG + Intergenic
1198649342 X:138844338-138844360 TATAATGCCTGTAAAGTTTAAGG - Intronic
1198709794 X:139489073-139489095 GATAATGTATGTAAAATATGTGG - Intergenic
1199027334 X:142955459-142955481 TATAACGTATGAAACGTTTTTGG + Intergenic
1199638365 X:149835252-149835274 TAAAATGAATGTATAGTTTTAGG - Intergenic
1201595270 Y:15661146-15661168 GATTATTTTTGTAAAGTTATAGG + Intergenic